Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Chemistry

Flow-modèle Fabrication guidée de haute densité Barcode puces à anticorps

doi: 10.3791/53644 Published: January 6, 2016

Summary

Ce protocole décrit la fabrication d'une grande échelle, deux dimensions ADN ou anticorps réseau multiplexé, avec des applications potentielles dans les études de signalisation cellulaire et la détection de biomarqueurs.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Biopuces d'anticorps ont été largement utilisés dans les études protéomiques pour les décennies à examiner la présence de protéines ciblées, y compris des biomarqueurs protéiques 1-3. Bien que ce domaine est actuellement confronté à de grands défis d'autres technologies à haut débit telles que la spectrométrie de masse (MS), il ya encore beaucoup de place pour l'utilitaire de puces à anticorps, principalement parce que ces appareils offrent l'interprétation des données interface simple et facile avec les autres tests. Au cours des dernières années, l'intégration de puces dans des échafaudages de puces a fourni la puce anticorps une nouvelle opportunité de prospérer 4-7. Par exemple, la puce de code à barres intégré dans une puce à cellule unique a été utilisé dans des études de communication cellulaire 8,9. Cette technologie présente des avantages distinctifs par rapport aux autres technologies de microréseaux disponibles. Il dispose d'éléments de tableau à 10-100 um, beaucoup plus petit que le type 150 um taille utilisée dans elemen de biopuces classiquests. La construction d'éléments de réseau est obtenue en utilisant de plus petites approches systématiques structuration d'écoulement, ce qui donne lieu à des puces à ADN compacts capables de détecter des protéines à cellule unique sécrétées et des protéines intracellulaires. Un autre avantage est l'utilisation d'une configuration simple, sans instrument. Ceci est particulièrement important, car la plupart des laboratoires et les petites entreprises peuvent ne pas être en mesure d'accéder microarray installations de base. Un tel code barre, des puces à anticorps disposent améliorées dosage et le débit peuvent être utilisés pour effectuer des tests hautement multiplexés sur des cellules individuelles tout en obtenant une haute sensibilité et une spécificité comparable à celle de dosage immuno-enzymatique en sandwich classique (ELISA 8). Cette technologie a trouvé de nombreuses applications dans la détection de protéines à partir de glioblastome 11.9, les cellules T 12, et des cellules tumorales circulantes 13. Alternativement, les puces à ADN de code à barres seuls ont été utilisés dans le positionnement précis de neurones et les astrocytes pour Mimicknant l'assemblage in vivo des tissus du cerveau 14.

Ce protocole se concentre uniquement sur les étapes expérimentales et blocs accumulation de deux dimensions (2-D) code à barres anticorps microarray qui a des applications potentielles dans la détection de biomarqueurs dans des échantillons fluidiques et dans des cellules individuelles. La technologie est basée sur une adressable simple brin, à une dimension (1-D) puces à ADN construit en utilisant des oligonucleotides qui sont orthogonales à motifs dans l'espace sur des substrats de verre. Le modèle 1-D est formé lorsque les canaux d'écoulement parallèles sont utilisés dans l'étape de flux de motifs, et un tel motif apparaît comme bandes discrètes visuellement similaires à 1-D Universal Product Code (UPC) des codes à barres. La construction d'un 2-D (n x m) réseau d'anticorps - rappelle un 2-D Quick Response (QR) code matriciel - a besoin de stratégies de mise en forme plus complexes, mais permet l'immobilisation d'anticorps à une densité plus élevée de 8,15. La fabricationADN nécessite deux étapes de mise en forme, avec le premier motif perpendiculaires à la seconde. Les points d'intersection de ces deux modèles représentent les m éléments de la matrice n x. En sélectionnant stratégiquement les séquences d'ADN simple brin (ADNsb) utilisé dans l'écoulement de motifs, chaque élément dans un tableau donné se voit attribuer une adresse spécifique. Cette référence spatiale est nécessaire de distinguer entre les signaux de fluorescence sur la lame de microréseau. La matrice ADN à un brin est converti en une série d'anticorps par incorporation de conjugués d'ADN-anticorps complémentaires, formant une plate-forme appelée bibliothèque d'anticorps codé par l'ADN (DEAL 16).

Ce protocole vidéo décrit les étapes clés dans la création de tableaux nxm d'anticorps qui comprennent la préparation (PDMS) de moules de codes à barres, flux-structuration ADNsb dans deux orientations, préparation d'un anticorps-oligonucléotides conjugués DEAL, et en convertissant le tableau 3 x 3 d'ADN dans un 3x 3 anticorps tableau.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Attention: Plusieurs produits chimiques utilisés dans ce protocole sont irritants et sont dangereux en cas de contact avec la peau. Consultez les fiches de données de sécurité (FDS) et porter un équipement de protection individuelle approprié avant d'effectuer ce protocole. La solution de piranha utilisé dans l'étape (1.1.1) est très corrosif et doit être préparé en ajoutant du peroxyde lentement à l'acide avec agitation. Manipuler cette solution avec une extrême prudence dans une hotte. Utilisez des lunettes de protection et des gants résistant à l'acide. Trimethylchlorosilane (TMCS) est un produit chimique inflammable corrosif utilisé dans une étape facultative après (1.1.6). Manipuler ce produit chimique dans une hotte.

Remarque: Effectuez la fabrication barres de slide et procédures flux-patterning critiques dans une chambre propre pour minimiser la contamination par les matières particulaires. Les particules de poussière peuvent bloquer les ports et les microcanaux de moules PDMS et interférer avec le flux-structuration.

1. Construction de l'Un-dimensionaL 'ADN Barcode diaporama

  1. Préparation du maître SU-8 pour les modèles de flux de code-barres
    Remarque: Les dessins pour les modèles d'écoulement perpendiculaires (figure 1A-B) sont créés en utilisant un (CAO) de conception assistée par ordinateur. Ces motifs sont rendus sur un masque photographique en chrome. Les zones transparentes du masque correspondent aux caractéristiques du maître SU-8.
    1. Nettoyer une tranche de silicium (diamètre 100 mm) à fond dans un mélange de 3 H 2 SO 4: 1 30% de H 2 O 2 (solution piranha) chauffée à 96 ° C. Laver la plaque avec de l'eau désionisée et d'alcool isopropylique, puis on sèche avec un pistolet de soufflage d'azote.
    2. Verser environ 4 ml de SU-8 2025 photorésist sur la plaquette. Utilisez une tournette programmable pour étaler uniformément la résine photosensible sur la plaquette pendant 10 secondes à 500 tours par minute, puis 30 secondes à 3000 tours par minute. Cela crée une couche de résine photosensible d'une épaisseur de 25 um ~. Permettent progressivement tourne à ralentir avant d'arrêter - ce qui est à Maintain un revêtement uniforme sur la surface de la plaquette.
    3. Cuire la plaquette revêtue sur une plaque chauffante pendant 1 min à 65 ° C, puis pendant 5 min à 95 ° C. Cette étape permet le revêtement se solidifier. Refroidir à température ambiante pendant 5 min.
    4. Placer le masque de chrome (figure 1C) sur la couche de résine photosensible. Exposer les caractéristiques de masque à la lumière proche UV (350-400 nm, énergie d'exposition 150-160 mJ / cm 2) pendant 20 secondes.
      Remarque: Le dessin sur le masque de chrome contient 20 chaînes, dont chacun est 20 m de large avec 50 um terrain. Les canaux sont sinueuses d'une extrémité du motif à l'extrémité opposée. Au total, les 20 canaux couvrent une zone rectangulaire d'une longueur de ~ 40 mm et une largeur de ~ 20 mm. Chaque canal est flanqué de deux éléments circulaires qui correspondent à une entrée et une sortie. Entrées et sorties sont interchangeables.
    5. Cuire au four de la tranche exposée sur une plaque chauffante pendant 5 min à 95 ° C. Refroidir à température ambiante progressivement.
    6. Plonger la plaquette dans SU-8 développeur avec agitationpendant 5 min. Laver la plaquette avec une petite portion des frais SU-8 développeur, suivi par l'alcool isopropylique. Séchez la plaquette en utilisant un pistolet à azote. Hard-cuire la galette sur une plaque de cuisson de 200 C ° pendant 30 min, et permettre à la plaquette de refroidir progressivement à la température ambiante.
      Remarque: Le développement peut être effectué pendant une durée plus longue si un film blanc est observé après lavage dans l'étape suivante.
      Facultatif: silaniser le maître SU-8 en l'exposant à Trimethylchlorosilane vapeur dans un boîte de Pétri fermée pendant 10 min.
  2. Préparation du code à barres moule PDMS
    1. Combiner 40,0 g silicone base élastomère avec 4,0 g agent de durcissement. On agite le mélange de prépolymère vigoureusement pendant 10 min. Degas pendant 20 min sous vide.
      Remarque: En règle générale, utiliser un 10: 1 (base: durcisseur) rapport de masse.
    2. Verser le prépolymère dans une boîte de Pétri contenant une plaquette de silicium avec le maître SU-8 du motif de code à barres. La hauteur du mélange PDMS devrait être d'environ 7,5 mm ou plus. Dégazer le mélange dans la Petri plat pour une seconde fois pour éliminer les bulles restantes, puis cuire le mélange pendant 1 heure à 75 ° C pour permettre PDMS pour guérir.
      Remarque: Il est important de maintenir suffisamment d'épaisseur de la dalle PDMS à ~ 7,5 mm ou au-dessus pour éviter d'ajouter trop de tension à la liaison PDMS-verre lors de l'insertion de broches / tube à travers des trous dans le moule PDMS dans l'étape (1.3.3.1)
    3. Avec un scalpel, couper soigneusement autour de la zone de la dalle PDMS qui contient les caractéristiques de moules de codes à barres et le zeste de la dalle de la plaquette.
    4. Couper les bords de la dalle pour atteindre la forme désirée du code à barres moule PDMS. Percez des trous 20 (diamètre de 1,0 mm) à travers le moule à l'aide d'un poinçon de biopsie avec piston. Faire en sorte que les trous soient alignés avec les fonctions circulaires du motif de code à barres. Ces trous servent les entrées et sorties.
  3. Un motif unidimensionnel de poly-L-lysine (PLL)
    1. Enlever la poussière sur la surface d'une lame de verre revêtue de poly-L-lysine en utilisant un pistolet à azote. Attach le moule PDMS à la lame de verre propre. Faire en sorte que les bords du moule et la coulisse sont alignées.
    2. Cuire au four pendant 1,5 heure à 75 ° C pour renforcer le lien entre le moule PDMS et la diapositive PLL-enduit. Pendant ce temps, préparer 20 des morceaux de tuyaux en polyéthylène souple (3 à 4 pouces morceaux, avec un diamètre intérieur de 0,5 mm et un diamètre extérieur de 1,5 mm).
      Remarque: Le nombre de morceaux de tube correspond au nombre d'entrées dans le code-barres moule PDMS. Le tube sert à coupler les canaux sur le code à barres moule PDMS à un réservoir d'azote gazeux équipé d'un régulateur de pression.
    3. À une extrémité de chaque morceau de tube, fixer une broche creuse en acier inoxydable (diamètre 1 mm). Aspirer stérilisée par filtration de poly-L-lysine solution à travers la broche, jusqu'à ce que au moins 1 cm du tube est rempli avec la solution.
      1. Fixer les broches (connectés à un tube rempli de solution) aux entrées du code à barres PDMS moule (figure 1E). Connectez l'autre extrémité des tubesun réservoir d'azote sous pression régulée set-up. Laisser la solution de circuler à travers le moule en utilisant une plage de pression de 0,5-1 psi pendant au moins 6 heures.
        Remarque: Reportez-vous à l'étape (1.3.3) pour toutes les procédures flux-structuration.
  4. Formation de motifs à une dimension de 14 ADNsb
    Remarque: La solution saline tamponnée au phosphate (PBS) utilisée dans les étapes suivantes est préparé à partir de 137 mM de NaCl, 10 mM de Na 2 HPO 4, et 2 mM de KH 2 PO 4. Le pH du tampon est de 7,4.
    1. Préparer bis (sulfosuccinimidyl) subérate (BS3) solution 2 mM dans PBS. Préparer 300 uM de solutions A, B, C et ADNsb (5'-amine modifié, de 80 nucleotides) dans du PBS ou de l'eau ultrapure.
      Remarque: Utilisez la solution de BS3 dans environ 30 min après la préparation, car l'ester hydroxysuccinimide N subit facilement hydrolyse.
    2. Moissonneuse 2,5 pi de 300 pM de A, B, C ou ADNsb avec 2,5 ul de 2 mM de bis (sulfosuccinimidyl) subérate dans du PBS pour chaque canal. A, B, C et l'ADN sont désignés à des canaux 1, 2, et 3, respectivement. Cette commande est également appliqué aux séries restantes de 3 canaux (figure 2A).
    3. Effectuez l'étape (1.3.3). Cette fois, aspirer les solutions BS3 / ADN 5 pi par des broches en acier inoxydable et dans le tuyau de polyéthylène, puis quelques moule PDMS à la source d'azote. Laisser la solution BS3 / ADN de circuler à travers le moule de codes à barres pendant environ 40 min ou jusqu'à ce que les canaux sont remplis.
    4. Arrêter l'écoulement une fois tous les canaux sont remplis, puis incuber la solution BS3 / ADN dans le code à barres à la température ambiante pendant 2 heures. Ne laissez pas la solution à sécher. Cuire le moule PDMS avec toboggan de codes à barres attachée pendant 1 heure à 75 ° C.
      Remarque: Pour faciliter le réglage dans des étapes ultérieures d'écoulement formation de motifs, les bords de la configuration de canal sur le coulisseau de code à barres peuvent être décrites. Ceci est fait en grattant soigneusement la surface de verre en utilisant un diamant Scribe pour générer des marqueurs d'alignement sur le bas de la lame de verre. Alignement dans les étapes ultérieures du protocole peut être vérifiée sous un microscope.
    5. Retirer le moule PDMS de la diapositive de codes à barres. Lavez doucement la lame avec 0,01% de SDS une fois et trois fois avec de l'eau ultra-pure.
      1. Séchez la diapositive de codes à barres en utilisant un fileur de lame de microscope. Stocker le coulisseau de codes à barres dans un tube à centrifuger de 50 ml propre pour une utilisation ultérieure.

2. Validation du modèle unidimensionnel sur la diapositive Barcode

Remarque: Ce protocole de validation peut également être adapté pour une utilisation dans l'évaluation de la qualité des étapes ultérieures de mise en forme de flux.

  1. Le blocage de la coulisse
    1. Préparer une% de sérum albumine bovine (BSA) dans du PBS. Filtrer cette solution à travers un filtre à seringue de 0,45 um avant utilisation. En utilisant une pointe de chargement de gel, appliquer 50 pl de solution de BSA à 1% à un bord de la lame de code à barres.
    2. Incuber la BSA solut 1%Ion pour 1 heure à température ambiante.
  2. L'incubation avec Cyanine 3 (Cy3) conjugué à de l'ADN complémentaire
    1. Préparer un cocktail de A ', B', C et les oligonucleotides «conjugué à Cy3 à une extrémité. Les séquences de A ', B' et C 'sont complémentaires de celles de A, B, et C, respectivement. La concentration de travail de l'ADN-Cy3 est de 0,05 uM à 0,1% de BSA.
    2. Retirer la solution de BSA à partir de la diapositive par pipetage, puis appliquer 30 ul de la solution d'ADN cocktail sur le même bord de la glissière. Incuber le cocktail Cy3-ADN sur la diapositive à température ambiante pendant 1 heure. Effectuez cette étape d'incubation dans l'obscurité pour protéger le groupement Cy3 de photoblanchiment.
  3. L'analyse de l'intensité de fluorescence
    1. Introduire à la pipette sur le cocktail Cy3-ADN et laver la lame dans 1% de BSA, PBS, et enfin dans PBS diluée (1 part PBS avec 50 parties d'eau ultra-pure). Séchez la diapositive à l'aide d'une centrifugeuse.
    2. Observer la fluorescence (figure 2B) en utilisant un microscope à fluorescence ou un scanner de microréseau. Lors de l'utilisation d'un scanner de puces à ADN, régler la longueur d'onde d'émission du laser à 532 nm, la taille du pixel à 5 ​​microns, tube photomultiplicateur (PMT) Gain à 450 et de puissance à 15%.

3. fabrication du réseau à 2 dimensions (3x3) de l'ADN 14

  1. Préparation du code à barres moule PDMS
    1. Exécuter la procédure (1,1) pour construire un autre maître SU-8, mais cette fois l'utilisation d'un masque de chrome avec une configuration d'écoulement perpendiculaire à celui de la première conception. Exécutez la procédure (1.2) pour construire un nouveau moule PDMS avec le motif perpendiculaire.
  2. Un motif d'écoulement à deux dimensions de l'ADNsb
    1. Pour un tableau 3 x 3, préparer 150 um solutions de stockage de A'-i, ii, B'-C'-iii, iv A'-, B'-V, C'-vi, A'-VII, B'ADN -VIII et C'-IX dans 3% de BSA / PBS. Ces oligonucléotides servent de "séquences de transition" (figure 2A). On combine les solutions d'oligonucléotides (solutions 1 à 3) de sorte que la concentration de travail est de 50 uM de chaque oligonucleotide. Utilisez le guide fourni dans le tableau 1.
    2. Débit 3% de BSA / solution de blocage PBS dans les 20 canaux pendant 1 h à 0,5-1 psi.
    3. Solutions de débit 1, 2, 3 et dans les canaux 1, 2 et 3, respectivement. Suivez cet ordre pour les séries subséquentes de 3 canaux. Le débit est généralement complété dans environ 40 min. Incuber les solutions d'ADN à température ambiante pendant 2 heures pour permettre à l'ADN hybride.
    4. Débit 3% de BSA / solution de blocage PBS dans les 20 canaux pendant 1 h à 0,5-1 psi pour éliminer l'ADN non hybridée. Décollez la dalle PDMS, et laver la lame de puces à ADN résultant en plongeant la lame de verre dans 3% de BSA / PBS une fois et deux fois par PBS, suivi par PBS dilué (1 partie PBS et 50 parties d'eau ultra-pure). réry la diapositive en utilisant un fileur de lame de microscope.
    5. Effectuer une deuxième étape de validation (figure 2C) similaire à celle de la section 2. Utilisez oligonucléotides i IX »qui sont conjugué à Cy3. Stocker la matrice 3 x 3 diapositive dans un tube à centrifuger de 50 ml pour une utilisation ultérieure.
      Remarque: La puce à ADN peut être conservé à température ambiante dans un dessiccateur pendant des mois.

4. Conversion de l'ADN matrice 3 x 3 dans un tableau Anticorps

  1. Préparation d'anticorps-oligonucléotides (DEAL) conjugués
    1. Préparer des solutions de 200 mM de succinate de 4-formylbenzoate-(S-4FB) et 40 mM de succinimidyl-6-hydrazinonicotinamide (HYNIC-S) anhydre dans du N, N-diméthylformamide (DMF).
    2. Préparer jusqu'à 7 solutions séparées d'anticorps de capture (1 mg / ml) dans du PBS.
      Remarque: Si les solutions d'anticorps contiennent de l'azoture de sodium actions bactériostatique, réaliser un échange de tampon avec PBS en utilisant rotation dessalage columns avec 7 kDa de poids moléculaire de coupure (MWCO).
    3. Préparer des solutions séparées de 400 uM de i ', II', III ', IV', V ', VI', et VII 'ADN. Attribuez à chaque anticorps de capture d'une séquence d'oligonucléotide. Combinez 40 pl de l'ADN de 400 uM avec 12,25 pi de DMF dans des microtubes et centrifuger pour bien mélanger.
      1. Pour chaque solution ADN / DMF, ajouter 2,3 pi de 200 mM S-4FB dans le DMF. Pour chaque 100 ug d'anticorps de capture, ajouter 2,25 ul de 40 mM de S-HYNIC dans du DMF.
    4. Incuber les solutions / S-HYNIC et l'ADN / S-4FB anticorps pendant 4 heures à la température ambiante.
    5. En vue de la réaction de couplage anticorps-ADN, préparer de nouvelles colonnes de dessalage de spin (un pour chaque solution d'ADN et l'autre pour chaque anticorps) en les lavant avec du tampon citrate à pH 6.
    6. Après 4 heures d'incubation, effectuer l'échange de tampon pour chaque anticorps / S-HYNIC et la solution ADN / S-4FB. Combinez le S-4FB conjugué VII 'oligonucleotides avec des conjugués anticorps-S-HYNIC. Incuber les mélanges pendant 2 heures à température ambiante.
    7. Incuber la réaction O / N à 4 ° C.
  2. Purification de l'anticorps-oligonucléotides (DEAL) conjugués
    Remarque: Pour purifier les conjugués anticorps-oligonucléotide, effectuez chromatographie liquide rapide de protéines (FPLC) sur un système FPLC équipé en standard d'une colonne Superose 6 10/300 GL.
    1. Régler la longueur d'onde du détecteur UV du système FPLC à 280 nm. Utilisation isocratique débit de PBS (pH 7,4) à 0,3 ml / min pour séparer les conjugués d'anticorps à partir de l'oligonucléotide-ADN-S 4FB excès.
    2. Réunir les fractions contenant le conjugué et concentrer les fractions à un volume de 150 pi en utilisant des filtres de spin avec un 10 kDa MWCO.
  3. Un motif bidimensionnel d'anticorps
    1. Préparer un autre moule PDMS avec microchambres ou US micro-puitsING procédés de fabrication à l'étape (1.2). Le moule PDMS peut contenir microlitre aux puits nanolitre pour immunoessais.
      Remarque: Pour la détection de biomarqueurs dans des échantillons fluidiques générale, un moule PDMS avec plusieurs puits est accouplé avec la glissière de tableau. Les caractéristiques du moule PDMS dépendent du système à l'étude. Par exemple, la détection de protéines à partir d'expériences de cellules individuelles peut être effectué avec un moule PDMS contenant microchambres avec des volumes de 0,15 nl.
    2. (Facultatif) Soumettre le moule PDMS au plasma de nettoyage (18 W) pendant 1,5 minutes pour rendre sa surface hydrophile à motifs. Avant le nettoyage au plasma, utiliser du ruban adhésif pour bloquer toutes les autres surfaces qui seront directement lié à la matrice coulissant 3 x 3.
      Remarque: L'étape (4.3.2) est facultatif, mais est généralement réalisée lorsque le moule PDMS est destiné à être utilisé dans des expériences de cellules uniques.
    3. Accoupler le moule PDMS avec le tableau coulissant 3 x 3, puis bloquer la lame avec 1% de BSA dans PBS. Incuber pendant 1 heure à température ambiante. Meanwhile, préparer un cocktail (200 volume final pi) de conjugués anticorps-oligonucléotide. La concentration de travail de chaque conjugué est de 10 ug / ml dans du BSA à 1% / PBS.
    4. Ajouter le cocktail anticorps-oligonucléotide, puis incuber pendant 1 heure à 37 ° C pour permettre le fragment oligonucléotidique des conjugués d'hybrider avec des points spécifiques sur les matrices 3 x 3, convertissant ainsi la puce à ADN à une puce à anticorps.
    5. Répétez l'étape (3.2.4) pour nettoyer et sécher la diapositive. La sensibilité la plus élevée peut être obtenue si le tableau d'anticorps est utilisé immédiatement. L'entreposage prolongé peut entraîner une perte de la sensibilité.
  4. Détection de protéines
    1. Reconstituer protéines recombinantes ou préparer un échantillon de cellules filtré.
    2. Compagnon de la puce avec une puce conçue sur mesure, et de bloquer la surface avec 3% de BSA dans PBS pendant 1 h. Ensuite, retirer la solution BSA, et appliquer des échantillons et incuber pendant 2 heures.
    3. Laver les échantillons en utilisant 3% de BSA dans PBS à trois reprises, uneD puis ajouter anticorps de détection à une concentration fournies par la fiche produit. Incuber pendant 2 heures.
    4. Laver les anticorps de détection par 3% de BSA dans PBS à trois reprises, puis ajoutez Cyanine 5 (Cy5) -streptavidin à 1 pg / ml, suivie d'une incubation pendant 1 h.
    5. Répétez l'étape (3.2.4) pour nettoyer et sécher la lame pour la numérisation.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Les dessins des moules PDMS (figure 1A-1B) ont été établis à l'aide d'un logiciel de CAO (AutoCAD). Deux conceptions montrées canaux longs pour motif d'écoulement, une horizontale et une verticale. Les parties gauche et droite de chaque modèle sont symétriques; l'un d'eux pourrait être entrées ou sorties. Chacun des 20 canaux est sinueuse d'un bout tout le chemin à l'autre extrémité. Chaque dessin est imprimé sur un photomasque de chrome (figure 1C). Le SU-8 fabriqué maître sur une plaquette est montré dans la figure 1D. Pour faciliter l'écoulement-structuration de PLL ou de l'ADN, le moule PDMS a été couplé à un flux d'azote gazeux set-up (figure 1E).

Il ya trois étapes flux-patterning utilisés dans ce protocole. La première étape PLL immobilise sur le substrat de verre, tandis que les deux étapes successives d'oligonucléotides introduisent des solutions. Dans le tableau 1, la oligonuclecompositions çage de Solutions 1-3 sont donnés. La concentration de travail de chaque oligonucleotide est de 50 uM et le volume total de chaque solution est de 39 ul. Ces solutions sont préparées en combinant 13 ul de chaque solution stock d'oligonucléotide (150 M).

Les unités de microréseaux d'ADN sont des motifs répétitifs et adjacent sur toute la lame de verre. Pour 3 x 3 puces à ADN, la densité maximale est d'environ 400 000 taches sur une lame de verre. Comparaison côte-à-côte avec puce à ADN commerciale révèle que notre technologie est environ 5 fois plus sensible lors de la liaison à Cy3 marqué ADN complémentaires. Les ADN motifs sont relativement uniforme avec ~ 5% de variation à travers de multiples répétitions. Ces caractéristiques promettent la capacité de quantification élevé de notre technologie lors de la mesure des teneurs en protéines des échantillons biologiques. En outre, l'orthogonalité des ADN en combinaison avec la conception du canal d'écoulement de l'offre la flexibilité de formation de motifs dans une variété de geometries (figure 2D).

Après la conversion de la matrice d'ADN dans un réseau d'anticorps par hybridation avec des conjugués d'ADN-anticorps (figure 3b), le panneau de l'anticorps résultant est utilisé dans la détection multiplexée, principalement par ELISA en sandwich plate-forme comme représenté sur la figure 3C. Dans ELISA sandwich, détection des anticorps biotinylés (secondaires) se lient aux protéines capturées, et l'étiquetage ultérieur avec fluorophore conjugué streptavidine permet la détection par fluorescence (figure 3C-E). La détection de protéines <10% montre la variation d'une extrémité à l'autre extrémité de la lame de verre (Figure 3D). Avec le tableau 3 x 3, nous sommes en mesure de détecter jusqu'à 7 protéines, tout en assignant un élément de tableau comme référence (Cy3 marqué) et un autre élément comme contrôle négatif. Par exemple, dans une expérience unique cellule réalisée pourétudes de tumeurs, les protéines de l'interleukine-6 ​​(IL-6), matrice métallopeptidase 9 (MMP9), le facteur de croissance des hépatocytes (HGF), facteur de croissance vasculaire endothélial (VEGF), l'interleukine-8 (IL-8), et migration des macrophages inhibiteur facteur (MIF) à partir d'une seule cellule peut être détectée simultanément (figure 3E).

Nous avons également calibré le système en utilisant des protéines recombinantes à diverses concentrations. Sur la figure 3F, des courbes d'étalonnage pour les protéines recombinantes de l'interféron-γ (IFN-y), α le facteur de nécrose tumorale (TNF alpha), l'interleukine-13 (IL-13), facteur de nécrose tumorale β (TNF ß), granzyme B, l'interleukine -4 (IL-4), et l'interleukine-8 (IL-8) sont présentés. La sensibilité de détection est tout à fait similaire à celle de l'ELISA sandwich classique de plaques à puits, même avec une charge plus élevée d'ADN et, éventuellement, des anticorps sur le substrat.

Le Antibod de code à barresy microréseau peut être utilisé pour détecter des biomarqueurs dans des échantillons fluides, ainsi que dans des cellules individuelles. Depuis analyse unicellulaire est pas l'objet de ce protocole, nous avons simplement illustré l'application de l'anticorps microarray 3 x 3 dans la détection des cytokines. Grâce aux interactions marqueurs anticorps surface, groupe de différenciation 8 (CD8) cellules -positifs ont été capturés sur l'un des éléments de puces à ADN (figure 3G; une puce PDMS sur le dessus), et le reste des éléments ont été utilisés pour détecter les cytokines sécrétées ( Figure 3H). Avec ce procédé de capture de cellules, "matrices de cellules" peuvent être formés. Cette technique de capture de gamme permet également un contrôle sur le nombre de cellules soumises à chaque expérience ELISA. Les cellules ont été isolées physiquement dans les chambres miniatures de sorte que les protéines détectées concernaient notamment des cellules simples. Sur la figure 3H, il est démontré que chaque microchambre est équipé de 16 éléments de microréseau pour assurer l'encapsulation deun complet 3 x 3 jeu de puces à ADN.

Figure 1
Figure 1. Conception et fabrication de moules PDMS de codes à barres pour les motifs d'ADN basé sur des flux. Panneau (A) montre les dessins AutoCAD pour les modèles de codes à barres unidimensionnels horizontales et verticales. Panneau (B) montre les modèles de codes à barres horizontales et verticales superposées de (A). Boîtes vertes entourent les zones à motifs discrets avec 3 x 3 tableaux. Masque (C) Chrome pour fabriquer le maître SU-8. (D) SU-8 maître fabriqué sur une tranche de silicium. (E) Mise en place de la structuration de l'écoulement. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2 Figure 2. Construction et validation d'une puce à ADN 3 x 3. Ce chiffre a été modifié à partir de "quantifier Fonctions cellule-cellule interaction avec des applications aux cellules du glioblastome multiforme cancer," par Wang, J. et al., 2012, Nano Lett 12 . Copyright 2012 par l'American Chemical Society. Adapté avec la permission. (A) Schéma pour l'ADN étapes flux-structuration. Profil (B) d'intensité de fluorescence de 20 canaux dans une zone sélectionnée (tracée par une ligne verticale) du code à barres 1D. Des oligonucleotides conjugués à Cy3 hybridées aux ont été puces à ADN pour la validation. (C) le profil de tableaux validés avec l'ADN conjugué à Cy3 après avoir terminé la deuxième étape de l'ADN de structuration intensité de fluorescence. (D) des motifs fluorescents de rechange de fl différenteOW-structuration des stratégies. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. Les demandes de la 3 x 3 microarray. (A) Régime pour la synthèse de conjugués anticorps-DEAL oligonucléotide. (B) Schéma de la conversion de la matrice d'ADN dans un réseau d'anticorps par hybridation avec des conjugués anticorps-oligonucléotide. (C) Schéma d'utilisation du 3 x 3 microréseaux dans une plate-forme sandwich ELISA. Ce chiffre a été modifié à partir de "quantifier Fonctions cellule-cellule interaction avec des applications aux cellules du glioblastome multiforme cancer," par Wang, J. et al., 2012, Nano Lett 12. Droit d'auteur 2012 par l'American Chemical Society. Adapté avec la permission. Panneau (D) montre une lecture de fluorescence générée dans un canal Cy5. Ceci correspond à une expérience ELISA sandwich qui a détecté 6 protéines. Panneau (E) est un zoom avant profil d'un tableau de lecture 3 x 3 sous canaux Cy3 et Cy5. Panneau (F) présente les ELISA sandwich courbes d'étalonnage pour les protéines recombinantes. Panneau (G) montre un «réseau de cellules" formé par la capture des cellules en se liant avec des anticorps sur la matrice. Panneau (H) montre le résultat de détection superposée avec microchambres dans une puce électronique. S'il vous plaît cliquez ici pour voir une version plus grande de cette figure.

1
Solution Composition oligonucléotide
A'-i, B'-ii, iii C'-
2 A'-iv, v-B', C'-vi
3 A'-vii, viii-B', C'-ix

Tableau 1. Composition des Solutions 1-3 pour l'ADN flux structuration.

Séquences d'ancrage
UN ATCCTGGAGCTAAGTCCGTA-aaaaaaaaaaaaaaaaaaaa-ATCCTGGAGCTAAGTCCGTA-aaaaaaaaaaaaaaaaaaaa
B GCCTCATTGAATCATGCCTA-aaaaaaaaaaaaaaaaaaaa-GCCTCATTGAATCATGCCTA-
Aaaaaaaaaaaaaaaaaaaa
C GCACTCGTCTACTATCGCTA-aaaaaaaaaaaaaaaaaaaa-GCACTCGTCTACTATCGCTA-aaaaaaaaaaaaaaaaaaaa
Combler séquences
A'-i TACGGACTTAGCTCCAGGAT-aaaaaaaaaaaaaaaaaaaa-ATGGTCGAGATGTCAGAGTA
Ii B'- TAGGCATGATTCAATGAGGC-aaaaaaaaaaaaaaaaaaaa-ATGTGAAGTGGCAGTATCTA
Iii C'- TAGCGATAGTAGACGAGTGC-aaaaaaaaaaaaaaaaaaaa-ATCAGGTAAGGTTCACGGTA
Iv A'- TACGGACTTAGCTCCAGGAT-aaaaaaaaaaaaaaaaaaaa-GAGTAGCCTTCCCGAGCATT
B'-v TAGGCATGATTCAATGAGGC-aaaaaaaaaaaaaaaaaaaa-ATTGACCAAACTGCGGTGCG
C'-vi TAGCGATAGTAGACGAGTGC-aaaaaaaaaaaaaaaaaaaa-TGCCCTATTGTTGCGTCGGA
A'-vii TACGGACTTAGCTCCAGGAT-aaaaaaaaaaaaaaaaaaaa-TCTTCTAGTTGTCGAGCAGG
Viii B'- TAGGCATGATTCAATGAGGC-aaaaaaaaaaaaaaaaaaaa-TAATCTAATTCTGGTCGCGG
Ix C'- TAGCGATAGTAGACGAGTGC-aaaaaaaaaaaaaaaaaaaa-GTGATT AAGTCTGCTTCGGC
Des oligonucleotides conjugués à Cy3 de validation
UN' TACGGACTTAGCTCCAGGAT
B ' TAGGCATGATTCAATGAGGC
C ' TAGCGATAGTAGACGAGTGC
je' TACTCTGACATCTCGACCAT
ii ' TAGATACTGCCACTTCACAT
iii ' TACCGTGAACCTTACCTGAT
iv ' AATGCTGGGGAAGGCTACTC
v ' CGCACCGCAGTTTGGTCAAT
vi ' TCCGACGCAACAATAGGGCA
vii ' CCTGCTCGACAACTAGAAGA
viii ' CCGCGACCAGAATTAGATTA
ix ' GCCGAAGCAGACTTAATCAC
"Fo: keep-together.within-page =" 1 "> Tableau 2. séquences utilisées dans l'ADN flux-structuration.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Conception de modèle de Flow est la première étape critique dans la fabrication de la puce 2-D. Pour générer deux motifs d'ADN qui se chevauchent sur ​​un substrat en verre, les caractéristiques de canal de la première conception doivent être perpendiculaires à celles de la seconde (figure 1A-B). Les dessins considèrent également les applications en aval de la puce. Dans le cas de l'analyse d'une seule cellule, la puce à ADN est utilisée pour détecter des protéines provenant de cellules uniques enfermés dans des chambres miniatures, donc les dimensions du canal sont rendues compatibles avec les chambres miniatures qui correspondent aux matrices 2-D. Chaque conception est rendue sur un photomasque et techniques de photolithographie classiques sont utilisés pour fabriquer les caractéristiques de canal dans SU-8 sur une plaquette de silicium (figure 1C-D). Cela sert comme maître PDMS de moulage. Une fois le moule a été fabriqué, il est lié à une diapositive PLL-enduit et ensuite couplé avec un flux d'azote gazeux set-up (figure 1E). Le nous de set-upl'utilisation est simple et a l'avantage d'être facilement intégré dans un laboratoire avec une source de gaz de l'azote à la pression régulée. On utilise un assemblage de multiples peu coûteuses vannes 3 voies reliés à un réservoir d'azote gazeux. Le flux d'air pour un motif doit être maintenue à des pressions faibles (0,5 à 1 psi) pour éviter le délaminage de la lame de verre du moule. Fuites dans le moule PDMS peuvent compromettre l'intégrité des modèles.

Les étapes de mise en forme de flux de l'ADN dans ce protocole utilisent ssADN avec des séquences orthogonales soigneusement sélectionnés (figure 2A). Avant de couler-structuration, les séquences uniques sur ces oligonucléotides doit être testé pour l'absence de diaphonie. Un simple test de diaphonie est fait en modifiant la procédure de validation, nous introduisons dans notre protocole (étape 2). Au lieu d'utiliser un cocktail de Cy3-tagged ADN complémentaire, un seul type de séquence complémentaire est utilisé à la fois pour une région sélectionnée de la diapositive sur laquelle multipleDes séquences d'ADN sont immobilisées. En l'absence d'ADN diaphonie, une seule bande (pour le tableau 1 l'ADN-D) ou un endroit (pour le tableau ADN 2-D) devraient être fluorescente sous un filtre à Cy3. Des exemples de séquences orthogonales soigneusement validés peuvent être trouvés dans la table des matières et équipements. La première étape de formation de motifs d'ADN introduit trois types d'oligonucléotides "d'ancrage". Ces séquences de 80 nt sont constituées de deux régions 20-mer poly-A qui alternent avec deux séquences 20-mères uniques. La modification 5'-amine sur ces séquences d'ancrage est nécessaire pour amine-à-amine réticulation 17 avec PLL médiée par BS3. La seconde étape de formation de motif ADN ne nécessite pas d'agent de réticulation. Cette étape introduit oligonucléotides «passerelles» qui hybrident partie avec les séquences d'ancrage. Chaque séquence de pontage 60-nt se compose d'une région 20-mère complémentaire à une séquence d'ancrage, un 20-mer poly-A d'espacement, et une séquence 20-mère unique. Validation des puces à ADN (Figure 2B-C) est effectué après chaque étape de flux de motifs d'ADN pour évaluer la qualité des étapes de structuration et de veiller à éviter toute contamination croisée 14. Ceci est réalisé par l'introduction de sondes d'oligonucléotides conjugués à Cy3 qui hybrident avec les modèles d'ADN. Avec les paramètres spécifiés dans l'étape (2.3.2) pour l'analyse de l'intensité de fluorescence, les profils d'ADN devraient présenter des intensités de fluorescence d'au moins 40.000 au maximiser la sensibilité des immunoessais en aval réalisée en utilisant la puce. Usage stratégique de différents ensembles Cy3-ADN lors de la validation donne lieu à des modes alternatifs (Figure 2D), démontrant ainsi la flexibilité de la formation de motifs d'ADN étapes 8. L'incapacité d'atteindre des modèles uniformes pourraient résulter de fuites ou des obstructions mécaniques (telles que les particules de poussière) rencontré dans les étapes flux-structuration.

La préparation d'anticorps conjugués oligonucléotides DEAL est une autre étape cruciale dans eest le protocole. Le choix des anticorps est déterminée par le système biologique étudié. Les oligonucleotides utilisés en conjugaison doivent avoir des séquences complémentaires à celles ancré sur la matrice d'ADN. Les solutions mères des linkers S-4FB et S-HYNIC doivent être fraîchement préparés et tenus à l'écart de l'humidité pour éviter l'hydrolyse. Les durées d'incubation utilisées dans notre protocole de conjugaison sont assez long pour présenter les fonctionnalités souhaitées sur les anticorps et l'ADN. La réaction finale de couplage est désactivé uniquement en retirant les S-oligonucléotides conjugués 4FB pas réagi par FPLC. Ainsi, la purification FPLC doit être effectuée immédiatement après avoir terminé la conjugaison. Lors de l'exécution FPLC avec le système décrit dans notre protocole, des débits plus faibles (0.2-0.25 ml / min) peuvent également être utilisés pour améliorer la résolution. Les conjugués sont élués comme un pic large (volume d'élution de l'ordre de 9 à 15 ml) qui apparaît avant un pic plus étroit et plus haut ADN (17 à 20 ml de volume d'élution). Nous ne recommandons pas stocker solutionsde conjugués avec S-4FB-ADN excès, car cela peut conduire à la perte des sites de liaison d'antigène à l'anticorps sur la conjugaison avec l'ADN de l'excès fonctionnalisés. La sensibilité, la spécificité et la reproductibilité des tests ELISA sandwich en utilisant des conjugués de transaction n'a été mise en évidence dans des études précédentes. 8,9,11,12,16 Pour évaluer la qualité de conjugués anticorps-ADN, les conjugués peuvent être mises en incubation sur les puces à ADN pour générer le tableau anticorps, qui est ensuite utilisé dans des expériences d'ELISA sandwich pour générer des courbes d'étalonnage pour la détection de la protéine (figure 3F). Pour générer ces courbes d'étalonnage, des protéines recombinantes prévues en sandwich ELISA conventionnel kit peuvent être utilisés. L'utilisation de conjugués de haute qualité devrait donner lieu à des plages linéaires et des limites inférieures de détection comparables à celles de la trousse. A titre d'exemple, les limites inférieures de INFy et TNFa pour ELISA sandwich sur notre puce à anticorps (figure 3F) sont ~ 50-100 pg / ml, et sont consistent avec la gamme de détection linéaire de ~ 15-1,000 pg / ml indiqué dans la fiche produit pour le sandwich kit ELISA classique. Pauvre lecture du signal obtenu en aval expériences ELISA en sandwich pourrait être attribué à la faible qualité de la matrice d'ADN, l'ingérence de l'ADN en excès dans les solutions conjuguées, ou encore, la conjugaison incomplète de ADNsb avec des anticorps.

Des préoccupations majeures pour effectuer ELISA sandwich sur le réseau d'anticorps comprennent la diaphonie entre les réactifs et si le signal reflète les événements biologiques réels. Les ADN orthogonaux que nous utilisons dans ce protocole ont été soigneusement validé pour avoir moins de 0,1% de diaphonie. Par conséquent, toute diaphonie observée à l'étape de dosage immunologique est principalement des anticorps et des réactifs ELISA. Test de diaphonie entre les anticorps dans le tableau doit être effectuée avant de procéder à des tests sur des échantillons réels. Une fois qu'un panel d'anticorps est construit, quelques sandwichs expériences de contrôle ELISA devraient être perfORMED avec les conditions suivantes: 1. Sans antigènes, 2. Sans anticorps de détection, et des anticorps de détection et 3. Les réactifs de marquage uniquement. Si la diaphonie est observée à l'étape de dosage immunologique, les paires d'anticorps et / ou des réactifs ELISA doivent être remplacés. Il convient de noter que l'utilisation d'anticorps disponibles dans le commerce à partir de kits ELISA conventionnels ne garantit pas l'applicabilité de la technique ELISA en sandwich à base de réseau.

Les mérites de cette technologie comprennent la fabrication bon marché, taille miniature, et la flexibilité de la conception. Notre protocole de fabrication n'a pas besoin d'un spotter microarray qui peuvent ne pas être disponibles pour de nombreux utilisateurs de puces à anticorps. La structuration de l'écoulement set-up peut être facilement assemblé dans les laboratoires simples. Pour les laboratoires qui ne sont pas équipées d'instruments pour la photolithographie, les conceptions de CAO que nous offrons dans notre protocole peuvent être transmises à des sociétés qui offrent des services de microfabrication. La réduction des effectifs dans la puce conventionnellela matrice compacte fabriquée avec notre protocole permet la compatibilité avec les micropuces utilisées dans les expériences unicellulaires. Notre protocole comprend la production de la matrice sous forme de tableau avant ADNsb première conversion à une puce à anticorps. Un motif préliminaire avec ADNsb a un certain nombre d'avantages. Tout d'abord, ADNsb sont chimiquement plus stable par rapport à des anticorps, ainsi les lames de ADNsb à motifs peuvent être stockés dans un dessiccateur pendant au moins 6 mois sans dégradation significative 8,16. Deuxièmement, notre approche offre un utilisateur final la possibilité de choisir les tests nécessaires, par simple mélange des conjugués sélectifs ensemble dans une solution sans modification de la puce; Au contraire, protéine / anticorps réseaux classiques sont pré-conçue et fixée sur un substrat, de sorte que le changement de dosages exigeraient la structuration / d'impression de protéines / anticorps dès le début. Des études représentatives illustrent l'utilisation de la puce d'anticorps de codes à barres dans le haut-débit detection de multiples protéines de signalisation de cellules individuelles. En faisant varier les conceptions de modèle d'écoulement et / ou les solutions oligonucléotide de motifs utilisés, une multitude de mises en page de tableau peuvent être explorées. A titre d'exemple de la présente demande, les protéines fonctionnelles à partir de cellules uniques peuvent être étudiées. La puce d'analyse unicellulaire englobe autant que ~ 8700 microchambres, chacune alignée avec une complète 3 x 3 anticorps array (figure 3H). Une telle configuration permet la détection à haut débit. Les protéines sécrétées par des cellules cultivées en chambres miniatures peuvent être détectés par ce réseau. La conception souple de puces à ADN permet également la détection multiplexée de protéines à partir de sérum, des lysats cellulaires, des cellules individuelles et la combinaison de la puce à ADN après avec d'autres composants génériques 8,15. En plus de la détection de protéine, la matrice de 3 x 3 anticorps est également utile dans des cellules de capture (figure 3G).

Le principal inconvénient de cette approche est son compl ajoutéeexity par rapport à la fabrication de puces à ADN classiques. Stratégies de modélisation et de conception de réseau doivent être soigneusement conceptualisée en tenant compte des demandes spécifiques de la matrice fabriquée. Cette approche nécessite également un certain nombre d'étapes critiques, y compris des procédures de validation et de tests pour diaphonie. La matrice 3 x 3 construit en utilisant notre protocole est limité à la détection de protéines 7 à la fois. Cependant, cette limite peut être dépassée par la création de grands tableaux. Le protocole présenté ici ne se limite pas à la fabrication de 3 x 3 puces. Nous avons été en mesure de fabriquer avec succès 5 x 5 puces et d'autres dimensions d'éléments du tableau. En principe, d'autres n x m peuvent être fabriquées réseaux utilisant des techniques similaires à condition que les ensembles d'oligonucléotides utilisées dans la création de la matrice d'ADN préliminaire à motif sont orthogonaux pour éviter la diaphonie entre éléments du tableau. La création de réseaux étendus est réalisé par patterni de fluxng n types de ADNsb ancres pour la première étape de formation de motifs d'ADN, suivi par n x m pontage séquences ADNsb pour la deuxième étape de formation de motifs. Par exemple, pour créer une matrice 5 x 5, les séquences d'ancrage A à E peut être utilisé, tandis que les séquences de pontage A'-i à E'-xxv sont utilisés. Pour automatiser le processus de structuration de l'écoulement, une plate-forme de robotique a été développé 18 bien que cela a seulement utilisé un ADN étape de structuration de flux. En principe, la même plate-forme peut être étendue à la seconde étape de formation de motifs d'écoulement perpendiculaire, tandis que la commutation entre les deux étapes peut nécessiter manuellement décoller le premier moule PDMS après la première étape de formation de motif, suivie d'un lavage et le séchage du coulisseau (cette étape serait prendre environ 10 min), avant l'accouplement du coulisseau avec un autre moule PDMS à faciliter la deuxième étape de formation de motif orientées perpendiculairement.

Nous avons discuté des procédures détaillées pour la fabrication d'un réseau de nxm motifsavec des anticorps à haute densité, ce qui est très prometteur pour les futures applications dans les études protéomiques et la signalisation cellulaire. Le protocole présenté ici peut également servir de guide pour la construction de matrices d'ADN plus élaborés / anticorps pour d'autres fins.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).
Flow-modèle Fabrication guidée de haute densité Barcode puces à anticorps
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).More

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter