Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Protéines immunofluorescence Analyse des endogènes et exogènes Centromere-kinétochoriens

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"centromères" ont été classiquement définis comme régions de recombinaison méiotique supprimée en génétique et plus tard reconnu comme la constriction primaire des chromosomes mitotiques, qui joue un rôle essentiel dans la ségrégation des chromosomes lors de la mitose précise. "cinétochores" ont été décrits comme des structures à couches multiples qui se lient aux microtubules à la surface de centromères, telle qu'elle est révélée par microscopie électronique; "cinétochores" ont ensuite été définis comme étant le complexe macromoléculaire qui se localise au niveau du centromère des chromosomes mitotiques. En dépit d'une divergence considérable de séquences d'ADN centromériques parmi les vertébrés, la structure et la composition kinétochore sont hautement conservées. Une interaction dynamique entre microtubules du fuseau et kinétochore est nécessaire pour la ségrégation fidèle des chromosomes lors de la mitose, et les défauts de centromère-kinétochore fonction conduisent à une aneuploïdie et ainsi le cancer.

Centromère dans la plupart des eucaryotesa pas de séquence d'ADN définie, mais est composé de grands réseaux (0,3-5 Mo) d'ADN alphoïde répétitif constitué d'ADN α-satellite de 171 pb. Sauf dans la levure bourgeonnante, l' identité de centromère est obtenue non pas par la séquence d'ADN , mais par la présence d'un nucléosome spécial qui contient le variant de l' histone H3 CENH3 (centromère protéine A [CENP-A] chez l' homme). 5 nucléosomes CENP-A localisent au plaque intérieure de kinétochores mammifères 7 et se lient à l'ADN α-satellite de 171 pb. centromères actifs exigent CENP contenant A-nucléosomes pour diriger le recrutement d'un réseau constitutif centromère-associé (CCAN) et les protéines kinétochoriens, qui régulent ainsi l'attachement des chromosomes au fuseau mitotique et la progression du cycle suivant à travers le point de contrôle de la broche.

À la lumière de la preuve ci - dessus, CENP-A a été proposé d'être la marque épigénétique du centromère 8; toutefois, le processus par lequel CENP-A est incorporé into ADN centromérique et les facteurs responsables de cette incorporation ont pas encore été bien caractérisée. Un domaine de centromère ciblage courte (DTAC) réside dans le histone fold région CENP-A, et le remplacement de la région correspondante de H3 avec le CATD est suffisante pour H3 directe du centromère. 9 Plusieurs études ont suggéré des rôles fonctionnels pour post-traductionnelle modification (PTM) de CENP-A 12-16; Cependant, les mécanismes moléculaires de ces PTM de CENP-A dans le recrutement à centromères n'a pas encore été élucidé. Nous avons déjà indiqué que l' activité de ligase CUL4A-RBX1-COPS8 E3 est nécessaire pour CENP-A K124 ubiquitylation et la localisation de CENP-A à centromères 17.

La découverte et la caractérisation des protéines kinétochoriens ont conduit à de nouvelles connaissances en ce qui concerne la ségrégation des chromosomes. 18 Plus de 100 éléments kinétochoriens ont été identifiées dans les cellules de vertébrés par diverses approches. Une sous 19,20méthodes permanentes de la façon dont cinétochores assemblent et la fonction vient également de la caractérisation des fonctions cellulaires de chaque réseau centromère-kinétochore protéines et protéine-protéine dans les cellules. 19 visualisation directe et d' imagerie de pointe en microscopie de fluorescence fournissent remarquable résolution de composants centromère-kinétochore et permettent l'observation directe des composants moléculaires spécifiques des centromères et kinétochores. En outre, les méthodes d'immunofluorescence indirecte (IIF) coloration en utilisant des anticorps spécifiques sont cruciaux pour ces observations. Cependant, en dépit de nombreux rapports sur les protocoles IIF, peu abordés dans les problèmes de détail de protéines centromériques-kinétochore spécifiques. 1-4 Ainsi, le développement et les méthodes de déclaration de IIF coloration et un dosage quantitatif IIF pour analyser spécifiquement chaque protéine centromère-kinétochore est extrêmement important. Dans IIF coloration, il faut procéder avec le protocole de coloration pour éviter la perte de la protéine d'intérêt oule reste de la cellule. Cependant, la fixation détruit les sites antigéniques de temps en temps, et des combinaisons anticorps-antigène fonctionne mal avec un fixatif, mais très bien avec les autres, 21 et le choix de fixatif dépend en grande partie de la protéine (s) d'intérêt. Par conséquent, les différentes méthodes de fixateur sont cruciales dans IIF coloration des protéines centromériques-kinétochore.

Méthodes ici optimisées immunofluorescence indirecte (IIF), la coloration et un essai pour résoudre la localisation des protéines centromère kinétochore endogènes, y compris CENP-A et les protéines CENP-A exogènes étiquetée FLAG, et la quantification de ces protéines dans des cellules humaines ont été développées. Ces procédés peuvent être appliqués à l'analyse des protéines centromériques-kinétochore dans d'autres espèces.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Culture cellulaire et transfection

  1. Mettez un couvercle en verre (22 mm x 22 mm) dans une plaque de polystyrène à 6 puits. manteau En option, un couvercle en verre avec Poly-L-lysine, 0,1% p / v, dans l'eau (voir la liste des matériaux / équipement) pour maintenir les cellules en mitose sur le couvercle en verre en suivant les étapes ci-dessous:
    Remarque: Les conditions optimales doivent être déterminées pour chaque lignée cellulaire et de l'application.
    1. Aseptique surface de culture de manteau avec Poly-L-lysine, 0,1% p / v, dans l'eau (0,4 ml / puits d'une plaque à 6 puits en polystyrène). Roche doucement pour assurer une couche de la surface de culture.
    2. Après 5 min, éliminer la solution par aspiration et bien rincer la surface avec de l'eau de qualité culture de tissu stérile.
    3. Sec au moins 2 heures avant l'introduction de cellules et le milieu.
  2. Seed cellules HeLa 17 ou cellules Tet-Off HeLa 17,22 sur un verre de couverture (22 mm x 22 mm) mettre dans une plaque de polystyrène à 6 puits. Vérifiez que la densité cellulaire est de 5,4 x 10 5 par puits. les cellules de la culturedans DMEM riche en glucose avec 10% de FBS et 1% de pénicilline-streptomycine.
    Remarque: Pour des résultats optimaux, déterminer empiriquement la densité cellulaire à utiliser dans l'ensemencement.
  3. Incuber les cellules à 37 ° C dans une atmosphère de 5% de CO2 pendant 18 heures.
    Note: Dans le cas des cellules HeLa Tet-Off, la transcription du gène exogène est active en l'absence de l'inducteur ( par exemple, la tetracycline / doxycycline) , par conséquent des cellules de culture sans tetracycline / doxycycline et transfecter de manière transitoire avec le vecteur de surexpression pTRM4 (tableau 2 ), dont la transcription est régulée par le promoteur TRE (voir ci-dessous).
  4. Dix-huit heures après l'ensemencement des cellules, transfecter comme suit:
    1. Faire la solution A en mélangeant 1,5 ul siRNA oligo (20 uM d'actions recuite; Tableau 1) et / ou 2,0 pg de plasmide (Tableau 2) en pl de milieu de sérum réduit 50 (voir la liste des matériaux / équipement), et incuber à température ambiante pendant 5 min .
      Remarque: Dans cette analyse,CA-UTR siRNA (un mélange de 5 'et 3' UTR siRNA; tableau 1) ont été co-transfectées pour une utilisation dans les protocoles 3 et 4 (voir Discussion).
    2. Faire la solution B en mélangeant 0,75 réactif de transfection ul I (voir Liste des Matériaux / Équipement) dans 50 pi réduits milieu sérique, et incuber à température ambiante pendant 5 min.
      Remarque: Une étape facultative est l'addition de 1,0 ul réactif de transfection II (voir la liste des matériaux / équipement).
    3. Mélanger les solutions A et B ensemble, et laisser incuber à température ambiante pendant 15 min.
    4. Laver les cellules cultivées une fois avec du PBS, puis ajouter 500 ul réduits milieu sérique à chaque puits de la plaque de polystyrène à 6 puits. Ajouter le mélange des solutions A et B ( par exemple, l' ARN et / ou d'un complexe ADN-lipide) , directement à chacun des puits individuels.
      Note: La concentration finale est de 3,3 pg / ml (plasmide); 50 nM (siARN).
    5. Incuber les cellules à 37 ° C dans une atmosphère de 5% de CO 2 pendant 4,5 heures. Changer le support à haute teneur en glucose DMEM with 10% de FBS et 1% de pénicilline-streptomycine.
    6. Incuber les cellules à 37 ° C dans une atmosphère de 5% de CO2 pendant 48 à 72 heures après la transfection.
      Remarque: Pour des résultats optimaux, la période d'incubation pour la croissance cellulaire avant la fixation doit être déterminée de manière empirique, et de protéines d'épuisement et / ou l'expression doit être confirmée par l'analyse Western blot (voir protocole n ° 6).
    7. Si l'analyse cellulaire mitotique est d'intérêt, ajouter le paclitaxel (10 nM) à des cellules en culture 24 heures avant la fixation, ou ajouter TN16 (0,5 uM) pour les cellules cultivées 2,5 heures avant la fixation.

2. Cellule de fixation et immunofluorescence pour détecter les protéines Endogène Centromere-kinétochoriens (paraformaldéhyde Fixation)

  1. Préparation de fixateurs, des tampons et des réactifs.
    1. Fraîchement préparer 50 ml d'une solution de paraformaldehyde à 4% dans du PBS, pH 7,4.
      1. Ajouter 40 ml de 1 x PBS dans un bécher de verre sur une plaque d'agitation dans une hotte ventilée. Chaleur tandis Stirring à environ 60 ° C. Ajouter 2 g de poudre de paraformaldéhyde à la PBS chauffée.
      2. Soulevez lentement le pH en ajoutant 1 ml de NaOH 1 N au total, parce que la poudre ne se dissout pas immédiatement.
        Remarque: La solution efface après l'addition de NaOH.
      3. Une fois que le paraformaldéhyde est dissous, refroidir et filtrer la solution.
      4. Ajuster le pH avec HCl 1 N à pH 7,4 et le volume de la solution avec 1 x PBS à 50 ml.
        Remarque: Des aliquotes de la solution peuvent être congelés ou conservés à 2-8 ° C pendant aussi longtemps que 1 semaine. La solution doit être refroidi à la glace ou stocké à 4 ° C jusqu'à ce qu'il doit être utilisé.
    2. Préparer 50 ml de tampon KB1, qui se compose de 10 mM de Tris-HCl, pH 7,5; NaCl 150 mM; BSA à 0,5%; et 0,5% de Triton X-100.
      Remarque: BSA doit être fraîchement ajouté.
      Note: La série KB de mémoire tampon sont basées sur KB tampon décrite dans les rapports précédents 1,2,4.
    3. Préparer 50 ml de tampon KB2, qui se compose de 10 mM de Tris-HCl,pH 7,5; NaCl 150 mM; et 0,5% de BSA.
      Remarque: BSA doit être fraîchement ajouté.
    4. Préparer 1 ml de tampon contenant KB3 DAPI (50 ng / ml).
    5. Préparer 100 ml de milieu de montage, qui se compose de 1 mg / ml de p-phénylènediamine; 10% de PBS et 90% de glycérol.
      1. Ajuster le pH de 1 x PBS à 9,8 avec NaOH 1 N, on dissout le p-phénylènediamine dans la solution, puis ajouter du glycérol.
      2. Magasin aliquots de 1 ml à -80 ° C. Protéger de la lumière.
  2. Retirez le milieu de culture par aspiration à 48-72 heures après transfection (voir Protocole 1) pour la fixation des cellules. Rincer les cellules une fois avec du PBS. Appliquer du PBS à côté des puits de culture afin d'éviter de perturber la surface des cellules.
    Remarque: Le point de temps optimal pour la fixation de la cellule doit être déterminée empiriquement.
  3. Fixer les cellules dans 4% de paraformaldehyde dans du PBS pendant 30 min à 4 ° C. Rincer les cellules deux fois avec KB2 de tampon pour éliminer suffisamment résiduelle paraformaldéhyde 4%.
  4. PermeabiLize les échantillons dans KB1 tampon pendant 30 min à température ambiante. Rincer les cellules une fois avec KB2 tampon, et ajouter KB2 tampon pendant 5 min à température ambiante pour bloquer les sites additionnels de liaison non spécifique.
    Remarque: Buffer KB1 contribue également de manière significative à blocage.
  5. Retirer un couvercle en verre (22 mm x 22 mm) à partir d'une plaque de polystyrène à 6 puits en utilisant une pince. L'utilisation d'un stylo barrière hydrophobe (voir la liste des matériaux / équipement), dessiner un carré ou un cercle vert pâle pour former une barrière hydrophobe autour de chaque échantillon de verre de couverture. Ne pas toucher ni trop près des cellules avec le stylo barrière hydrophobe. Mettez le couvercle en verre dans une nouvelle plaque de polystyrène à 6 puits.
  6. Diluer un anticorps primaire à centromère ou protéine kinétochore (rapport de dilution de 1: 100 à 1: 200; voir aussi la liste des matériaux / équipement) et soit un anticorps anti-CENP-B (rapport de dilution de 1: 400) ou un anti anticorps centromere (ACA) (rapport de dilution de 1: 2000) comme marqueur de localisation de centromère dans KB2 tampon.
    Remarque: Pour des résultats optimaux, la concentra finaletion de l'anticorps primaire dans cette solution doit être déterminée de manière empirique.
  7. Appliquer un volume suffisant (environ 30 pi) de l'anticorps primaire dilué pour immerger l'échantillon cellulaire. Incuber l'échantillon de cellules pendant 1 heure à 37 ° C. Rincer les cellules 3 fois avec KB2 tampon.
  8. À l'aide KB2 tampon, diluer un anticorps secondaire conjugué à un fluorophore (rapport de dilution de 1: 100 à 1: 200) dirigés l'un contre l'anticorps primaire.
    Remarque: Pour des résultats optimaux, la concentration finale de l'anticorps secondaire dans cette solution doit être déterminée de manière empirique.
  9. Appliquer un volume suffisant (une goutte d'environ 30 ul sur la vitre de recouvrement) de l'anticorps secondaire dilué pour immerger l'échantillon cellulaire. Incuber l'échantillon de cellules pendant 1 heure à 37 ° C. Rincer les cellules 5 fois avec KB2 tampon pendant une période de 30 min (cinq lavages 6 min).
    Remarque: Pour des résultats optimaux (ie, pour une perte minimale de cellules), la condition de lavage optimale doit être déterminée empirically.
  10. Appliquer un volume suffisant de KB3 tampon contenant du DAPI (50 ng / ml) pour immerger l'échantillon cellulaire. Incuber l'échantillon de cellules pendant 5 min à température ambiante. Rincer les cellules 1-2 fois avec KB2 tampon.
  11. Monter le couvercle en verre qui contient l'échantillon de cellules sur la lame micro.
    1. Placer une goutte de milieu de montage au centre de la lame micro.
    2. Retirer le liquide de l'échantillon de cellules et, à l'aide des mains ou des pinces, placer l'échantillon dans le centre de la diapositive micro. Évitez les bulles d'air.
    3. Retirer le milieu de montage en excès avec une serviette en papier.

3. Cellule de fixation et immunofluorescence de C-terminal Flag-étiqueté CENP-A Protéines (Acétone Fixation)

  1. Préparation
    1. Préparer glacée 75% d'acétone.
    2. Fraîchement préparer 50 ml de PBS (pH 7,4) contenant 0,5% de lait écrémé et 0,5% de BSA.
    3. Fraîchement préparer 50 ml de PBS (pH 7,4) contenant 0,1% de lait écrémé et 0,1% de BSA.
    4. Préparer 1 ml de PBS (pH 7,4) contenant du DAPI (50 à 100 ng / ml).
    5. Préparer 100 ml de milieu de montage tel que décrit au point 2.1.5.
  2. Retirez le milieu de culture par aspiration à 48-72 heures après transfection (voir Protocole 1) pour la fixation des cellules. Rincer les cellules une fois avec du PBS. Appliquer du PBS sur le côté du puits de culture afin d'éviter de perturber la surface des cellules.
    Remarque: Le point de temps optimal pour la fixation de la cellule doit être déterminée empiriquement.
  3. Fixer les cellules dans de la glace-froid 75% d'acétone, et incuber les cellules pendant 10 minutes à -20 ° C. cellules sèches sur le verre de couverture dans une hotte pendant 30-60 min à température ambiante.
    Remarque: Pour des résultats optimaux, la durée du temps nécessaire à la fixation cellulaire et le séchage doit être déterminée de manière empirique.
  4. En utilisant le stylo barrière hydrophobe (voir la liste des matériaux / équipement), dessiner un carré ou un cercle vert pâle pour former une barrière hydrophobe autour de chaque échantillon de verre de couverture. Ne pas toucher ni trop près des cellules avec le stylo barrière hydrophobe.
  5. Bloc nonspecific des sites de liaison sur les cellules par l'addition de PBS contenant 0,5% de lait écrémé et 0,5% de BSA pendant 5 min à température ambiante.
  6. À l'aide de PBS contenant 0,1% de lait écrémé et 0,1% de BSA, on dilue un anticorps anti-Flag (1: 1000 taux de dilution) et soit un anticorps anti-CENP-B (rapport de dilution de 1: 200) ou ACA (rapport 1: 2000 dilution ) comme marqueur de localisation de centromère.
    Remarque: Pour des résultats optimaux, la concentration finale de l'anticorps primaire dans cette solution doit être déterminée de manière empirique.
  7. Appliquer un volume suffisant (environ 30 pi) de l'anticorps primaire dilué pour immerger l'échantillon cellulaire. Incuber l'échantillon de cellules pendant 1 heure à 37 ° C. Rincer les cellules 5 fois avec le tampon de blocage pendant une période de 30 min.
    Nota: Les cellules peuvent être rincées avec du PBS. Pour des résultats optimaux ( par exemple, pour éviter la perte de cellules), les conditions de lavage optimales doivent être déterminées de manière empirique.
  8. Diluer un anticorps secondaire conjugué à un fluorophore (rapport de dilution de 1: 100 à 1: 200) dirigé contrele chaque anticorps primaire dans du PBS contenant 0,1% de lait écrémé et 0,1% de BSA.
    Remarque: Pour des résultats optimaux, la concentration finale de l'anticorps secondaire dans cette solution doit être déterminée de manière empirique.
  9. Appliquer un volume suffisant (environ 30 pi) de l'anticorps secondaire dilué pour immerger l'échantillon cellulaire. Incuber l'échantillon de cellules pendant 1 heure à 37 ° C. Rincer les cellules 2 fois avec du PBS contenant 0,1% de lait écrémé et 0,1% de BSA.
    Remarque: PBS seul peut également être utilisé pour laver les cellules.
  10. Appliquer une quantité suffisante de PBS contenant du DAPI (50-100 ng / ml) pour immerger l'échantillon cellulaire. Incuber l'échantillon de cellules pendant 5 min à température ambiante. Rincer les cellules 1-2 fois avec du PBS.
  11. Monter le couvercle en verre contenant l'échantillon de cellules sur la lame micro comme décrit dans 2.11.

4. Cellule de fixation et immunofluorescence de N-terminal Flag-étiqueté CENP-A Protéines (Methanol Fixation)

  1. Préparation
    1. Préparer méthanol glacé.
    2. Préparer TBS (pH 7,4) contenant du sérum de chèvre à 4%.
    3. Préparer 1 ml de TBS (pH 7,4) contenant du DAPI (50 à 100 ng / ml).
    4. Préparer 100 ml de milieu de montage tel que décrit au point 2.1.5.
  2. Retirez le milieu de culture par aspiration à 48-72 heures après transfection (voir Protocole 1) pour la fixation des cellules. Rincer les cellules une fois avec le SCT. Appliquer TBS sur le côté du puits de culture afin d'éviter de perturber la surface des cellules.
    Remarque: Le point de temps optimal pour la fixation de la cellule doit être déterminée empiriquement.
  3. Fixer les cellules dans du méthanol glacé, et incuber les cellules pendant 6 min à -20 ° C. Rincer les cellules deux fois avec TBS pour éliminer suffisamment méthanol résiduel.
  4. L'utilisation d'un stylo barrière hydrophobe (voir la liste des matériaux / équipement), dessiner un carré ou un cercle vert pâle pour créer une barrière hydrophobe autour de chaque échantillon de verre de couverture. Ne pas toucher ni trop près des cellules avec le stylo barrière hydrophobe.
  5. Bloquer les sites de liaison non spécifiques sur le cellulols par l'ajout de TBS contenant du sérum de chèvre à 4%. Incuber pendant 10 min à température ambiante.
  6. Diluer un anticorps anti-Flag (1: 1000 dilution) et soit un anticorps anti-CENP-B (rapport de dilution de 1: 200) ou ACA (1: 2000 taux de dilution) en tant que marqueur d'emplacement de centromère dans du TBS contenant du sérum de chèvre à 4% .
    Remarque: Pour des résultats optimaux, la concentration finale de l'anticorps primaire dans cette solution doit être déterminée de manière empirique.
  7. Appliquer un volume suffisant (environ 30 pi) de l'anticorps primaire dilué pour immerger l'échantillon cellulaire. Incuber l'échantillon de cellules pendant 1 heure à 37 ° C. Rincer les cellules 5 fois avec le tampon de blocage pendant une période de 30 min. Pour des résultats optimaux ( à savoir la perte minimale de cellules), la condition de lavage optimale doit être déterminée empiriquement.
  8. Diluer un anticorps secondaire conjugué à un fluorophore (rapport de dilution de 1: 100 à 1: 200) dirigés l'un contre l'anticorps primaire dans du TBS contenant du sérum de chèvre à 4%.
    Remarque: Pour des résultats optimaux, le final Concentration de l'anticorps secondaire dans cette solution doit être déterminée de manière empirique.
  9. Appliquer un volume suffisant (environ 30 pi) de l'anticorps secondaire dilué pour immerger l'échantillon cellulaire. Incuber l'échantillon de cellules pendant 1 heure à 37 ° C. Rincer les cellules 3 fois avec le tampon de blocage.
  10. Appliquer un volume suffisant de la solution TBS contenant du DAPI (50-100 ng / ml) pour immerger l'échantillon cellulaire. Incuber l'échantillon de cellules pendant 5 min à température ambiante. Rincer les cellules 1-2 fois avec TBS.
  11. Monter le couvercle en verre qui contient l'échantillon de cellules sur la lame micro comme décrit dans 2.11.

5. Immunofluorescence Observation d'image, Acquisition, Quantification et analyse

  1. Observer l'échantillon cellulaire à travers un microscope à fluorescence motorisé équipé d'un objectif 63X et 100X à immersion d'huile, une source extérieure de lumière compacte et une caméra CCD numérique.
  2. Effectuer l'acquisition d'images et de traitement, y compris déconvolution, par l'utilisation du logicielA, ou Softwares B1 et B2 (voir la liste des matériaux / équipement). S'il vous plaît voir Supplemental Files (5.2.1) Code pour toutes les commandes utilisées dans le logiciel A. Pour toutes les commandes utilisées dans Softwares B1 et B2, s'il vous plaît voir (5.2.2) dans les fichiers de code supplémentaire.
  3. Utilisez une méthode 23-25 ​​décrit précédemment pour quantifier les signaux de protéines centromériques-kinétochore (par exemple, les signaux de CENP-A au centromère restant) avec les modifications mineures suivantes:
    1. Sélectionner la zone des protéines centromère kinétochore et celle de l'arrière-plan comme suit:
      1. cellulaire mitotique: (région centromère-kinétochore) Sélectionnez la zone de chevauchement avec des chromosomes colorés avec DAPI; (région d'arrière - plan) et zone à l' extérieur mais à l' intérieur des chromosomes de la cellule unique identiques (région -à- dire, cytosolique).
      2. cellulaire interphase: (région centromère-kinétochore) Sélectionnez la zone de chevauchement avec la chromatine colorées avec DAPI; (Région d'arrière-plan) et zone à l'extérieur de la chromatine, mais l'intérieur de la cellule unique identique (<em> ie, région cytosolique).
        Note: Voir aussi Supplemental Files (5.2.1.4.3) ou (5.2.2.6.4) Code pour la sélection de la zone avec le logiciel A ou logiciel B2, respectivement.
    2. Quantifier le pourcentage des autres signaux aux centromères en utilisant Software A ou B. Pour cette tâche, utilisez la formule suivante:
      Restant signaux de protéines centromère-kinétochore au niveau du centromère-kinétochore
      équation1
      s est la luminosité du signal de la zone sélectionnée, ce qui est confirmé par l' ACA ou CENP-B coloration; b est la luminosité de signal de fond; échantillon de r est les signaux d'ACA de référence ou CENP-B pour les siRNA (s) des cellules traités par ; et r ctrl est l'ACA de référence ou des signaux CENP-B pour les cellules Luc siRNA-transfectées.
      Remarque: Dans cette analyse, les signaux CENP-B ont été utilisés comme signaux de référence pour CUL4A et RBX1 comme décrit dans les rapports précédents.
    3. Utilisez un fichier Excel pour ce calcul après copier et coller les données brutes à partir du logiciel signal de quantification décrit ci-dessus. Voir aussi Fichiers de code supplémentaire: (5.2.1.4) et (5.2.2.6) pour plus de détails. Un exemple de calcul est indiquée dans le tableau 3.
  4. Analyser au moins 20 cellules pour éliminer la variation de coloration et d'acquisition d'image pour chaque niveau de mesure. Vous pouvez éventuellement utiliser "valeur moyenne" des signaux centromériques-kinétochore restant pour chaque cellule analysée pour comparer ces valeurs entre les différentes protéines centromériques-kinétochore.

6. Western Blot L'analyse des protéines totales

  1. Remettre en suspension les cellules dans dénaturant tampon A (20 mM de Tris-HCl, pH 7,4, NaCl 50 mM, 0,5% de Nonidet P-40, 0,5% de désoxycholate, 0,5% de SDS, 1 mM d'EDTA et complète inhibiteur de protéase cocktail d'EDTA), 26 , sous réserve de la suspension à une sonication et le processus de congélation-décongélation, et mesureLes concentrations de protéines comme suit:
    1. Pour le processus de sonication, ajouter 50 pi de tampon A aux cellules recueillies à partir de deux puits d'une plaque de polystyrène à 6 puits à 48-72 heures après transfection (voir Protocole 1). Faire fonctionner un sonicateur équipé corne disrupteur et micropointe (voir la liste des matériaux / équipement) pour une durée totale de 15 sec intermittente impulsion (cycle de service de 50%) par un échantillon.
    2. Pour le procédé de congélation-décongélation, de geler les cellules avec de l'azote liquide et décongeler les cellules à la température ambiante.
    3. Mesurer la concentration de protéines en utilisant un dosage de protéine commerciale réactif I ou II (voir la liste des matériaux / équipement).
      Nota: Les lysats sont dilués avec rapport de 1:10 dans la mesure des concentrations de protéine soit avec le réactif I ou II. À cette dilution, le SDS présent dans le tampon A montre peu ou pas d'interférence dans cette mesure.
  2. Mélanger le lysat contenant 20-30 ug de protéine totale avec le tampon de chargement 2 × ou 4 × SDS-PAGE. 27 Faire bouillir les échantillons pour5 min, puis les charger sur un 12.0% -15.0% dénaturant SDS-polyacrylamide gel d'électrophorèse.
  3. Transférer les protéines séparées par SDS-PAGE sur une membrane de PVDF en utilisant un procédé Western Blot décrit précédemment. 17,24,27-31
    1. Bloquer les sites de liaison non spécifiques sur la membrane avec 5% de lait non gras dans 1 x PBS, puis incuber la membrane avec des solutions d'anticorps primaires dilués pendant 1 heure à température ambiante. Voir la liste des matériaux / équipement pour des informations détaillées (par exemple, le taux de dilution) de chaque anticorps primaire.
    2. Après lavage des membranes 3-4 fois (chaque incubation de 3 à 5 min avec agitation) avec du tampon PBS-T (1 x PBS et 0,1% de Tween-20), incuber la membrane dans un mélange proche de l'infrarouge (IR) anticorps secondaires colorant fluorescent conjugué (rapport de dilution de 1: 20 000), des anticorps secondaires DyLight conjugués (rapport de dilution de 1: 20 000) et / ou la peroxydase de raifort (HRP) conjuguée à des anticorps secondaires (dilué dans du PBS-T, dilutile rapport de 1: 10000) pendant 1 heure à température ambiante. Voir la liste des matériaux / équipement pour des informations détaillées (par exemple, le taux de dilution) de chaque anticorps secondaire.
  4. Laver la membrane 3 fois, puis balayer la membrane pour analyser les protéines avec le système d'imagerie infrarouge et / ou l'imageur de chimioluminescence pour la détection de immunoblot (voir la liste des matériaux / équipement).
    1. Pour utiliser le système d'imagerie infrarouge, voir (6.4.1) dans les fichiers de code supplémentaire.
    2. Pour utiliser l'imageur de chimioluminescence, voir (6.4.2) dans les fichiers de code supplémentaire. Utiliser un substrat ultra-sensible chimioluminescent renforcé (ECL) (voir la liste des matériaux / équipement) pour ce système.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L' analyse par immunofluorescence de CENP-A endogène soutient l'hypothèse que CUL4A-ligase E3 est nécessaire pour la localisation de CENP-A centromères
Nos études récentes ont montré que l' activité de ligase CUL4A-RBX1-COPS8 E3 est nécessaire pour ubiquitylation de la lysine 124 (K124) sur CENP-A et la localisation de CENP-A à centromères. 17 Initialement, le complexe interphase-centromère (ICEN) a été isolé par anti-CENP-a: immunoprécipitation de la chromatine native, 32-34 et il a été émis l' hypothèse que certaines des protéines ICEN peuvent jouer un rôle dans la localisation de CENP-a à centromères. Par conséquent, les siARN expériences de knock - down ont été réalisées pour cribler des protéines dont l' absence d'expression induite par la délocalisation de CENP-A , à centromères 17 (données non représentées) des cellules HeLa en croissance de manière asynchrone ont été transfectées avec Cullin 4A (CUL4A) siARN ou RBX1 siRNA pour les temps nécessaire pour optimiser l'épuisement des protéines (48 hr pour CUL4A et 72 h pour RBX1). Les cellules transfectées avec CUL4A siRNA ont montré une délocalisation importante de CENP-A à centromères (Figure 1A-C). Comme on le voit à la figure 2G, les niveaux de CENP-A dans des lysats cellulaires totaux de cellules CUL4A ARNsi transfectées protéines étaient (GCU) , les cellules d'ARNsi transfectée dans les mêmes conditions de culture similaire aux niveaux CENP-A dans des lysats de luciférase. La possibilité d'effets hors-cible de CUL4A siRNA a été exclu, parce que l' expression ectopique de CUL4A-Flag a sauvé la réduction de CENP-A à centromères lorsque CUL4A siRNA ciblé 3 'UTR (Figure 2A-C). Les teneurs en protéines de CENP-A dans les lysats cellulaires totaux ont été confirmés comme étant similaire à des niveaux CENP-A dans des lysats de cellules Luc ARNsi transfectées dans les mêmes conditions de culture indépendamment de la (1B des figures, 2G) en phase de cycle cellulaire; par conséquent, la possibilité que l'épuisement provoqué CUL4A CENP-A dégradation de la protéine a été éliminée.

35 et contiennent 3 éléments principaux: un échafaudage cullin, une protéine RING finger (RBX1 ou RBX2), et une E2 enzyme ubiquitine chargée qui est recruté par RBX1 ou RBX2, 36 BAGUE finger protein recrute aussi un adaptateur de substrat qui place les substrats à proximité de l'enzyme E2 pour faciliter le transfert de l' ubiquitine. 36 ARNsi RBX1 induit une réduction significative de la CENP-A à centromères (figure 1D-F) dans les conditions dans lesquelles les niveaux de protéine de CENP-A dans les lysats cellulaires totaux de cellules siARN transfectées RBX1 étaient semblables à des niveaux CENP-A dans les lysats de cellules Luc siRNA-transfectées (Figure 2G). La dégradation de la protéine CENP-A , soit par épuisement RBX1 ou par la combinaison de l' épuisement RBX1 CUL4A et dans les mêmes conditions de culture n'a pas été observée (figure 2G). La possibilité d'un effet hors cibles de RBX1 siRNA a été exclu, parce que l' expression ectopique de Flag-RBX1 sauvé la réduction de CENP-A à centromères lorsque RBX1 siRNA ciblé 3 'UTR (figure 2D-F). Ces résultats suggèrent que CUL4A-RBX1-ligase E3 est spécifiquement nécessaire pour la localisation de CENP-A à centromères.

L' analyse par immunofluorescence exogène CENP-A - protéines de drapeau indique que CENP-A K124 ubiquitylation est essentiel pour la localisation de CENP-A à centromères
Auparavant, notre analyse par spectrométrie immunoprécipitation de masse a montré que la lysine 124 (K124) de CENP-A-Flag est ubiquitylé dans des cellules HeLa. 17 Dans la structure cristalline de la CENP-A nucléosome, K124 réside dans l'hélice α3, bien que le site est pas dans la région CATD. 17 En outre, K124 est conservé chez les mammifères, les oiseaux, les lézards, les plantes, et un groupe de champignons (par exemple, bourgeonding levure). 17 CENP-A mutants de lysine (figure 3A) a été construit et testé leur capacité à se localiser au niveau du centromère. Abrogation substantielle de la localisation centromérique du exogène CENP-A mutant K124R avec des signaux diffus dans les deux mitose et interphase de cellules HeLa a été observée (figure 3B, C). Centromere localisation n'a pas été significativement affectée ni par des mutations K9A (K9 correspond à histone H3 K9 méthylation) , ni mutations K77R (K77 est un site unique en lysine CATD) (figure 3B, C).

Sur la base de ces résultats, deux hypothèses sont proposées en ce qui concerne la fonction de CENP-A ubiquitylation in vivo à K124. Tout d'abord, le rôle de l'ubiquitination K124 est à la protéolyse ubiquitine pour éliminer surexprimée et / ou mislocalized CENP-A euchromatin. Deuxièmement, le rôle de CENP-A ubiquitylation sur K124 est pour le chargement de CENP-A sur centromères. Pour tester le fpossibilité remièrement, les stabilités de CENP-A-Drapeau de type sauvage et le mutant K124R ainsi que endogènes CENP-A après cycloheximide (CHX) traitement des CUL4A- ou des cellules RBX1 appauvri ont été abordées. Ces données suggèrent que l' ubiquitination de K124 est probablement pas impliqués dans la protéolyse ubiquitine pour éliminer surexprimée et / ou mislocalized CENP-A (données non présentées). 17. En outre, il a été confirmé que la mutation K124R abroge les bandes de monoubiquitylation et diubiquitylation putatifs, à la fois in vivo et dans des essais de ubiquitylation in vitro (données non montrées). 17 Collectivement, ces données suggèrent que le complexe CUL4A-RBX1 contribue à la "signalisation" ubiquitination, qui est nécessaire pour CENP-A localisation au centromères.

L' analyse par immunofluorescence de drapeau exogène - protéines CENP-A indique que monoubiquitin fusion est suffisante pour chargerCENP-A K124R à centromères
Sur la base des résultats ci-dessus, il a été émis l'hypothèse que monoubiquitin lié de manière covalente sert de signal pour CENP-A chargement sur centromères. Pour tester cette hypothèse, une N-terminale et étiquetée Flag C-terminal de l' ubiquitine fusionnée de type sauvage CENP-A et un mutant K124R CENP-A a été construit (figure 4A). Le mutant monoubiquitin Ub (K48R), qui manque un site majeur pour polyubiquitylation 37-39 a également été utilisé pour empêcher l' ubiquitine fusionnée CENP-A protéines de polyubiquitylation potentiel. En capturant des signaux d'immunofluorescence anti-Flag, la localisation centromérique des protéines codées par ces constructions a été testée. Considérant que Flag-CENP-A (K124) sensiblement abrogé la localisation de centromère du CENP-A (figure 4B et 4C, colonne [6]), à la fois Flag-CENP-A (WT) et Flag-CENP-A (WT) -Ub ( WT) ont maintenu leur localisation centromérique (figure 4B et 4C, les colonnes [1] et [2]). leFlag-CENP-A (K124R) -Ub (K48R) protéine vraisemblablement imité monoubiquitylated CENP-A, car cette protéine pratiquement rétablie localisation à centromères (Figure 4C, comparer les colonnes [5] et [6]) de manière plus efficace que ne CENP-A (K124R) -Ub (WT) (figure 4C, comparez les colonnes [4] - [6]). Ces données ont démontré que monoubiquitylation est suffisante pour le recrutement de CENP-A centromères.

Figure 1
Figure 1. L' analyse par immunofluorescence de CENP-A endogène soutient l'hypothèse que CUL4A-ligase E3 est nécessaire pour la localisation de CENP-A centromères (figures ont été adaptées à partir Niikura et al. 17). (A) CUL4A siRNA induite par la délocalisation de CENP-A à centromères. Des cellules HeLa ont été transfectées avec CUL4A ou luciférase (Luc) siRNA et incubées pendant 48 heures (Tableau 1). La barre d'échelle représente 10 um. (B) Western analyse par transfert de HeLa lysats de cellules entières en utilisant les mêmes conditions de culture que dans (A). Les cellules ont été récoltées 48 heures après la transfection avec l' ARNsi ou CUL4A Luc siRNA (tableau 1). GAPDH a servi de témoin de charge. (C) quantifiées endogènes signaux CENP-A à centromères indiquées dans (A). La normalisation des signaux a été réalisée en utilisant des cellules Luc siRNA-transfectées, et les pourcentages moyens (± SD) sont présentés. **** P <0,0001 vs cellules Luc siRNA-transfectées (test t de Student). (D) RBX1 siRNA induite de délocalisation CENP-A de centromères. Des cellules HeLa ont été transfectées avec l' ARNsi RBX1 ou Luc (s) et mis en incubation pendant 72 h (Tableau 1). La barre d'échelle représente 10 um. (E) Analyse par transfert Western de lysats de cellules HeLa entier en utilisant les mêmes conditions de culture que dans (D). Les cellules ont été récoltées 72 heures après transfection avec RBX1 or Luc ARNsi (s) (tableau 1). GAPDH a servi de témoin de charge. (F) quantifiée signaux CENP-A endogènes à centromères indiquées dans (D). La normalisation des signaux a été réalisée en utilisant des cellules Luc siRNA-transfectées, et les pourcentages moyens (± SD) sont présentés. **** P <0,0001 vs cellules Luc siRNA-transfectées (test t de Student). S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. Information supplémentaire liée à la figure 1 centromères (figures ont été adaptées à partir de Niikura et al. 17). (A) Exogène CUL4A-Flag a sauvé la délocalisation de CENP-A lorsque CUL4A siRNA ciblé 3 'UTR. HeLa Tet-Off cells ont été fixées à 48 heures après co - transfection avec l' ARNsi (CUL4A # 2: 3 'UTR cible ou Luc; Tableau 1) ainsi que la construction de plasmide (pTRM4-CUL4A-Flag ou vecteur; tableau 2). 4 couleurs immunocoloration: coloration pour DAPI (bleu); Drapeau; CENP-B endogènes (en rouge); et endogènes CENP-A (vert), a été effectuée et les cellules Flag-positives ont été triées, mais les images de drapeau sont omis pour simplifier. Remarque: CUL4A n ° 2 est la cible identique à celle représentée sur la figure 1A-C. La barre d'échelle représente 10 um. (B) Western analyse par transfert de HeLa Tet-Off lysats de cellules entières suivant la même condition de culture comme indiqué dans (A). GAPDH a servi de contrôle de chargement. Signaux (C) CENP-A à centromères indiquées dans (A) ont été quantifiés par microscopie après le tri des cellules pour isoler ceux qui sont liés par un anticorps anti-Flag. La normalisation des signaux a été effectuée avec des cellules transfectées avec Luc siRNA ainsi que vecteur, et les pourcentages moyens (± SD) sont présentées.**** P <0,0001 vs cellules transfectées avec Luc siRNA , plus vecteur (colonne de gauche, le test t de Student). (D) Exogène Flag-RBX1 sauvé la délocalisation de CENP-A au niveau du centromère lorsque RBX1 siRNA ciblé 3 'UTR . Des cellules HeLa ont été fixées à 72 heures après co - transfection avec l' ARNsi (RBX1 # 2: 3 'UTR cible ou Luc; Tableau 1) ainsi que la construction de plasmide (pcDNA3-Flag-RBX1 ou vecteur; tableau 2). 4 couleurs immunocoloration: coloration pour DAPI (bleu); Drapeau; CENP-B endogènes (en rouge); et endogènes CENP-A (vert), a été effectuée et les cellules Flag-positives ont été triées, mais les images de drapeau sont omis pour simplifier. La barre d'échelle représente 10 um. (E) Analyse par transfert Western de lysats de cellules HeLa ensemble suivant les mêmes conditions de culture que dans (D). GAPDH a servi de témoin de charge. (F) signaux CENP-A à centromères indiquées dans (D) ont été quantifiés par microscopie après le tri des cellules pour isoler ceux qui sont liés par un n anticorps anti-Flag. La normalisation des signaux a été effectuée avec des cellules transfectées avec Luc siRNA ainsi que vecteur, et les pourcentages moyens (± SD) sont présentées. **** P <0,0001 vs cellules transfectées avec Luc siRNA , plus vecteur (colonne de gauche, le test t de Student). (G) Épuisement des CUL4A et RBX1 n'a pas affecté les niveaux de endogène CENP-A protéines. Les niveaux endogènes de protéine CENP-A HeLa ont été mesurées dans des lysats de cellules entières récoltées 72 heures après la transfection avec CUL4A, RBX1, CUL4A, plus RBX1 ou Luc ARNsi. Quarante-huit heures après la transfection, les cellules ont été soit non traitées (Asyn) ou traitées avec le paclitaxel (+ Tax) pour induire l'arrêt de la mitose, et ils ont été cultivées pendant 24 heures. GAPDH a servi de contrôle de chargement. S'il vous plaît cliquez ici pour voir une version plus grande de cette figure.

32 / 53732fig3highres.jpg "width =" 700 "/>
Figure 3. Analyse par immunofluorescence de protéines CENP-A-Flag exogènes indiqué que CENP-A K124 ubiquitylation est nécessaire pour CENP-A localisation au centromères ( Les chiffres ont été adaptés à partir de Niikura et al. 17). (A) surexpression de CENP-A- constructions Flag (mutants WT et KR) a été confirmée par une analyse Western blot de HeLa Tet-Off lysats de cellules entières. Les cellules ont été récoltées 48 heures après la transfection avec pTRM4-CENP-A-Flag WT, des mutants KR ou pTRM4 vecteur (tableau 2). La surexpression de CENP-A-Flag a été détectée par un anticorps anti-Flag. GAPDH a servi de contrôle de chargement. Putatif CENP-A-Flag dimère (##) et CENP-A-Flag monomère (#) sont présentés. Nota: SDS-résistant dimères CENP-A ont été rapportés antérieurement 40,41 (B) CENP-A mutant K124R a montré la délocalisation diffusé à partir centromères.. Les signaux provenant de DAPI (bleu), Drapeau (green), et endogène CENP-B (rouge, un contrôle de l'emplacement de centromère) sont présentés. Remarque: Contrairement endogène CENP-A dans les cellules transfectées avec CUL4A ou RBX1 siRNA, signaux diffus sont apparus dans les cellules qui surexprimés exogène CENP-A K124R-Flag comme un phénotype de l'incapacité à cibler à centromères, sans doute parce que son niveau d'expression est d'environ 10 - à 25 fois supérieure à celle de endogène CENP-A (données non présentées) 17 la barre d'échelle représente 10 um (C) histogrammes des motifs de localisation figurant dans (B)... Plus de 50 prométaphase et métaphase cellules pro / et plus de 200 cellules interphase par expérience ont été comptées (n ≥ 3 expériences). Les pourcentages moyens (± SD) sont présentés. "Autres (Non-centromère)" indique les cellules essentiellement endommagées, les cellules mortes, ou des cellules avec localisation nucléolaire (uniquement en interphase), probablement à cause de transfection ou d'autres traitements. *** P <0,001 vs CENP-A WT-Flag (t-test de Student).

Figure 4
Figure 4. Analyse par immunofluorescence de protéines Flag-CENP-A exogènes indiqué que CENP-A monoubiquitin fusion sauvé de l'délocalisation CENP-A mutant K124R de centromères (figures ont été adaptées à partir de Niikura et al. 17). (A) des dessins animés schématiques de chaque construction utilisée dans cette étude (voir également le tableau 2). Le site de mutation K124R sur CENP-A (rouge) et le site de mutation K48R sur monoubiquitin (bleu) sont présentées. (1) WT: Flag-CENP-A WT, (2) WT-Ub (WT): Flag-CENP-A WT-Ub (WT), (3) WT-Ub (K48R): Flag-CENP-A WT -Ub (K48R), (4) K124R-Ub (WT): Flag-CENP-A K124R-Ub (WT), (5) K124R-Ub (K48R): Flag-CENP-A K124R-Ub (K48R), (6) K124R: Flag-CENP-A K124R (B) Exogène CENP-A monoubiquitin fusion sauvé de l'délocalisation CENP-A mutant K124R de centromères.. DAPI (bleu), Drapeau (vert), et CENP-B endogène (rouge, un contrôle de l'emplacement de centromère) sont présentés. La barre d'échelle représente 10 um. (C) Histogrammes des motifs de localisation figurant dans (C). Plus de 50 prométaphase et métaphase cellules pro / et plus de 200 cellules interphase par expérience ont été comptées (n ≥ 3 expériences). Les pourcentages moyens (± SD) sont présentés. **** P <0,0001 et *** P <0,001 vs non fusionnée Drapeau-CENP-A K124R (colonne [6]) (test t de Student). S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

siRNA cible Indication dans cette étude Type cible Numéro de base de données siRNA Séquence Forward (s) Source / Référence
Luciferase (GL3) - 1 cible RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir et al. (2001)
CENP-A CA-UTR piscine siRNA (2 cibles mélange) RKK375 / 5 'UTR t1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura et al., (2015)
RKK383 / 3 'UTR t1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura et al., (2015)
CUL4A #1 1 cible CRKK178 / RKK309 / t1 AGCGAUCGUAAUCAAUCCUGA Niikura et al., (2015)
# 2 (3'UTR) 1 cible CRKK181 / RKK331 / t4 AUGCGGGUUUGAAAUAUGACA Niikura et al., (2015)
RBX1 / ROC1 #1 piscine siRNA (4 cibles mélange) CRKK198 / RKK411 / t1 GAAGCGCUUUGAAGUGAAA Niikura et al., (2015)
CRKK198 / RKK413 / t2 GCAUAGAAUGUCAAGCUAA Niikura et al., (2015)
CRKK198 / RKK415 / t3 GCAAGAAGCGCUUUGAAGU Niikura et al., (2015)
CRKK198 / RKK417 / t4 CAACAGAGAGUGGGAAUUC Niikura et al., (2015)
# 2 (3 'UTR) 1 cible CRKK206 / RKK425 / t8 UUCCCUGCUGUUACCUAAUUA Niikura et al., (2015)

Tableau 1. Séquences d'ARNsi utilisées dans cette étude.

Numéro B Caractéristique pertinente (s) Source / Référence
B288 pTRM4 Niikura et al., (2006)
B2067 CENP-A-Flag pTRM4 humain Niikura et al., (2015)
B2281 CENP-A K9A-Flag pTRM4 humain Niikura et al., (2015)
B2387 CENP-A K77R-Flag pTRM4 humain Niikura et al., (2015)
B2388 pTRM4-human CENP-A K124R-Flag Niikura et al., (2015)
B2512 CENP-A pTRM4-Flag-humaine Niikura et al., (2015)
B2579 CENP-A pTRM4-Flag humain K124R Niikura et al., (2015)
B2513 pTRM4-Flag-humaine CENP-A-Ub (WT) Niikura et al., (2015)
B2559 pTRM4-Flag-humaine CENP-A K124R-Ub (WT) Niikura et al., (2015)
B2515 pTRM4-Flag-humaine CENP-A-Ub (K48R) Niikura et al., (2015)
B2560 pTRM4-Flag-humaine CENP-A K124R-Ub (K48R) Niikura et al., (2015)
B2759 CUL4A-Flag pTRM4 humain Niikura et al., (2015)
B2624 RBX1 pcDNA3-Flag-humaine Niikuraet al., (2015)
B1491 pcDNA3-Flag Niikura et al., (2015)

Tableau 2. Des vecteurs plasmidiques utilisés dans cette étude.

R (anti-CENP-B) échantillon b (anti-CENP-B) Échantillon R (soustrait) Ratio (échantillon S: échantillon R) Ratio corrigée (échantillon S: échantillon R)
520 514 6 -4,167 0.000
535 445 90 -1,033 0.000
515 431 84 0,274 0,274
562 483 79 0,506 0,506
902 562 340 0,509 0,509
1203 703 500 -0,560 0.000
1014 589 425 -0,819 0.000
768 510 258 -1,345 0.000
555 458 97 -1,845 0.000
781 576 205 -1,146 0.000
556 436 120 0,758 0,758
534 493 41 -1,634 0.000
702 543 159 0,667 0,667
482 429 53 -1.000 0.000 654 531 123 0.740 0.740
1190 607 583 0,384 0,384
552 454 98 0,969 0,969
489 413 76 0,539 0,539
511 452 59 -3,186 0.000
485 475 dix -2,700 0.000
481 441 40 -1,475 0.000
Somme 5.347
Moyenne 0,255
R (anti-CENP-B) ctrl b (anti-CENP-B) Ratio (S ctrl: R ctrl) Ratio corrigée (S ctrl: R ctrl)
543 483 60 3.017 3.017
526 466 60 2.667 2.667
532 460 72 1.792 1.792
507 457 50 3.520 3.520
491 458 33 4.273 4.273
545 464 81 2.160 2.160
518 484 34 3.559 3.559
461 404 57 2.404 2.404
487 447 40 3.550 3.550
534 477 57 3.965 3.965
528 456 72 3.097 3.097
707 601 106 1.868 1.868
615 528 87 2.828 2.828
660 481 179 1.620 1.620
565 476 89 1.607 1.607
527 455 72 3.583 3.583
560 474 86 2.930 2.930
510 451 59 4.017 4.017
729 586 143 2.678 2.678
634 576 58 3.655 3.655
507 476 31 3.935 3.935
Somme 62,725
Moyenne 2.987
Restant signaux CENP-A à centromère (%) 8.5

. Tableau 3. Un exemple de calcul des autres signaux CENP-A au niveau du centromère (en%) Un exemple de Pro / Prométaphase dans la figure 2F est représenté: l' échantillon est RBX1 # 2 (3'UTR) + Vec (colonne centrale de la figure 2F ) et le contrôle est Luc + Vec (colonne gauche de la figure 2F). En conséquence, les signaux restants CENP-A àcentromère (%) = (0,255 / 2,987) x 100 = 8,5% est obtenu (Ou [5.347 / 62,725] x 100 = 8,5% avec le même nombre total de cellules [ie, 21 cellules] analysées entre deux échantillons). Notez que si la valeur de b est plus que la valeur S ( par exemple, si la valeur soustraite est négative), la valeur du ratio corrigé est fixé à 0,00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Au cours des dernières années , de nombreuses études ont développé différents tests de microscopie quantitative pour les cellules fixes. 42 Progrès dans centromère-kinétochore biologie nécessite souvent une compréhension de la fonction centromère spécifique ou spécifique à kinétochore de protéines de laquelle la régulation spatio-temporelle subcellulaire reflète l'évolution des fonctions de ces protéines au cours du cycle cellulaire. Par conséquent, nous avons développé ici des procédés de coloration IIF et un dosage quantitatif IIF pour analyser plus précisément les niveaux relatifs des protéines endogènes et exogènes CENP-A, qui peuvent être applicables dans des échantillons traités différemment. Actuellement nous avons réalisé avec succès la coloration IIF endogène CENP-I, CENP-H, KNL1, HEC1 et SKA1 utilisant le protocole 2 dans cette étude (voir Niikura et al 24 et données non présentées;. Liste des Matériaux / Équipement pour l' information des anticorps) . À l'avenir, on peut appliquer la même méthode pour quantifier le niveau de différentes protéines centromériques-kinétochore (deux EndoGEnous et Flag-tagged protéines exogènes) le choix des anticorps spécifiques, cependant, nos méthodes de l'IIF ne couvrent pas la détection de ces protéines dans les cellules vivantes ou dans une cellule spécifique unique au cours du cycle cellulaire entier. Parce que ces procédures nécessitent des cellules à fixer et traitées sur des lamelles distinctes, nous avons introduit des signaux de référence (par exemple, ACA ou CENP-B) aux fins de normalisation afin de comparer équitablement les signaux entre les différents échantillons et d' augmenter la précision du dosage. Parce que ACA impliquent et ou exogènes signaux endogènes / CENP-A, CENP-B en tant que signal de référence en vue de la normalisation serait plus approprié pour la comparaison que ne le ferait l'ACA en termes de précision du dosage quantitatif de signaux CENP-A. La région amino-terminale de CENP-B se lie au motif de 17 pb de la séquence de la boîte CENP-B dans l' ADN alphoïde et la région carboxy-terminale de CENP-B forme des homodimères. 43,44 CENP-B ne colocalisent pas complètement avec CENP-A et / ou d'autres chaufprotéines OMERE-kinétochoriens, cependant, est étroitement associé avec eux. 45 Alors immunofluorescence avec des anticorps anti-CENP-C donne généralement deux points discrets, coloration avec anti-CENP-B apparaît souvent comme un seul bar lumineux reliant les deux centromères soeurs. 46 Cependant , dans notre observation microscopique macro-échelle, certains signaux CENP-B apparemment se chevauchent avec des signaux CENP-A, en particulier à des stades mitotiques antérieures (prophase-prométaphase que tard métaphase), également en partie en fonction de l'angle d'observation et le type de fixateur utilisé (données non présentées). En revanche, dans un dosage IIF quantitative des signaux CENP-A, la localisation des protéines de signaux de référence ne doit pas être affectée par l'appauvrissement et / ou un dysfonctionnement de CENP-A des fins d'analyse juste, bien que la localisation de la plupart des protéines du centromère kinétochore est dépendante CENP-A localisation au centromères. d'assemblage de kinétochore 47,48 CENP-A-indépendant est établi en remplaçant les régions de liaison à l' ADN de CENP-C Et CENP-T avec des domaines chromosomiques ciblage alternatifs qui recrutent ces protéines loci ectopique. 49,50 De plus, des travaux récents ont indiqué que les composants kinétochoriens internes CENP-C et CENP-T agissent en parallèle pour recruter le réseau KMN à kinétochores. 51-54 de plus, Nishino et al. ont suggéré que les formes complexes CENP-TWSX une structure nucléosome comme unique pour générer des contacts avec de l' ADN, l' extension du «code histone» au - delà des protéines nucléosomes canoniques. 55 Parce que la localisation de centromère du CENP- C est dépendante de la localisation des centromères de CENP-a, 47,48 CENP-TWSX ou en particulier CENP-T pourrait être un autre candidat (s) de protéine pour fournir des signaux de référence dans un dosage quantitatif de l' IIF CENP-a. Cependant, le candidat pour la signalisation de référence doit être soigneusement testés avant l'essai afin de déterminer si la localisation au centromère est affectée par déplétion et / ou d'un dysfonctionnement de CENP-A. examen analoguedevraient être prises pour des analyses quantitatives IIF d'autres protéines centromériques-kinétochore: la localisation des protéines de signaux de référence ne devrait pas être affectée par l'épuisement et / ou d'un dysfonctionnement de la protéine cible pour une analyse équitable. Dans l'étude précédente, nous avons utilisé ACA comme un signal de référence pour quantitative test IIF d'autres protéines kinétochoriens centrales-externe. 24 ACA pourrait être une option plus appropriée que seule CENP-B comme un contrôle de position ainsi qu'un signal de référence, si ACA les signaux ne sont pas affectés par déplétion et / ou d'un dysfonctionnement de la protéine cible, mais colocalisation de la protéine cible avec CENP-B est faible, comme mentionné ci-dessus.

Bodor et al. ont rapporté que les niveaux CENP-A centromériques sont réglementés par l' action de masse, à savoir, la quantité de centromérique CENP-A varie en proportion directe avec le contenu cellulaire. 56 Ils ont également montré que l' induction transitoire de CENP-A expression conduit à une augmentation rapide de la centromérique CENP-A niveau. A l' inverse, nous avons observé une grande population de cellules avec centromère-localisée, Drapeau-étiqueté CENP-A WT après cotransfection du vecteur d'expression pTRM4 avec CA-UTR siRNA (un mélange de 5 'et 3' UTR siRNA; tableau 1) (données non représenté); cette population était supérieure à celle observée après la transfection avec seulement le vecteur d'expression pTRM4. Le niveau exogène CENP-Protéine de marquage Flag, dont l'expression est entraînée par pTRM4, était d'environ 1,0 à 1,4 ordres de grandeur (10 à 25 fois) supérieur à celui de endogène CENP-A (données non présentées). Il est spéculé que l'expression exogène CENP-A WT-dessus d'un certain seuil pourrait nuire à sa localisation centromérique appropriée.

Dans les présents protocoles, la fixation est une étape critique pour maintenir la structure cellulaire et de l'environnement que la situation proximale que possible à l'état natif. Une fois que les cellules sont fixées, on doit procéder au protocole de coloration pour éviter la perte de la protéine d'interepos ou dans le reste de la cellule. Cependant, la fixation détruit les sites antigéniques de temps en temps, et des combinaisons anticorps-antigène fonctionne mal avec un fixatif, mais très bien avec les autres. 21 En raison de cette variation, le choix d' un fixateur dépend en grande partie de la protéine (s) d'intérêt. La longueur de temps de fixation peut affecter de manière significative la détection de la protéine (s) par immunocoloration, et la fixation plus courte est généralement préférable de conserver l' antigénicité. 57 Par conséquent, lors de la détermination des procédures de coloration pour une nouvelle cible d'autres protéines centromériques-kinétochore, en particulier d'incertitude localisation, ou lorsque vous travaillez avec un nouvel anticorps, on doit tester plusieurs méthodes de fixation et des tampons pour trouver la condition optimale. Dans les présents protocoles, deux classes de fixateurs populaires ont été sélectionnés: fixateurs aldéhyde (protocole 2) et les solvants organiques (Protocoles 3 et 4). La pureté des fixateurs est également extrêmement important. Dans le protocole 4, le sérum de chèvre 4% est utilisé especially pour bloquer les récepteurs d' IgG sur la surface cellulaire pour réduire fond non spécifique. 57 En général, le sérum pour le blocage des récepteurs d' IgG devrait être d'une espèce non liée à l'anticorps primaire et de préférence de la même espèce que l'anticorps secondaire. 57

Dans chacun des protocoles actuels, le choix de l'anticorps primaire est l'étape la plus critique dans la réalisation immunocoloration avec succès. L'anticorps avec la plus grande spécificité, la pureté, l'affinité et l'avidité est souhaitée. Une bonne concentration de départ pour les anticorps monoclonaux est habituellement de 1 à 5 ug / ml. Dilutions typiques de la préparation de la pâte d'anticorps polyclonaux vont de 1:20 à 1:. 500 57 Il faut déterminer empiriquement la concentration appropriée de l'anticorps primaire et le diluant pour chaque échantillon. Les échantillons doivent être doucement secoué mais non séchés pendant l'incubation pour la coloration homogène. lavage extensif entre l'incubation de l'anticorps primaire et un secondairentibody peut être nécessaire pour éviter une réaction croisée avec les immunoglobulines d'autres espèces. Toutefois, la condition de lavage optimale doit être déterminée empiriquement pour éviter la perte de cellules, en particulier les cellules en mitose, qui arrondissent et se détachent quand on les secoue (ie, mitotique shake-off). 58 Pour réussir, un anticorps secondaire doit être choisi pour se lier à l'anticorps primaire avec une grande affinité. Par exemple, pour éviter la liaison non spécifique de la partie Fc de l'anticorps secondaire à des récepteurs Fc des IgG, Fb (ab ') 2 peuvent être utilisés à la place de l'anticorps entier. 57 Pour de nombreux anticorps secondaire, le temps d'incubation peut être réduite à 30 minutes à la température ambiante pour réduire le fond non spécifique.

En outre le protocole n ° 5, laser, microscopie confocale à balayage pourrait être avantageux pour la détection et l'analyse de la localisation et la fonction des protéines centromériques-kinétochore ayant les propriétés fluorescentes. Comme le montre la liste des matériaux / Equipment, Alexa Fluor 488 et Alexa Fluor 594 sont probablement des colorants fluorescents les plus fréquemment utilisés dans les protocoles actuels. Pour détecter les deux protéines et / ou multiples différents centromère kinétochore dans l'échantillon, il faut veiller à ce que les anticorps utilisés pour détecter une protéine ne préviennent pas la détection de la seconde protéine. 57 Dans les protocoles actuels, deux anticorps primaires sont mélangés et appliqués en même temps. Cependant, il faut optimiser les conditions de immunocoloration pour chaque protéine séparément avant d'appliquer les anticorps primaires ou secondaires, ainsi que: si les deux protéines sont très proches comme dans le cas de deux composants centromère kinétochoriens, un anticorps primaire peut structurellement empêcher la liaison du second anticorps primaire. Une autre préoccupation de la détection de signaux multiples est le problème du chevauchement spectral: la difficulté à empêcher le signal d'un colorant "fuite" dans le canal spectral d'un autre. Ce problème devient plus difficile pour les congrèsal filtre d'interférence fixe pour résoudre le nombre de colorants augmente ou si l'échantillon contient des signaux overenhanced (par exemple, les signaux ACA ou anti-Flag dans la présente étude), y compris l'interférence de l' autofluorescence. Dépannage d'autofluorescence a été menée dans d' autres études. 57,59,60 Dans la présente étude, l' optimisation des jeux de filtres fluorescents avec des commandes en une seule partie dans chaque canal est suffisante dans la plupart des cas pour éviter ces problèmes (voir ci - dessous).

Dans chacun des présents protocoles, des contrôles appropriés sont essentiels. Chaque nouvel anticorps primaire doit être caractérisée avant le début de l'immunocoloration. La spécificité de l'anticorps doit être confirmée par analyse par transfert de Western, le cas échéant. En outre, la confirmation que la coloration ne soit pas provoquée par la liaison non spécifique à la surface cellulaire doit être obtenue, et la concentration optimale de fonctionnement d'un anticorps primaire particulière doit être déterminée à l'aide de dilutions en série(Ie, une courbe de liaison devrait être développée). Un témoin négatif ( par exemple, l'absence de l'anticorps primaire à partir du processus de coloration) devraient être inclus. Une autre option de contrôle négatif est la substitution d'IgG normale de la même espèce pour l'anticorps primaire. Pour la détection de plusieurs étiquettes, il faut préparer des témoins sans anticorps secondaires (le contrôle de fond) ainsi que des contrôles en une seule partie pour éviter les artefacts de chevauchement spectral (c. -à- transpercement, croisement, diaphonie, ou de colorant "fuite" , comme décrit ci - dessus ). On peut quantifier la fraction de "fuite" en comparant les signaux à travers les filtres «mauvais» avec le signal correct, en utilisant ces proportions pour enlever informatiquement tous "fuite" , et le calcul de la vraie distribution et / ou co-localisation de marqueur fluorescent. 60 Le contrôle de fond doit être examinée de façon indépendante à chaque canal pour définir les limites de gain de signal et de décalage pour être adaPtEd pour l'imagerie finale. Tous les canaux qui seront utilisés pour obtenir une image d'un échantillon multiple label doivent être soumis à une correction de fond indépendant, parce que le niveau d'autofluorescence dans chaque canal varie sensiblement. Les contrôles "fuites" tels que décrits ci - dessus sont nécessaires pour déterminer le montant du gain de signal possible dans chaque canal sans détecter "fuite" dans les canaux adjacents. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu'ils ont aucun intérêt financier concurrents.

Acknowledgments

Ce travail a été soutenu par le NIH subvention GM68418.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Protéines immunofluorescence Analyse des endogènes et exogènes Centromere-kinétochoriens
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter