Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Immunofluorescensanalyse av Endogene og eksogene cent-kinetochore Proteiner

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"sentromerer" ble klassisk definert som områder av undertrykt meiotisk rekombinasjon i genetikk og senere anerkjent som den primære innsnevring av mitotiske kromosomer, som spiller en viktig rolle i nøyaktig kromosom segregering under mitose. "kinetochores" ble beskrevet som den multilagsstrukturer som binder seg til mikrotubuli ved overflaten av sentromerer, som vist ved elektronmikroskopi; "kinetochores" ble senere definert som macromolecular kompleks som lokaliserer på cent av mitotiske kromosomer. Til tross for en dramatisk divergens av centromeric DNA-sekvenser blant virveldyr, kinetochore struktur og sammensetning er sterkt konservert. En dynamisk samspill mellom spindel mikrotubuli og kinetochore er nødvendig for trofast segregering av kromosomer under mitose, og defekter i cent-kinetochore funksjon fører til Aneuploidy og dermed kreft.

Cent i de fleste eukaryoterhar ingen definert DNA-sekvens, men er sammensatt av store matriser (0.3-5 MB) med repeterende alphoid DNA bestående av 171-bp α-satellitt-DNA. Bortsett fra i spirende gjær, er cent identitet oppnås ikke av DNA-sekvensen, men ved tilstedeværelsen av en spesiell nucleosome som inneholder histon H3 varianten CenH3 (cent Protein A [CENP-A] i mennesker). 5 CENP-A nukleosomer lokalisere til indre plate av pattedyr kinetochores 7 og binde seg til 171-bp α-satellitt DNA. Aktive sentromerer krever CENP-A-holdig nukleosomer til direkte rekruttering av et konstituerende cent-forbundet nettverk (ccan) og kinetochore proteiner, som sammen regulere feste av kromosomene til mitotisk spindel og påfølgende syklus progresjon gjennom spindel sjekkpunkt.

I lys av det ovenstående bevis har CENP-A blitt foreslått å være den epigenetisk merket på cent 8; imidlertid, den prosessen som CENP-A er inkorporert into centromeric DNA og de faktorer som er ansvarlige for dette inkorporering ennå ikke er godt karakterisert. En kort cent-målsøkende domene (CATD) befinner seg i den histon fold region av CENP-A, og erstatning av det tilsvarende område av H3 med CATD er tilstrekkelig til direkte H3 til cent. 9. Flere studier antydet funksjonelle roller for post-translasjonell modifikasjon (PTM) av CENP-A 12-16; Men de molekylære mekanismene for disse PTMs av CENP-A i rekrutteringen til sentromerer ennå ikke er klarlagt. Vi har tidligere rapportert at CUL4A-RBX1-COPS8 E3 ligase aktivitet er nødvendig for CENP-A K124 ubiquitylation og lokalisering av CENP-A til sentromerer. 17

Oppdagelsen og karakterisering av kinetochore proteiner har ført til ny innsikt om kromosom segregering. 18 Mer enn 100 kinetochore komponentene har blitt identifisert i virveldyrceller ved ulike tilnærminger. 19,20 En understående av hvordan kinetochores montere og funksjon kommer også fra karakteriseringen av de cellulære funksjoner av hver cent-kinetochore proteiner og protein-protein-nettverket i cellene. 19 direkte visualisering og avansert avbildningsmetoder i fluorescens mikroskopi gir bemerkelsesverdig oppløsning av cent-kinetochore komponenter og tillate direkte observasjon av spesifikke molekylære komponenter av sentromerer og kinetochores. I tillegg er fremgangsmåter for indirekte immunfluorescens (IIF) farging ved hjelp av spesifikke antistoffer er avgjørende for disse observasjonene. Men til tross for mange rapporter om IIF protokoller, få diskutert i detalj problemer med spesifikke cent-kinetochore proteiner. 1-4 Dermed utvikle og rapportering metoder for IIF flekker og en kvantitativ IIF analyse for å spesifikt analysere hver cent-kinetochore protein er ekstremt viktig. I IIF farging, bør man fortsette med fargingen protokollen for å unngå tap av proteinet av interesse ellerresten av cellen. Imidlertid ødelegger fiksering antigene seter fra tid til annen, og forskjellige antistoff-antigen kombinasjoner fungerer dårlig med en fikseringsmiddel, men svært godt med hverandre, 21 og valg av bindemiddel avhenger i stor grad av protein (er) av interesse. Derfor ulike festing metoder er avgjørende i IIF farging av cent-kinetochore proteiner.

Her optimaliserte fremgangsmåter for indirekte immunfluorescens (IIF) farging, og en analyse for å adressere lokalisering av endogene cent-kinetochore proteiner, inkludert CENP-A og Flagg-merkede eksogene CENP-A-proteiner, og kvantifisering av disse proteiner i humane celler har blitt utviklet. Disse metodene kan brukes til analyse av cent-kinetochore proteiner i andre arter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cell Culture og Transfeksjon

  1. Sette et dekkglass (22 mm x 22 mm) i en 6-brønns polystyren plate. Eventuelt frakk et dekkglass med Poly-L-lysin, 0,1% vekt / volum, i vann (se liste over materialer / utstyr) for å holde mitotiske celler på dekkglass å følge trinnene nedenfor:
    Merk: Optimale betingelser må bestemmes for hver cellelinje og anvendelse.
    1. Aseptisk belegge kulturoverflaten med poly-L-lysin, 0,1% vekt / volum, i vann (0,4 ml / brønn av en 6-brønns polystyren plate). Rist for å sikre jevn belegging av kulturoverflaten.
    2. Etter 5 min, fjerne oppløsningen ved avsugning og skylle overflaten med sterilt vevskultur karakter vann.
    3. Tørke i minst 2 timer før innføring av celler og medium.
  2. Seed HeLa-celler 17 eller HeLa-Tet-Off-celler 17,22 på et dekkglass (22 mm x 22 mm) satt i en 6-brønns polystyren plate. Sjekk at mobiltettheten er 5,4 x 10 5 per brønn. Kultur celleri høy glukose DMEM med 10% FBS og 1% penicillin-streptomycin.
    Merk: For optimalt resultat, empirisk bestemme celletettheten til å bruke i seeding.
  3. Inkuber cellene ved 37 ° C i en atmosfære av 5% CO2 i 18 timer.
    Merk: I tilfelle av HeLa Tet-Off-celler, transkripsjon av det eksogene genet er aktiv i fravær av induser (dvs. tetracyklin / doksycyklin) derfor kultur celler uten tetracyklin / doksycyklin og transfektere transient med pTRM4 overekspresjon vektor (tabell 2 ), hvis transkripsjon er regulert av TRE-promotoren (se nedenfor).
  4. Atten timer etter såing, transfektere celler som følger:
    1. Gjør løsning A ved å blande 1,5 mL siRNA oligo (20 mikrometer glødet lager, Tabell 1) og / eller 2,0 mikrogram plasmid (tabell 2) i 50 pl redusert serum medium (se liste over materialer / utstyr), og inkuber ved RT i 5 min .
      Merk: I denne analysen,CA-UTR sirnas (en blanding av 5 'og 3' UTR siRNA; Tabell 1) ble ko-transfektert til bruk i protokoll 3 og 4 (se diskusjon).
    2. Gjør løsning B ved å blande 0,75 mL transfeksjon reagens I (se liste over materialer / utstyr) i 50 ul redusert serum medium, og inkuber ved RT i 5 min.
      Merk: En valgfri trinnet er tillegg på 1,0 mL transfeksjon reagens II (se liste over materialer / utstyr).
    3. Blande oppløsninger A og B sammen, og inkuber ved romtemperatur i 15 min.
    4. Vask de dyrkede cellene en gang med PBS, og deretter legge til 500 mL redusert serummedium til hver brønn på 6-brønners polystyren plate. Tilsett blandingen av løsninger A og B (dvs. RNA og / eller DNA-lipid-kompleks) direkte til hver av de enkelte brønn.
      Merknad: Endelig konsentrasjon er 3,3 ug / ml (plasmid); 50 nM (siRNA).
    5. Inkuber cellene ved 37 ° C i en atmosfære av 5% CO2 i 4,5 timer. Endre medium til høy glukose DMEM viddh 10% FBS og 1% penicillin-streptomycin.
    6. Inkuber cellene ved 37 ° C i en atmosfære av 5% CO2 i 48-72 timer etter transfeksjon.
      Merk: For best mulig resultat, må inkubasjonstiden for cellevekst før fiksering bestemmes empirisk, og protein nedbryting og / eller uttrykk må bekreftes av Western blot analyse (se Protocol 6).
    7. Hvis mitotiske celle analyse er av interesse, legge paclitaxel (10 nM) for å dyrkede celler 24 timer før fiksering, eller legge TN16 (0,5 mm) til dyrkede celler 2,5 time før fiksering.

2. Cell Fixation og Immunofluorescent Farging å oppdage Endogene cent-kinetochore Proteins (Paraformaldehyde Fixation)

  1. Utarbeidelse av festing, buffere og reagenser.
    1. Tilbereder 50 ml av 4% paraformaldehyd i PBS-løsning, pH 7,4.
      1. Legg 40 ml 1 x PBS til et begerglass på et rør plate i en ventilert hette. Heat mens stirring til ca 60 ° C. Tilsett 2 g paraformaldehyd pulver til det oppvarmede PBS.
      2. Heve langsomt pH-verdien ved tilsetning av 1 ml av 1 N NaOH i total, fordi pulveret ikke vil umiddelbart oppløses.
        Merk: Løsningen tømmer etter tilsetning av NaOH.
      3. Når paraformaldehyde er oppløst, kjølig og filtrer løsningen.
      4. Juster pH-verdien med 1 N HCl til pH 7,4, og volumet av oppløsningen med 1 x PBS til 50 ml.
        Merk: Prøver av oppløsningen kan fryses eller lagres ved 2-8 ° C for så lenge som en uke. Løsningen skal være iskald eller lagret ved 4 ° C inntil den skal brukes.
    2. Fremstille 50 ml buffer KB1, som består av 10 mM Tris-HCl, pH 7,5; 150 mM NaCl; 0,5% BSA; og 0,5% Triton X-100.
      Merk: BSA bør være ferske lagt.
      Merk: Buffer KB-serien er basert på buffer KB beskrevet i tidligere rapporter 1,2,4.
    3. Fremstille 50 ml buffer KB2, som består av 10 mM Tris-HCl,pH 7,5; 150 mM NaCl; og 0,5% BSA.
      Merk: BSA bør være ferske lagt.
    4. Fremstille 1 ml buffer inneholdende KB3 DAPI (50 ng / ml).
    5. Fremstille 100 ml monteringsmedium, som består av 1 mg / ml p-fenylendiamin; 10% PBS, og 90% glycerol.
      1. Juster pH på 1 x PBS til 9,8 med 1 N NaOH, oppløse p-fenylendiamin i løsningen, og deretter legge til glycerol.
      2. Butikk 1 ml porsjoner ved -80 ° C. Beskytt mot lys.
  2. Fjerne kulturmediet ved aspirasjon ved 48-72 timer etter transfeksjon (se Protokoll 1) for cellefiksering. Skyll cellene en gang med PBS. Anvende PBS til siden av kulturbrønnene for å unngå å forstyrre overflaten av cellene.
    Merk: Den optimale tidspunktet for celle fiksering må bestemmes empirisk.
  3. Fiksere cellene i 4% paraformaldehyd i PBS i 30 minutter ved 4 ° C. Skyll cellene to ganger med buffer KB2 å fjerne tilstrekkelig gjenværende 4% paraformaldehyde.
  4. Permeabigående stabiliserer prøvene i buffer KB1 i 30 minutter ved RT. Skyll cellene gang med buffer KB2, og legge buffer KB2 i 5 min ved RT ytterligere blokkere nettsteder av uspesifikk binding.
    Merk: Buffer KB1 bidrar også betydelig til blokkering.
  5. Fjerne et dekkglass (22 mm x 22 mm) fra en 6-brønns polystyren plate ved hjelp av tang. Ved hjelp av en hydrofob barriere penn (se liste over materialer / utstyr), tegne en blek grønn firkant eller sirkel for å danne en hydrofob barriere rundt hvert dekkglass prøve. Ikke berør eller kommer for nær cellene med hydrofobe barriere penn. Sett glasset i nye seks-brønns polystyren plate.
  6. Fortynn et primært antistoff til cent eller kinetochore protein (fortynningsforhold på 1: 100 til 1: 200; se også Liste over materialer / Equipment) og enten et anti-B-antistoff CENP (fortynningsforhold på 1: 400) eller et anti- cent antistoff (ACA) (fortynning forholdet 1: 2000) som en centposisjonsmerke i buffer KB2.
    Merk: For optimalt resultat, slutt konsensjon av det primære antistoff i denne løsningen må bestemmes empirisk.
  7. Anvende et tilstrekkelig volum (ca. 30 pl) av den fortynnede primært antistoff for å senke celleprøven. Inkuber celleprøve i 1 time ved 37 ° C. Skyll cellene 3 ganger med buffer KB2.
  8. Ved hjelp av buffer KB2, fortynne en fluorofor-konjugert sekundært antistoff (fortynningsforhold på 1: 100 til 1: 200) som er rettet mot hverandre primært antistoff.
    Merk: For optimale resultater, må den endelige konsentrasjonen av det sekundære antistoffet i denne oppløsning bestemmes empirisk.
  9. Anvende et tilstrekkelig volum (et fall på ca. 30 ul på dekkglasset) av den fortynnede, sekundært antistoff for å senke celleprøven. Inkuber celleprøve i 1 time ved 37 ° C. Rens cellene 5 ganger med buffer KB2 i løpet av en periode på 30 min (fem min 6 vaskinger).
    Merk: For optimalt resultat (dvs. for minimalt tap av celler), må den optimale vaske tilstand bestemmes Empirically.
  10. Påfør et tilstrekkelig volum av buffer KB3 inneholder DAPI (50 ng / ml) for å dyppe den celleprøve. Inkuber celleprøve i 5 min ved RT. Skyll cellene 1-2 ganger med buffer KB2.
  11. Monter dekkglasset som inneholder celleprøve på micro lysbildet.
    1. Plassere en dråpe av monteringsmedium i sentrum av mikro lysbildet.
    2. Fjerne væske fra celleprøve og, ved hjelp av hendene eller tang, plasserer prøven i midten av mikro lysbildet. Unngå luftbobler.
    3. Fjern overflødig montering medium med et papirhåndkle.

3. Cell Fixation og Immunofluorescent Farging av C-terminal Flag-merket CENP-A Proteins (Aceton Fixation)

  1. Preparat
    1. Forbered iskald 75% aceton.
    2. Tilbereder 50 ml PBS (pH 7,4) inneholdende 0,5% skummet melk og 0,5% BSA.
    3. Tilbereder 50 ml PBS (pH 7,4) inneholdende 0,1% skummet melk og 0,1% BSA.
    4. Forbered 1 ml PBS (pH 7,4) inneholdende DAPI (50-100 ng / ml).
    5. Forbered 100 ml monteringsmedium som beskrevet i 2.1.5.
  2. Fjerne kulturmediet ved aspirasjon ved 48-72 timer etter transfeksjon (se Protokoll 1) for cellefiksering. Skyll cellene en gang med PBS. Anvende PBS til siden av kulturen godt for å unngå å forstyrre overflaten av cellene.
    Merk: Den optimale tidspunktet for celle fiksering må bestemmes empirisk.
  3. Fiksere cellene i iskald 75% aceton, og inkuberes cellene i 10 minutter ved -20 ° C. Tørre celler på dekkglass i et avtrekksskap i 30-60 minutter ved RT.
    Merk: For best mulig resultat, må tiden som trengs for fiksering og celle tørking bestemmes empirisk.
  4. Bruke den hydrofobe barriere penn (se liste over materialer / utstyr), tegne en blek grønn firkant eller sirkel for å danne en hydrofob barriere rundt hvert dekkglass prøve. Ikke berør eller kommer for nær cellene med hydrofobe barriere penn.
  5. Block nonspecific bindingsseter på cellene ved tilsetning av PBS inneholdende 0,5% skummet melk og 0,5% BSA i 5 min ved RT.
  6. Ved å bruke PBS inneholdende 0,1% skummet melk og 0,1% BSA, fortynne en anti-Flag-antistoff (1: 1000 fortynning forhold) og enten et anti-A-B CENP antistoff (fortynningsforhold på 1: 200) eller ACA (1: 2000 fortynning forholdet ) som en centposisjonsmerke.
    Merk: For optimale resultater, må den endelige konsentrasjonen av det primære antistoff i denne løsningen bestemmes empirisk.
  7. Anvende et tilstrekkelig volum (ca. 30 pl) av den fortynnede primært antistoff for å senke celleprøven. Inkuber celleprøve i 1 time ved 37 ° C. Rens cellene 5 ganger med blokkeringsbuffer i løpet av en periode på 30 min.
    Merk: Celler kan vaskes bort med PBS. For optimale resultater (dvs. å unngå tap av celler), må de optimale vaskebetingelser bestemmes empirisk.
  8. Fortynn en fluorofor-konjugert sekundært antistoff (fortynningsforhold på 1: 100 til 1: 200) som er rettet motden hver primære antistoff i PBS inneholdende 0,1% skummet melk og 0,1% BSA.
    Merk: For optimale resultater, må den endelige konsentrasjonen av det sekundære antistoffet i denne oppløsning bestemmes empirisk.
  9. Anvende et tilstrekkelig volum (ca. 30 pl) av den fortynnede, sekundært antistoff for å senke celleprøven. Inkuber celleprøve i 1 time ved 37 ° C. Rens cellene 2 ganger med PBS inneholdende 0,1% skummet melk og 0,1% BSA.
    Merk: PBS alene kan også anvendes for å vaske cellene.
  10. Påfør et tilstrekkelig volum av PBS som inneholder DAPI (50-100 ng / ml) for å dyppe den celleprøve. Inkuber celleprøve i 5 min ved RT. Rens cellene 1-2 ganger med PBS.
  11. Monter dekkglass inneholdende celleprøve på mikro lysbilde som beskrevet i 2.11.

4. Cell Fixation og Immunofluorescent Farging av N-terminal Flag-merket CENP-A Proteins (Metanol Fixation)

  1. Preparat
    1. Forbered iskald metanol.
    2. Forbered TBS (pH 7,4) inneholdende 4% geiteserum.
    3. Fremstille 1 ml TBS (pH 7,4) inneholdende DAPI (50-100 ng / ml).
    4. Forbered 100 ml monteringsmedium som beskrevet i 2.1.5.
  2. Fjerne kulturmediet ved aspirasjon ved 48-72 timer etter transfeksjon (se Protokoll 1) for cellefiksering. Skyll celler gang med TBS. Gjelder TBS til siden av kulturbrønnene for å unngå å forstyrre overflaten av cellene.
    Merk: Den optimale tidspunktet for celle fiksering må bestemmes empirisk.
  3. Fiksere cellene i is-kald metanol, og inkuberes cellene i 6 minutter ved -20 ° C. Skyll cellene to ganger med TBS for å fjerne tilstrekkelig gjenværende metanol.
  4. Ved hjelp av en hydrofob barriere penn (se liste over materialer / utstyr), tegne en blek grønn firkant eller sirkel for å lage en hydrofob barriere rundt hvert dekkglass prøve. Ikke berør eller kommer for nær cellene med hydrofobe barriere penn.
  5. Blokkere uspesifikke bindingssteder på cells ved å legge TBS som inneholder 4% geit serum. Inkuber i 10 minutter ved RT.
  6. Fortynne en anti-Flag-antistoff (1: 1000 fortynning) og enten et anti-A-B CENP antistoff (fortynningsforhold på 1: 200) eller ACA (1: 2000 fortynning forhold) som en centposisjonsmerke i TBS inneholdende 4% geiteserum .
    Merk: For optimale resultater, må den endelige konsentrasjonen av det primære antistoff i denne løsningen bestemmes empirisk.
  7. Anvende et tilstrekkelig volum (ca. 30 pl) av den fortynnede primært antistoff for å senke celleprøven. Inkuber celleprøve i 1 time ved 37 ° C. Rens cellene 5 ganger med blokkeringsbuffer i løpet av en periode på 30 min. For optimale resultater (dvs. den minimale tap av celler), må den optimale vaske tilstand bestemmes empirisk.
  8. Fortynn en fluorofor-konjugert sekundært antistoff (fortynningsforhold på 1: 100 til 1: 200) som er rettet mot hverandre primære antistoff i TBS inneholdende 4% geiteserum.
    Merk: For optimale resultater, final konsentrasjon av det sekundære antistoff i denne løsningen må bestemmes empirisk.
  9. Anvende et tilstrekkelig volum (ca. 30 pl) av den fortynnede, sekundært antistoff for å senke celleprøven. Inkuber celleprøve i 1 time ved 37 ° C. Rens cellene 3 ganger med blokkeringsbuffer.
  10. Påfør et tilstrekkelig volum av TBS som inneholder DAPI (50-100 ng / ml) for å dyppe den celleprøve. Inkuber celleprøve i 5 min ved RT. Skyll cellene 1-2 ganger med TBS.
  11. Monter dekkglasset som inneholder celleprøve på mikro lysbilde som beskrevet i 2.11.

5. Immunofluorescensanalyse Bilde Observasjon, Acquisition, kvantifisering, og analyse

  1. Observer celleprøve gjennom en motorisert fluorescens mikroskop utstyrt med en 63X og 100X olje nedsenking linse, en ekstern kompakt lyskilde, og en digital CCD kamera.
  2. Utfør bilde oppkjøpet og bearbeiding, herunder deconvolution, ved hjelp av SoftwareEn eller programvare B1 og B2 (se liste over materialer / utstyr). Vennligst se Supplemental Kode filer (5.2.1) for alle kommandoer som brukes i Software A. For alle kommandoer som brukes i programvare B1 og B2, se (5.2.2) i Supplemental Kode filer.
  3. Bruke en tidligere beskrevet metode 23-25 ​​for å kvantifisere signaler med cent-kinetochore proteiner (f.eks gjenværende signaler på CENP-A på cent) med følgende mindre modifikasjoner:
    1. Velg område av cent-kinetochore proteiner og den til bakgrunnen som følger:
      1. Mitotiske celle: (cent-kinetochore region) Velg område overlappende med kromosomer farget med DAPI; (bakgrunns region) og området utenfor kromosomer, men inne i identisk enkelt celle (dvs. cytosolic region).
      2. Interphase cell: (cent-kinetochore region) Velg område overlappende med kromatin farget med DAPI; (Bakgrunns region) og området utenfor kromatin men inne i identisk enkelt celle (<em> dvs. cytosolic region).
        Merk: Se også Opplysning Kode filer (5.2.1.4.3) eller (5.2.2.6.4) for området utvalg med Software A eller programvare B2, henholdsvis.
    2. Kvantifisere andelen av gjenværende signalene på sentromerer med Software A eller B. For denne oppgaven, må du bruke følgende formel:
      Resterende signaler om cent-kinetochore protein på cent-kinetochore
      Equation1
      hvor s er signalet lysstyrken i det valgte området, noe som bekreftes av ACA eller CENP-B farging, b er bakgrunnen signal lysstyrke; r prøven er referanse ACA eller CENP-B-signaler for siRNA (e) behandlede celler; og r ctrl er referanse ACA eller CENP-B-signaler for Luc siRNA-transfekterte celler.
      Merk: I denne analysen ble CENP-B-signaler brukt som referansesignaler for CUL4A og RBX1 som beskrevet i tidligere rapporter.
    3. Bruk en Excel-fil for denne beregningen etter å kopiere og lime rådata fra signalet kvantifisering programvaren som er beskrevet ovenfor. Se også Supplemental Kode Files: (5.2.1.4) og (5.2.2.6) for mer informasjon. Et eksempel på beregningen er vist i tabell 3.
  4. Analyser minst 20 celler for å eliminere variasjoner i fargingen og bilde-innhentings for hver måling nivå. Eventuelt bruke "gjennomsnittlig verdi" av gjenværende cent-kinetochore signaler for hvert analysert celle å sammenligne disse verdiene mellom ulike cent-kinetochore proteiner.

6. Western blot analyse av Total protein

  1. Resuspender cellene i denaturerende buffer A (20 mM Tris-HCl, pH 7,4; 50 mM NaCl, 0,5% Nonidet P-40, 0,5% deoksycholat, 0,5% SDS, 1 mM EDTA, og fullstendig EDTA-fri protease-inhibitor cocktail), 26 gjenstand suspensjonen til en sonikator og fryse-tine-prosess, og måleproteinkonsentrasjoner som følger:
    1. For sonikasjonsprosessen, tilsett 50 ul buffer A til cellene samlet fra to brønner i en 6-brønns polystyren plate ved 48-72 timer etter transfeksjon (se Protokoll 1). Operere en ultralyd utstyrt med disruptor horn og mikrotip (se liste over materialer / utstyr) for totalt 15 sek uregelmessig puls varighet (driftssyklus 50%) per én prøve.
    2. For fryse-tine-prosess, fryse celler med flytende nitrogen og tine-celler ved RT.
    3. Mål protein konsentrasjoner ved hjelp av en kommersiell protein assay reagens I eller II (se liste over materialer / utstyr).
      Note: Lysater blir fortynnet med forholdet 1:10 i måling av proteinkonsentrasjoner med enten reagens I eller II. På denne fortynningen, SDS er tilstede i buffer A viser liten eller ingen forstyrrelser i denne målingen.
  2. Bland lysat som inneholdt 20-30 mikrogram total protein med 2 × eller 4 × SDS-PAGE lasting buffer. 27 Kok prøvene for5 min og deretter laste dem på en 12,0% -15,0% denaturering SDS-polyakrylamid gel for elektroforese.
  3. Overfør proteiner separert ved SDS-PAGE på en PVDF-membran ved anvendelse av en Western blot-fremgangsmåten beskrevet tidligere. 17,24,27-31
    1. Blokkere ikke-spesifikke bindingsseter på membranen med 5% ikke-fettholdig melk i 1 x PBS, og deretter inkubere membranen med oppløsninger av fortynnet primære antistoffer i 1 time ved RT. Se liste over materialer / utstyr for detaljert informasjon (f.eks fortynning ratio) for hvert primært antistoff.
    2. Etter vasking av membranen 3-4 ganger (hver 3 til 5 minutters inkubasjon med risting) med PBS-T-buffer (1 x PBS og 0,1% Tween-20), inkubere membranen i en blanding av nær-infrarødt (IR) fluorescerende fargestoff-konjugerte sekundære antistoffer (fortynningsforhold på 1: 20 000), DyLight-konjugerte sekundære antistoffer (fortynningsforhold på 1: 20 000), og / eller pepperrot peroksidase (HRP) -konjugert sekundære antistoff (fortynnet i PBS-T; fortynningenepå forhold på 1: 10000) i 1 time ved RT. Se liste over materialer / utstyr for detaljert informasjon (f.eks fortynning ratio) for hver sekundært antistoff.
  4. Vask membranen 3 ganger, og deretter skanne membranen for å analysere proteiner med infrarød imaging system og / eller chemiluminescence imager for immunoblot deteksjon (se liste over materialer / utstyr).
    1. For å bruke infrarød imaging system, se (6.4.1) i Supplemental Kode filer.
    2. For å bruke chemiluminescence imager, se (6.4.2) i Supplemental Kode filer. Bruk en ultra-sensitive forsterket kjemiluminescerende (ECL) substrat (se liste over materialer / utstyr) for dette systemet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Immunofluorescensanalyse av endogent CENP-A støtter den hypotese at CUL4A-E3-ligase er nødvendig for lokalisering av CENP-A til sentromerer
Våre nyere studier viste at CUL4A-RBX1-COPS8 E3 ligase aktivitet er nødvendig for ubiquitylation av lysin 124 (K124) på CENP-A og lokalisering av CENP-A til sentromerer. 17 I utgangspunktet var det inter-cent kompleks (ICEN) isolert av anti-CENP-A: innfødt kromatin immunopresipitering, 32-34 og det har vært antatt at noen av de ICEN proteiner kan spille en rolle i å lokalisere CENP-A til sentromerer. Derfor ble siRNA knockdown eksperimenter utført for å screene for proteiner som har fravær av ekspresjon indusert delokalisering av CENP-A ved sentromerer 17 (data ikke vist): asynkront voksende HeLa-celler ble transfektert med Cullin 4A (CUL4A) siRNA eller RBX1 siRNA for tiden som kreves for optimal proteinmangel (48 hr for CUL4A og 72 timer for RBX1). Celler transfektert med CUL4A siRNA viste en signifikant delokalisering av CENP-A ved sentromerer (figur 1 A-C). Som vist i figur 2G, protein nivåene av CENP-A i totale cellelysater av CUL4A siRNA-transfekterte celler var lik CENP-A-nivåer i lysatene fra luciferase (Luc) siRNA-transfekterte celler under de samme dyrkningsbetingelser. Muligheten for off-target effekter av CUL4A siRNA ble ekskludert, fordi ektopisk uttrykk for CUL4A-Flag reddet reduksjon av CENP-A på sentromerer når CUL4A siRNA målrettet 3 'UTR (figur 2A-C). Protein nivåer av CENP-A i totalcellelysatene ble bekreftet til å være lik CENP-A-nivåer i lysater fra Luc siRNA-transfekterte celler under de samme dyrkningsbetingelser uavhengig av cellesyklusen trinnet (figurene 1B, 2G); Dermed blir muligheten for at CUL4A laget forårsaket CENP-A proteindegradering ble eliminert.

35 og inneholder 3 hovedelementer: en Cullin stillas, en ring finger protein (RBX1 eller RBX2), og en ubiquitin-ladet E2 enzym som er rekruttert av RBX1 eller RBX2, 36 A RING finger protein rekrutterer også et substrat adapter som plasserer underlag i nærhet til E2 enzymet å lette ubiquitin overføring. 36 RBX1 sirnas induserte en betydelig reduksjon av CENP-A på sentromerer (figur 1D-F) under forhold der proteinnivåer CENP-A totalt cellelysater av RBX1 siRNA-transfekterte celler lignet CENP-A nivåer i lysatene fra Luc siRNA-transfekterte celler (Figur 2G). Nedbrytning av CENP-A-proteinet, enten ved RBX1 uttømming, eller ved en kombinasjon av CUL4A og RBX1 utarming under de samme dyrkningsbetingelser som ikke ble observert (figur 2G). Muligheten for off-target virknings av RBX1 siRNA ble ekskludert, fordi ektopisk uttrykk for Flag-RBX1 reddet reduksjon av CENP-A på sentromerer når RBX1 siRNA målrettet 3 'UTR (figur 2D-F). Disse resultatene antydet at CUL4A-RBX1-E3-ligase er spesielt nødvendig for lokalisering av CENP-A til sentromerer.

Immunofluorescensanalyse av eksogene CENP-A - Flag proteiner indikerer at CENP-A K124 ubiquitylation er avgjørende for lokalisering av CENP-A til sentromerer
Tidligere vår immunoutfelling-massespektrometri-analyse viste at lysin 124 (K124) på CENP-A-flagg er ubiquitylated i HeLa-celler. 17 I den krystallstrukturen av CENP-A nucleosome, K124 ligger i det α3 helix, selv om området ikke innenfor CATD regionen. 17 i tillegg er K124 konservert blant pattedyr, fugler, øgler, planter, og en gruppe av sopp (f.eks budding gjær). 17 CENP-A lysin mutanter (figur 3A) ble konstruert og testet deres evne til å lokalisere til cent. Betydelig opphør av centromeric lokalisering av eksogene CENP-A K124R mutant med diffuse signaler i både mitotiske og interfase HeLa-celler ble observert (figur 3B, C). Cent lokalisering ble ikke signifikant påvirket verken av K9A mutasjoner (K9 tilsvarer Histone H3 K9 metylering) eller K77R mutasjoner (K77 er en unik lysin nettsted i CATD) (figur 3B, C).

Basert på disse resultatene blir to hypoteser foreslått når det gjelder in vivo-funksjonen av CENP-A ubiquitylation ved K124. Først rolle K124 ubiquitylation er for ubiquitin-mediert proteolyse å eliminere uttrykt og / eller mislocalized CENP-A til eukromatin. For det andre, er rollen til CENP-A ubiquitylation på K124 for lasting CENP-A på sentromerer. For å teste first mulighet, ble stabiliteten for CENP-A-Flag villtype og K124R mutant samt endogene CENP-A etter cycloheximide (CHX) behandling av CUL4A- eller RBX1-utarmet celler adressert. Disse data antydet at ubiquitylation av K124 er sannsynligvis ikke er involvert i ubiquitin-formidlet proteolyse for å eliminere overuttrykt og / eller mislocalized CENP-A (data ikke vist). 17. Videre ble det bekreftet at K124R mutasjon opphever antatte monoubiquitylation og diubiquitylation band, både i in vivo og in vitro ubiquitylation analyser (data ikke vist). 17 Sammen er disse data tyder på at CUL4A-RBX1 kompleks bidrar til «signale" ubiquitylation, som er nødvendig for CENP-A lokalisering ved sentromerer.

Immunofluorescensanalyse av eksogent flagg - CENP-A-proteinene indikerer at monoubiquitin fusjon er tilstrekkelig til å lasteCENP-A K124R på ​​sentromerer
Basert på resultatene ovenfor, ble det antatt at kovalent bundet monoubiquitin tjener som et signal for CENP-A lasting på sentromerer. For å teste denne hypotese, en N-terminal Flag-merket og C-terminale ubikvitin-kondenserte villtype CENP-A og en K124R mutant CENP-A ble konstruert (figur 4A). Den monoubiquitin mutant Ub (K48R), som mangler et større område for polyubiquitylation 37-39 ble også brukt for å hindre ubiquitin-kondensert CENP-A-proteinet fra potensiell polyubiquitylation. Ved å fange anti-Flag Immunofluorescent signaler ble centromeric lokalisering av proteiner kodet av disse konstruerer testet. Mens Flag-CENP-A (K124) i hovedsak avskaffet cent lokalisering av CENP-A (figur 4B og 4C, kolonne [6]), begge Flag-CENP-A (WT) og Flag-CENP-A (WT) -Ub ( WT) opprettholdt sin cent lokalisering (figur 4B og 4C, søyler [1] og [2]). DeFlag-CENP-A (K124R) -Ub (K48R) protein antagelig etterlignet monoubiquitylated CENP-A, da dette proteinet vesentlig restaurert lokalisering til sentromerer (figur 4C, sammenligne kolonner [5] og [6]) mer effektivt enn gjorde CENP-A (K124R) -Ub (WT) (figur 4C, sammenligne kolonner [4] - [6]). Disse dataene viste at monoubiquitylation er tilstrekkelig for rekruttering av CENP-A til sentromerer.

Figur 1
Figur 1. Immunofluorescensanalyse av endogent CENP-A støtter den hypotese at CUL4A-E3-ligase er nødvendig for lokalisering av CENP-A til sentromerer (figurene ble tilpasset fra Niikura et al. 17). (A) CUL4A siRNA indusert delokalisering av CENP-A på sentromerer. HeLa-celler ble transfektert med CUL4A eller luciferase (Luc) siRNA og inkubert i 48 timer (Tabell 1). Scale bar utgjør 10 um. (B) Western blot-analyse av HeLa hele cellelysater ved å bruke det samme dyrkingsbetingelser som i (A). Cellene ble høstet 48 timer etter transfeksjon med CUL4A siRNA eller Luc siRNA (tabell 1). GAPDH tjente som en kontroll lasting. (C) kvantifiserte endogene CENP-A-signaler ved sentromerer vist i (A). Normalisering av signaler som ble utført ved hjelp av Luc siRNA-transfekterte celler, og de midlere prosent (± SD) er vist. **** P <0,0001 vs Luc siRNA-transfekterte celler (t-test). (D) RBX1 siRNA indusert delokalisering av CENP-A fra sentromerer. HeLa-celler ble transfektert med Luc RBX1 eller siRNA (e) og inkubert i 72 timer (tabell 1). Scale bar utgjør 10 um. (E) Western blot-analyse av HeLa hele cellelysater ved å bruke det samme dyrkingsbetingelser som i (D). Cellene ble høstet 72 timer etter transfeksjon med RBX1 or Luc siRNA (e) (tabell 1). GAPDH tjente som en kontroll lasting. (F) kvantifiserte endogene CENP-A-signaler ved sentromerer vist i (D). Normalisering av signaler som ble utført ved hjelp av Luc siRNA-transfekterte celler, og de midlere prosent (± SD) er vist. **** P <0,0001 vs Luc siRNA-transfekterte celler (t-test). Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Opplysning informasjon relatert til figur 1 sentromerer (Tall ble tilpasset fra Niikura et al. 17). (A) Eksogene CUL4A-Flag reddet delokalisering av CENP-A når CUL4A siRNA målrettet 3 'UTR. HeLa Tet-Off cells ble fastsatt til 48 timer etter kotransfeksjon med siRNA (CUL4A # 2: 3 'UTR mål eller Luc, tabell 1) pluss plasmidkonstruksjonen (pTRM4-CUL4A-Flag eller vektor, tabell 2). 4-farge farging: farging for DAPI (blå); Flagg; endogen CENP-B (red); og endogene CENP-A (grønn), ble utført og Flag-positive celler ble sortert, men Flag bilder er utelatt for enkelhets skyld. Merk: CUL4A # 2 er det samme mål som den som er vist i Figur 1A-C. Scale bar utgjør 10 um. (B) Western blot-analyse av HeLa-Tet-Off helcellelysater å følge den samme kulturen tilstand som vist i (A). GAPDH tjente som en kontroll lasting. (C) CENP-A-signaler ved sentromerer vist i (A) ble kvantifisert ved mikroskopi etter sorteringen av cellene for å isolere dem som er bundet av et anti-Flag-antistoff. Normalisering av signaler som ble utført med celler transfektert med Luc siRNA pluss vektoren, og de midlere prosent (± SD) er vist.**** P <0,0001 vs celler transfektert med Luc siRNA pluss vektor (venstre kolonne, Student t-test). (D) Eksogent Flag-RBX1 reddet delokalisering av CENP-A på cent når RBX1 siRNA rettet 3'-UTR . HeLa-celler ble fiksert ved 72 timer etter kotransfeksjon med siRNA (RBX1 # 2: 3 'UTR mål eller Luc, tabell 1) pluss plasmidkonstruksjonen (pcDNA3-Flag-RBX1 eller vektor, tabell 2). 4-farge farging: farging for DAPI (blå); Flagg; endogen CENP-B (red); og endogene CENP-A (grønn), ble utført og Flag-positive celler ble sortert, men Flag bilder er utelatt for enkelhets skyld. Scale bar utgjør 10 um. (E) Western blot-analyse av HeLa hele cellelysater å følge den samme dyrkingsbetingelser som i (D). GAPDH tjente som en kontroll lasting. (F) CENP-A-signaler ved sentromerer vist i (D) ble kvantifisert ved mikroskopi etter sorteringen av cellene for å isolere dem som er bundet av en n anti-Flag antistoff. Normalisering av signaler som ble utført med celler transfektert med Luc siRNA pluss vektoren, og de midlere prosent (± SD) er vist. **** P <0,0001 vs celler transfektert med Luc siRNA pluss vektor (venstre kolonne, Student t-test). (G) Nedbrytning av CUL4A og RBX1 ikke påvirke nivåer av endogen CENP-A-proteinet. Nivåer av endogen CENP-A protein ble målt i HeLa hele cellelysater høstet 72 timer etter transfeksjon med CUL4A, RBX1, CUL4A pluss RBX1, eller Luc siRNA. Førti-åtte timer etter transfeksjon, ble cellene enten ubehandlet (Asyn) eller behandlet med paclitaxel (+ mva) for å indusere arrest i mitose, og de ble dyrket i 24 timer. GAPDH fungerte som en lasting kontroll. Klikk her for å se en større versjon av dette tallet.

32 / 53732fig3highres.jpg "width =" 700 "/>
Figur 3. Immunofluorescensanalyse av eksogene CENP-A-Flag proteiner indikerte at CENP-A K124 ubiquitylation kreves for CENP-A lokalisering ved sentromerer (figurene ble tilpasset fra Niikura et al. 17). (A) Overekspresjon av CENP-A- Flag konstruksjoner (WT og KR mutanter) ble bekreftet ved Western blot analyse av HeLa Tet-Off helcellelysater. Cellene ble høstet 48 timer etter transfeksjon med pTRM4-CENP-A-Flag WT, KR mutanter, eller pTRM4 vektor (tabell 2). Overekspresjon av CENP-A-Flag ble oppdaget av en anti-Flag antistoff. GAPDH fungerte som en lasting kontroll. Antatte CENP-A-Flag dimer (##) og CENP-A-Flag monomer (#) vises. Merk: SDS-resistente CENP-A dimerer har vært rapportert tidligere 40,41 (B) CENP-A K124R mutant viste diffust delokalisering fra sentromerer.. Signaler fra DAPI (blå), Flag (grønn), og endogen CENP-B (rød, en cent sted kontroll) er vist. Merk: I motsetning til endogen CENP-A i celler transfektert med CUL4A eller RBX1 siRNA, diffuse signaler dukket opp i celler som overuttrykt eksogene CENP-A K124R-Flag som en fenotype av manglende evne til å være rettet mot sentromerer, antagelig fordi dens uttrykk nivå er ca 10 - til 25-ganger høyere enn den for endogen CENP-A (data ikke vist) 17 Skala bar utgjør 10 um (C) Histogrammer av lokaliseringsmønster som er vist i (b)... Mer enn 50 pro / prometafase og metafase celler og mer enn 200 interfase celler per eksperiment ble telt (n ≥ 3 forsøk). De gjennomsnittlige prosentandeler (± SD) er vist. "Andre (Non-cent)" indikerer stort sett skadede celler, døde celler eller celler med nukleolært lokalisering (bare i interfase), antagelig på grunn av transfeksjon eller andre behandlinger. *** P <0,001 vs CENP-A WT-Flag (t-test).

Figur 4
Figur 4. Immunofluorescensanalyse av eksogene Flag-CENP-A proteiner indikerte at CENP-A monoubiquitin fusjon reddet delokalisering av CENP-A K124R mutant fra sentromerer (Tall ble tilpasset fra Niikura et al. 17). (A) Skjematiske tegninger av hver konstruksjon anvendt i denne studien (se også tabell 2). Den K124R-mutasjonen sete på CENP-A (rød) og den K48R mutasjonssetet på monoubiquitin (blå) er vist. (1) WT: Flagg-CENP-A WT, (2) WT-Ub (WT): Flagg-CENP-A WT-Ub (WT), (3) WT-Ub (K48R): Flagg-CENP-A WT -Ub (K48R), (4) K124R-Ub (WT): Flag-CENP-A K124R-Ub (WT), (5) K124R-Ub (K48R): Flag-CENP-A K124R-Ub (K48R), (6) K124R: Flagg-CENP-A K124R (B) Eksogent CENP-A monoubiquitin fusjon reddet delokalisering av den CENP-A K124R mutant fra sentromerer.. DAPI (blå), Flag (grønn), og endogen CENP-B (rød, en cent sted kontroll) er vist. Scale bar utgjør 10 um. (C) Histogrammer av lokaliseringsmønster som er vist i (C). Mer enn 50 pro / prometafase og metafase celler og mer enn 200 interfase celler per eksperiment ble telt (n ≥ 3 forsøk). De gjennomsnittlige prosentandeler (± SD) er vist. **** P <0,0001 og *** p <0,001 vs ikke-smeltet Flag-CENP-A K124R (kolonne [6]) (t-test). Klikk her for å se en større versjon av dette tallet.

siRNA mål Indikasjon i denne studien måltypen siRNA database nummer Frem-sekvens (er) Kilde / Reference
Luciferase (GL3) - 1 mål RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir et al., (2001)
CENP-A CA-UTR siRNA basseng (2 mål blanding) RKK375 / 5 'UTR t1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura et al., (2015)
RKK383 / 3 'UTR t1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura et al., (2015)
CUL4A #1 1 mål CRKK178 / RKK309 / t1 AGCGAUCGUAAUCAAUCCUGA Niikura et al., (2015)
# 2 (3'UTR) 1 mål CRKK181 / RKK331 / t4 AUGCGGGUUUGAAAUAUGACA Niikura et al., (2015)
RBX1 / ROC1 #1 siRNA basseng (4 mål blanding) CRKK198 / RKK411 / t1 GAAGCGCUUUGAAGUGAAA Niikura et al., (2015)
CRKK198 / RKK413 / t2 GCAUAGAAUGUCAAGCUAA Niikura et al., (2015)
CRKK198 / RKK415 / t3 GCAAGAAGCGCUUUGAAGU Niikura et al., (2015)
CRKK198 / RKK417 / t4 CAACAGAGAGUGGGAAUUC Niikura et al., (2015)
# 2 (3 'UTR) 1 mål CRKK206 / RKK425 / t8 UUCCCUGCUGUUACCUAAUUA Niikura et al., (2015)

Tabell 1. siRNA sekvenser brukt i denne studien.

B nummer Relevant karakteristisk (s) Kilde / Reference
B288 pTRM4 Niikura et al., (2006)
B2067 pTRM4-menneske CENP-A-Flag Niikura et al., (2015)
B2281 pTRM4-menneske CENP-A K9A-Flag Niikura et al., (2015)
B2387 pTRM4-menneske CENP-A K77R-Flag Niikura et al., (2015)
B2388 pTRM4-Human CENP-A K124R-Flag Niikura et al., (2015)
B2512 pTRM4-Flag-menneske CENP-A Niikura et al., (2015)
B2579 pTRM4-Flag-menneske CENP-A K124R Niikura et al., (2015)
B2513 pTRM4-Flag-menneske CENP-A-Ub (WT) Niikura et al., (2015)
B2559 pTRM4-Flag-menneske CENP-A K124R-Ub (WT) Niikura et al., (2015)
B2515 pTRM4-Flag-menneske CENP-A-Ub (K48R) Niikura et al., (2015)
B2560 pTRM4-Flag-menneske CENP-A K124R-Ub (K48R) Niikura et al., (2015)
B2759 pTRM4-menneske CUL4A-Flag Niikura et al., (2015)
B2624 pcDNA3-Flag-menneske RBX1 Niikuraet al., (2015)
B1491 pcDNA3-Flag Niikura et al., (2015)

Tabell 2. Plasmidvektorer brukt i denne studien.

R (anti-CENP-B) prøve b (anti-A-B CENP) R prøve (trekkes) Ratio (S Prøven: R sample) Korrigert Ratio (S Prøven: R sample)
520 514 6 -4,167 0.000
535 445 90 -1,033 0.000
515 431 84 0,274 0,274
562 483 79 0,506 0,506
902 562 340 0,509 0,509
1203 703 500 -0,560 0.000
1014 589 425 -0,819 0.000
768 510 258 -1,345 0.000
555 458 97 -1,845 0.000
781 576 205 -1,146 0.000
556 436 120 0,758 0,758
534 493 41 -1,634 0.000
702 543 159 0,667 0,667
482 429 53 -1,000 0.000 654 531 123 0,740 0,740
1190 607 583 0,384 0,384
552 454 98 0,969 0,969
489 413 76 0,539 0,539
511 452 59 -3,186 0.000
485 475 10 -2,700 0.000
481 441 40 -1,475 0.000
Sum 5,347
Gjennomsnitt 0,255
R (anti-CENP-B) ctrl b (anti-A-B CENP) Ratio (S ctrl: R ctrl) Korrigert Ratio (S ctrl: R ctrl)
543 483 60 3,017 3,017
526 466 60 2,667 2,667
532 460 72 1,792 1,792
507 457 50 3,520 3,520
491 458 33 4,273 4,273
545 464 81 2.160 2.160
518 484 34 3,559 3,559
461 404 57 2,404 2,404
487 447 40 3.550 3.550
534 477 57 3,965 3,965
528 456 72 3,097 3,097
707 601 106 1,868 1,868
615 528 87 2,828 2,828
660 481 179 1.620 1.620
565 476 89 1,607 1,607
527 455 72 3,583 3,583
560 474 86 2,930 2,930
510 451 59 4,017 4,017
729 586 143 2,678 2,678
634 576 58 3,655 3,655
507 476 31 3,935 3,935
Sum 62,725
Gjennomsnitt 2,987
Gjenværende CENP-A signaler på cent (%) 8.5

. Tabell 3. Et eksempel på beregning av gjenværende CENP-A-signaler på cent (%) Et eksempel på Pro / prometafase i figur 2F vises: Prøven er RBX1 # 2 (3'UTR) + Vec (midtkolonnen i figur 2F ) og kontroll er Luc + Vec (venstre kolonne i figur 2F). Som et resultat, gjenværende CENP-A-signaler vedcent (%) = (0,255 / 2,987) x 100 = 8,5%, tilveiebrakt (Or [5,347 / 62,725] x 100 = 8,5% med den samme totale cellenummer [dvs. 21 celler] analysert mellom to prøver). Merk at hvis b verdien er mer enn S-verdi (dvs. hvis trekkes verdien er negativ), korrigert ratio verdien er satt til 0,00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I de senere år har mange studier har utviklet ulike kvantitative mikroskopi-analyser for fikserte celler. 42 Progress in cent-kinetochore biologi krever ofte en forståelse av den centspesifikk eller kinetochore-spesifikk funksjon av proteiner som subcellulære romlig-temporale regulering reflekterer de endrede funksjoner av disse proteinene i løpet av cellesyklusen. Derfor, her vi utviklet metoder for IIF farging og en kvantitativ IIF-analyse for spesifikt å analysere de relative nivåer av endogene og eksogene CENP-A-proteiner, noe som kan være anvendelig på en annen måte behandlede prøver. Foreløpig har vi oppnådd vellykket IIF farging av endogen CENP-I, CENP-H, KNL1, Hec1, og Ska1 bruker protokoll 2 i denne studien (se Niikura et al 24 og data ikke vist,. Liste over Materialer / utstyr for informasjon av antistoffer) . I fremtiden kan man bruke samme metode for å kvantifisere graden av forskjellige cent-kinetochore proteiner (begge endogenous og Flag-merket eksogene proteiner) velge de spesifikke antistoffer, men våre IIF metoder dekker ikke påvisning av disse proteinene i levende celler eller i en bestemt enkelt celle i løpet av hele cellesyklus. Fordi disse fremgangsmåter krever at cellene å være fast og behandlet på separate dekkglass, innførte vi referansesignaler (f.eks ACA eller CENP-B) for det formål å normalisering for å ganske sammenligne signaler mellom forskjellige prøver og øke nøyaktigheten av analysen. Fordi ACA involvere endogene og / eller eksogene CENP-A-signaler, CENP-B som et referansesignal for det formål å normaliseringen vil være mer passende for sammenligning enn det som ville ACA når det gjelder nøyaktigheten av den kvantitative analysen av CENP-A-signaler. Den amino-terminale region av CENP-B binder seg til den 17 bp-motiv av den CENP-B-boksen sekvens i alphoid DNA, og den karboksy-terminale region av CENP-B danner homodimerer. 43,44 CENP-B ikke colocalize fullstendig med CENP-A og / eller andre centrOmere-kinetochore proteiner, derimot, er nært knyttet til dem. 45 Mens immunofluorescens med anti-CENP-C-antistoffer gir vanligvis to diskrete flekker, farging med anti-CENP-B vises ofte som en singel lyse bar koble begge søster sentromerer. 46 Men i vår makro-skala mikroskopisk observasjon, noen CENP-B-signalene tilsynelatende overlapper med CENP-A-signaler, spesielt ved tidligere mitotiske faser (prophase-prometafase enn sen meta), også delvis avhengig av observasjonsvinkel og typen av bindemiddel som brukes (data ikke vist). I motsetning til dette, i en kvantitativ IIF-analyse av CENP-A-signaler, protein lokalisering av referansesignaler bør ikke bli påvirket av uttømming og / eller dysfunksjon av CENP-A for rettferdig analyse, selv om lokalisering av de fleste av de cent-kinetochore proteiner er avhengig CENP-A lokalisering ved sentromerer. 47,48 CENP-A-uavhengig kinetochore sammenstillingen er etablert ved å erstatte DNA-bindende regioner av CENPC og CENP-T med alternative kromosom målretting domener som rekrutterer disse proteinene til ektopisk loci. 49,50 i tillegg senere arbeid indikerte at de indre kinetochore komponenter CENP-C og CENP-T handle parallelt å rekruttere KMN nettverket kinetochores. 51-54 Videre Nishino et al. antydet at CENP-TWSX komplekse former en unik nucleosome-lignende struktur for å generere kontakter med DNA, utvide 'histone koden "utover kanoniske nucleosome proteiner. 55 Fordi cent lokalisering av CENP- C er avhengig av cent lokalisering av CENP-A, kunne 47,48 CENP-TWSX eller spesielt CENP-T være et annet protein som kandidat (er) for å tilveiebringe referansesignaler i en kvantitativ IIF-analyse av CENP-A. Imidlertid bør den kandidat for referansesignal nøye prøves før analyse for å bestemme hvorvidt lokalisering ved sentromerer påvirkes av uttømming og / eller dysfunksjon av CENP-A. analogt betraktningbør tas for kvantitative IIF-analyser av andre cent-kinetochore proteiner og protein lokalisering av referansesignaler bør ikke bli påvirket av uttømming og / eller dysfunksjon av målproteinet for rettferdig analyse. I den tidligere studie benyttet vi ACA som et referansesignal for kvantitativ IIF-analyse andre sentral-ytre kinetochore proteiner. 24 ACA kan være en mer passende alternativ enn enkelt CENP-B som en posisjonskontroll, så vel som et referansesignal, hvis ACA signalene påvirkes ikke av uttømming og / eller dysfunksjon av målproteinet men colocalization av målproteinet med CENP-B er dårlig som nevnt ovenfor.

Bodor et al. rapporterte at centromeric CENP-A-nivåer er regulert av masse virkning, dvs. mengden av centromeric CENP-A varierer i direkte forhold til det cellulære innholdet. 56 De viste også at forbigående induksjon av CENP-A uttrykk fører til en rask økning i centromeric CENP-A nivå. Motsatt, vi observerte en stor cellepopulasjon med cent-lokalisert, Flag-tagged CENP-A WT etter kotransfeksjon av pTRM4 ekspresjonsvektoren med CA-UTR sirnas (en blanding av 5 'og 3' UTR siRNA; Tabell 1) (data ikke vist); denne populasjonen var større enn det som sees etter transfeksjon med bare den pTRM4 ekspresjonsvektor. Nivået av eksogent Flag-tagged CENP-A-protein hvis ekspresjon ble drevet av pTRM4, var ca. 1,0 til 1,4 størrelsesordener (10- til 25 ganger) høyere enn for endogen CENP-A (data ikke vist). Det er spekulert i at uttrykk for eksogene CENP-A WT over en bestemt terskel kan påvirke sin rette centromeric lokalisering.

I de foreliggende protokoller, er fiksering et kritisk trinn for å opprettholde cellestrukturen og miljø som proksimale situasjon som mulig til den opprinnelige tilstand. Når cellene er fiksert, må man fortsette med fargingen protokollen for å unngå tap av proteinet av intehvile eller resten av cellen. Imidlertid ødelegger fiksering antigene seter fra tid til annen, og forskjellige antistoff-antigen kombinasjoner fungerer dårlig med en fikseringsmiddel, men svært godt med hverandre. 21 På grunn av denne variasjon, valg av bindemiddel avhenger i stor grad av protein (er) av interesse. Den tidslengden for fiksering kan påvirke påvisning av protein (er) ved å immunfarging, og kortere fiksering er vanligvis bedre å beholde antigenisitet. 57 Derfor, når det fastslås fargingsprosedyrer for et nytt mål på andre cent-kinetochore proteiner, spesielt av usikker lokalisering, eller når du arbeider med en ny antistoff, bør man teste flere metoder for fiksering og buffere for å finne den optimale tilstand. I de foreliggende protokoller, ble to klasser av populære fiksativ utvalgte: aldehyd-fiksativ (protokoll 2) og organiske løsningsmidler (Protokoller 3 og 4). Renheten av bindemiddel er også svært viktig. I protokoll 4, er 4% geit serum brukes especially å blokkere IgG-reseptorer på celleoverflaten for å redusere ikke-spesifikk bakgrunn. 57 Generelt er serum for å blokkere IgG-reseptorer bør være av en art som ikke er relatert til det primære antistoff, og fortrinnsvis fra samme art som det sekundære antistoff. 57

I hver av de foreliggende protokoller, er valget av det primære antistoffet mest kritiske trinnet i å oppnå vellykket immunofarging. Antistoffet med størst spesifisitet, renhet, affinitet, aviditet og er ønskelig. En god utgangskonsentrasjon for monoklonale antistoffer er vanligvis 1-5 ug / ml. Typiske fortynninger av lager fremstilling av polyklonale antistoffer i området fra 1:20 til 1:. 500 57 Man trenger å bestemme empirisk passende konsentrasjon av det primære antistoff og fortynningsmidlet for hver prøve. Prøvene bør forsiktig rystet, men ikke tørket under inkubasjon for homogen farging. Inngående vasking mellom inkubering av primært antistoff og sekundær enntibody kan være nødvendig for å unngå kryssreaksjon med immunglobuliner fra andre arter. Imidlertid må den optimale vaske tilstand bestemmes empirisk for å unngå tap av celler, særlig mitotiske celler som runder av og løsner når ristet (dvs. mitotisk shake-off). 58 For å lykkes, må et sekundært antistoff bli valgt til å binde til det primære antistoff med høy affinitet. For eksempel, for å unngå ikke-spesifikk binding av Fc-delen av det sekundære antistoff til IgG-Fc-reseptorer, Fb (ab ') 2-fragmenter kan anvendes i stedet for hele antistoffet. 57 For mange sekundære antistoffer, kan inkubasjonstid bli minimalisert til 30 min ved RT for å redusere ikke-spesifikk bakgrunn.

I tillegg til protokoll 5, kunne laser-scanning konfokalmikroskopi være fordelaktig ved detektering og analysering av lokalisering og funksjonen av cent-kinetochore proteiner med de fluoriserende egenskaper. Som vist i listen over materialer / utstyr;nt, Alexa Fluor 488 og Alexa Fluor 594 er trolig den mest brukte fluorescerende fargestoffer i dagens protokoller. For å detektere to og / eller flere forskjellige cent-kinetochore proteiner i prøven, må man sørge for at antistoffene brukes til å gjenkjenne en protein ikke hindrer påvisning av det andre proteinet. 57 I de foreliggende protokoller er to primære antistoffer blandes og påføres samtidig. Imidlertid bør man optimalisere immunofarging betingelsene for hvert protein separat før påføring av de primære eller sekundære antistoffer sammen: dersom de to proteinene er i umiddelbar nærhet som i tilfellet med to cent-kinetochore bestanddeler, kan man primært antistoff strukturelt forhindre bindingen av andre primære antistoff. En annen bekymring for multippel signaldeteksjon er problemet med spektral overlapping: vanskeligheten i å hindre signal fra en farvestoff "lekkasje" i den spektrale kanal til en annen. Dette problemet blir vanskeligere for konvensjonenal støyfilter sett å løse som antall fargestoffer øker eller hvis prøven inneholder overenhanced signaler (f.eks ACA eller anti-Flag signaler i denne studien), inkludert forstyrrelser av autofluorescence. Feilsøking av autofluorescence har blitt gjennomført i andre studier. 57,59,60 I denne studien, optimalisere fluorescerende filter sett med single-label kontroller i hver kanal er tilstrekkelig i de fleste tilfeller for å unngå disse problemene (se nedenfor).

I hver av de foreliggende protokoller forsvarlig kontroll avgjørende. Hver ny primær antistoff bør være preget før farging begynner. Spesifisiteten av antistoffet må bekreftet ved Western blot-analyse, hvis det er aktuelt. I tillegg bør bekreftelse på at fargingen ikke er forårsaket av ikke-spesifikk binding til celleoverflaten oppnås, og den optimale arbeids konsentrasjonen av en spesiell primært antistoff bør bestemmes ved hjelp av seriefortynninger(Dvs, en bindingskurve utvikles). En negativ kontroll (dvs. fravær av det primære antistoff fra fargeprosessen) bør være inkludert. Et annet alternativ for negativ kontroll er substitusjon av normal IgG fra samme art for det primære antistoff. For påvisning av flere etiketter, må man forberede kontroller uten sekundære antistoffer (bakgrunnen kontroll) samt single-label kontroller for å unngå spektrale overlapp gjenstander (dvs. blø-through, crossover, crosstalk, eller dye "lekker", som beskrevet ovenfor ). Man kan kvantifisere brøkdel av "lekker" ved å sammenligne signaler gjennom "feil" filtre med riktig signal ved hjelp av disse proporsjoner for å fjerne beregnings alle "lekker", og å beregne den virkelige fordeling og / eller ko-lokalisering av fluorescerende markør. 60 bakgrunnen kontroll skal undersøkes uavhengig av hverandre med hver kanal for å angi grensene for signalforsterkning og forskjøvet for å være adapted for den endelige bildebehandling. Alle kanaler som skal brukes for å oppnå et bilde av en fler etikett prøven må utsettes for uavhengig bakgrunnskorreksjon, fordi nivået av autofluorescens i hver kanal varierer betydelig. De "lekker" kontroller som beskrevet ovenfor, er nødvendig for å bestemme mengden av signalforsterkning mulig i hver kanal uten å detektere "lekker" inn i tilstøtende kanaler. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne hevder at de ikke har noen konkurrerende økonomiske interesser.

Acknowledgments

Dette arbeidet ble støttet av NIH stipend GM68418.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Immunofluorescensanalyse av Endogene og eksogene cent-kinetochore Proteiner
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter