Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

متعددة اكسون تخطي عن طريق أليغنوكليوتيد] كوكتيل العقاقير في ضمور العضلات المرتبطة X الناب

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

اكسون تخطي حاليا خيارا علاجيا الواعدة لضمور العضلات دوشين (DMD). على توسيع إمكانية تطبيق للمرضى DMD ولتحسين الاستقرار / وظيفة من الناتج البروتينات الدستروفين اقتطاع، تم وضع متعددة اكسون تخطي النهج باستخدام أليغنوكليوتيد] العقاقير كوكتيل وأثبتنا الإنقاذ الدستروفين النظامية في نموذج الكلب.

Abstract

ضمور العضلات دوشين (DMD) هو واحد من الأمراض الوراثية القاتلة الأكثر شيوعا في جميع أنحاء العالم، التي تسببها طفرات في جين الدستروفين (DMD). اكسون تخطي يستخدم الحمض النووي القصير / مثل RNA الجزيئات تسمى أليغنوكليوتيد] العقاقير (AONs) أن استعادة إطار القراءة وإنتاج البروتينات أقصر ولكن وظيفية. ومع ذلك، اكسون العلاج تخطي يواجه عقبتين رئيسيتين: محدودة التطبيق (تصل إلى 13٪ فقط من المرضى يمكن معالجتها بعقار AON واحدة)، وظيفة غير واثقين من البروتينات مبتورة. وتم تناول هذه القضايا مع نهج كوكتيل AON. بينما حوالي 70٪ من المرضى DMD يمكن علاجها عن طريق تخطي اكسون واحد (كل الإكسونات معا)، قد يكون بمقدورها معالجة أكثر من 90٪ من المرضى DMD إذا اكسون متعددة تخطي باستخدام العقاقير العقاقير كوكتيل يمكن أن تتحقق. تم استخدام الكلاب X المرتبطة ضمور العضلات (CXMD) نموذج الكلب، الذي النمط الظاهري هو أكثر مماثلة للمرضى DMD البشري، لاختبار effic النظاميةACY وسلامة تخطي متعددة اكسون الإكسونات 6 و 8. نموذج الكلب وCXMD المرافئ طفرة الموقع لصق في إنترون 6، مما يؤدي إلى عدم وجود اكسون 7 في مرنا الدستروفين. لاستعادة إطار القراءة في CXMD يتطلب تخطي متعددة اكسون الإكسونات 6 و 8؛ وبالتالي، CXMD هو نموذج حيواني متوسطة الحجم جيدة لاختبار فعالية وسلامة تخطي متعددة اكسون. في الدراسة الحالية، وقد تم تصميم مزيج من morpholinos العقاقير التي تستهدف اكسون 6 و 8 اكسون واستعادة تعبير الدستروفين في العضلات والهيكل العظمي في جميع أجزاء الجسم. يتم عرض طرق ترنسفكأيشن / حقن oligos كوكتيل وتقييم فعالية وسلامة تخطي متعددة اكسون في نموذج الكلب CXMD.

Introduction

ضمور العضلات دوشين (DMD) هو أحد أمراض العضلات المتنحية المرتبطة X يتميز بضعف العضلات التدريجي، وصف لأول مرة من قبل الدكتور غيوم-بنيامين أماند دوشين (بولوني) 1. DMD هو مرض وراثي شائع يؤثر على حوالي 1 في 3500 الفتيان في جميع أنحاء العالم، مع ما يقرب من 20،000 الأطفال المتضررين يولدون كل عام 2،3. تأخر النمو الحركي وتعتبر اضطرابات المشية في مرحلة الطفولة المبكرة تليها الاعتماد على كرسي متحرك في حوالي سن المراهقة المبكرة. تحدث الوفاة عادة تتراوح أعمارهم بين 20 و 30 بسبب الجهاز التنفسي أو القلب الفشل 5-8. لا يوجد حاليا أي علاج لDMD. العلاج مع السكرية يمكن أن يبطئ تطور ضمور العضلات إلى حد ما ولكن يترافق مع آثار جانبية كبيرة، بما في ذلك السمنة وداء السكري 2،7،8. DMD ينجم عن طفرات في جين الدستروفين (DMD)، مما يؤدي إلى فقدان protei الدستروفين وظيفيةن. DMD هو جين كبير للغاية مع أكثر من 2 مليون زوج قاعدة و 79 الإكسونات 9،10. الحذف، هراء، والازدواجية الطفرات المؤدية إلى خارج الإطار الطفرات هي السبب الأكثر شيوعا من النمط الظاهري نائب العضو المنتدب. ويطلق على 55 "النقاط الساخنة طفرة" لأن معظم المرضى الذين لديهم طفرات الحذف داخل هذه الأجزاء من الجينات، مما يؤدي إلى الدستروفين غير وظيفية في المرضى الذين يعانون DMD 3،9،11-16 - المناطق الإكسونات 3-9 والإكسونات 45. وظائف الدستروفين داخل مجمع بروتين سكري الدستروفين (نادي دبي للجواهر)، التي لها دور كبير في استقرار غشاء العضلات. وN- وC-ترميني هي المجالات الأكثر أهمية بالنسبة للوظيفة، في حين يلعب المجال قضيب المركزي 3،9،17 دور أقل أهمية. مراعاة النمط الظاهري معتدل مصحوب بيكر ضمور العضلات (BMD)، والذي ينتج في الغالب من الطفرات في الإطار داخل الجين DMD، ألهم تطبيق اكسون تخطي لعلاج DMD. المرضى BMD لديها تقصير، ولكن functionaل، بروتين الدستروفين أن يحافظ على حد سواء ترميني 3،6،18. اكسون الطفر، من الناحية النظرية، يمكن استعادة إطار القراءة، مما أدى إلى البروتينات الدستروفين الوظيفية تقصير، ولكن، مماثلة لتلك التي ظهرت في BMD 3،19.

وقد تم اختبار أنواع متعددة من أليغنوكليوتيد] العقاقير (AONs) في التجارب السريرية، بما في ذلك phosphorothioates ميثليته 2'O (2'OMePS) والأوليغومرات phosphorodiamidate morpholino (أبطأ قليلا). تخطي الإكسونات 51 و 53 استخدام هذه AONs وقد تم فحص وعلى الرغم من النتائج واعدة، واكسون واحد تخطي تطبيق محدودة، كما هو طفرة محددة 3، 19، 20،21، 22-26. تبقى الأسئلة أيضا بشأن استقرار ينتج عن ذلك من البروتينات الدستروفين تقصير ينتج من واحد اكسون تخطي 22،23. بالإضافة إلى ذلك، يحتاج بعض المرضى أكثر من اكسون واحد ليتم تخطي من أجل استعادة إطار القراءة 3. في حين أن أكثر صعوبة من الناحية الفنية، متعدد اكسون الطفر هو أسلوب واحديمكن أن تعالج هذه المشاكل 3،19. وقد سبق أن أثبتت متعددة اكسون الطفر في الكلب التصنع وخطوط الخلايا البشرية في المختبر. بالإضافة إلى ذلك، تم استخدام mdx52 الماوس والكلاب العاشر مرتبطة ضمور العضلات (CXMD) نماذج الكلب لفي الدراسات المجراة 22، 24-27. الكلاب العاشر مرتبطة ضمور العضلات اليابان (CXMD J) استخدمت البيجل هنا، كإطار قراءة CXMD J يمكن الحفاظ عليه من خلال تخطي متعددة اكسون الإكسونات 6 و 8، أو الإكسونات إضافية (على سبيل المثال، الإكسونات 3-9) (الشكل 1). يشارك CXMD أساس بيغل-نفس النمط طفرة كنموذج الذهبي المسترد ضمور العضلات (GRMD)، ولكن البيجل هي أصغر حجما وأرخص للحفاظ نظرا لحجم أجسامهم، مما يوفر نموذجا مفيدا للDMD 28،29. الكلاب CXMD تحاكي بشكل وثيق النمط الظاهري نائب العضو المنتدب للالبشري من النماذج الحيوانية الصغيرة، مثل القوارض، وهي أكثر موثوقية لتقييم السمية 3،22،30،31 (الشكل 2). الكلاب CXMD عرض التدريجي تسوس العضلات، واضطرابات المشية، ومشاكل في القلب والجهاز التنفسي مماثلة لتلك التي ظهرت في إعلان الدوحة الوزاري. مقارنة مع تخطي-اكسون واحد، متعدد اكسون تخطي ينطبق على نسبة أكبر بكثير من المرضى. ومن بين أنواع الطفرات الثلاث الأكثر شيوعا (الحذف، هراء، والتكرار)، 80 - يمكن علاج 98٪ من المرضى من خلال متعددة اكسون تخطي 14،32،33، في حين أن 45٪ من جميع المرضى DMD يمكن أن تستفيد من الإكسونات تخطي تحديدا 45 - 55 3،19،22،34.

مع تطور morpholinos تعديل، تحسنت كفاءة من الكوكتيلات AON في تسهيل تخطي اكسون. أرجينين الغنية بمعدل أبطأ قليلا الببتيد مترافق-اختراق الخلية (PPMOs)، والجسم الحي morpholinos (vPMOs) هي كيمياء AON التي حسنت بشكل ملحوظ القدرة على اختراق الخلية والاستقرار 3،35-38. لا يزال هناك قلق حول طويل الأجل AON سمية. ومع ذلك، تقدما كبيراتم صنعه. التعديلات التي أدخلت على المواد الكيميائية morpholinos يقلل إلى حد كبير بعيدا عن الهدف الآثار ووأفادت الدراسات ما قبل السريرية ليس لها آثار سامة كبيرة 3،22،39،40. ويتمثل أحد التحديات المتبقية لتخطي متعددة اكسون هو الشرط الحالي لكل AON واحد ليتم اختبار السمية وحده، باعتباره دواء واحد، بدلا من معا في كوكتيل 3،19،22،41،42. في دراسات DMD تشمل كلا من واحد ومتعدد اكسون تخطي تستهدف قلب، كان هناك تحسن طفيف في أنسجة القلب التصنع. ويعتقد أن فعالية morpholinos في قلب لتكون منخفضة بسبب ضعف القدرة على اختراق الخلية. وتحسنت PPMOs الببتيد مترافق قدرة AONs على اختراق خلايا القلب، وزيادة كمية البروتين الدستروفين وظيفية انقاذ في قلب 3،19،38.

هنا، وتناقش نهجنا كوكتيل AON مطولا، بما في ذلك تصميم تسلسل AON باستخدام برنامج ESEfinder 43. Protocويرد أيضا عملية شريان الحياة للتجارب الكلب مع تخطي متعددة اكسون. واستخدمت CXMD J البيجل لالإكسونات 6 و 8 تجارب تخطي. متعددة اكسون تخطي في نموذج الكلب CXMD يظهر نتائج واعدة، ولكن تبقى التحديات التي يجب التغلب عليها قبل أن تكون قابلة للتطبيق سريريا.

Protocol

جميع البروتوكولات المذكورة أدناه وفقا للمبادئ التوجيهية رعاية الحيوان المنصوص عليها من قبل المركز الوطني لعلم الأعصاب والطب النفسي (NCNP) في اليابان. تمت الموافقة على جميع التجارب من قبل لجنة رعاية واستخدام الحيوان المؤسسي للNCNP.

1. تصميم العقاقير Oligos

  1. استخدام ESE الإنقاذ وبرامج ESEfinder للكشف عن مواقع جنوب شرقي 44، 45-47.
  2. تصميم 25 زوج قاعدة (بي بي) متواليات التي هي العقاقير لالإكسونات التي سيتم المستهدفة. الإكسونات الهدف 6 و 8 في نموذج الكلب (الشكل 1).
    1. استخدام 25-30 تسلسل بي بي عن أبطأ قليلا (الجدول 1) أو 25 نقطة ل2'OMePS. لتصميم 25 متواليات بي بي، تحديد تسلسل التي تقع ضمن المنطقة المستهدفة. النظر في هيكل الثانوي، وتجنب heterodimers، زخارف محسن اكسون الربط، ومحتوى GC لخلق تسلسل مستقرة 43. يجب AONs هدف واحد على الأقل من مواقع ESE كما حددها البرمج المذكور أعلاهtware.
    2. اختر AONs مع محتوى GC التي هي أقل من 65٪، مع أقل من 4 "في G، ولا تحتوي على تسلسل متتالية مكملة النفس. استخدام NCBI البرمجيات انفجار التنبؤ المواقع الصلب بعيدا عن الهدف 22،48،49.
  3. حدد AON العمود الفقري الكيمياء المناسب. للتجارب في المختبر استخدام أليغنوكليوتيد 2'O-الميثيل (2'OMePS) أو morpholinos. لإجراء التجارب في الجسم الحي، استخدم 2'OMePS، morpholinos أو vPMOs. 3،19،48،50

2. في تجارب المختبر (exons متماثلة 6 و 8 الطفر في CXMD النموذجي)

  1. 2'OMePS ترنسفكأيشن من الكلب Myoblasts
    1. ثقافة myoblasts CXMD في 3 مل من متوسط ​​النمو في 6 لوحات جيدا. البذور 1-5 × 10 3 خلية / سم 2 مع 0.5 مل / سم 2 متوسطة لmyoblasts. على المدى المتوسط ​​النمو، واستخدام تعديل المتوسطة Dulbecco والنسر (DMEM) مع 10٪ مصل بقري جنيني (FBS) و 1٪البنسلين / الستربتومايسين (P / S) 40.
    2. احتضان عند 37 درجة مئوية حتى 60-80٪ متموجة. هذا يستغرق حوالي 12 إلى 24 ساعة.
    3. تمييع الموجبة وكيل الحويصلية transfecting إلى ما مجموعه 100 ميكرولتر في خفض سيرم (2: 1 نسبة كيل transfecting: AONs، على سبيل المثال، 10 ميكرولتر lipofectin مقابل 5 ميكروغرام AONs). السماح للخليط إلى الوقوف على RT لمدة 30 - 45 دقيقة.
    4. تمييع AONs (2'OMePS أو morpholinos) إلى الحجم النهائي من 100 ميكرولتر في خفض المتوسطة المصل.
    5. الجمع بين وكيل transfecting المخفف مع AONs المخفف واحتضان على RT لمدة 10-15 دقيقة.
    6. في حين أن وكيل ترنسفكأيشن / AON خليط يجلس على RT، وإزالة وسائل الإعلام القديمة من الخلايا عن طريق الطموح وغسل الخلايا مع وسائل الإعلام.
    7. إضافة 0.8 مل سائل الإعلام إلى وكيل ترنسفكأيشن / AON الخليط ثم تضاف حل كامل لخلايا غسلها طازجة. احتضان لمدة 3 ساعة على 37 درجة مئوية.
    8. بعد تفرخ، استبدال وسائل الإعلام مع differentiatوسائل الإعلام أيون (DM)؛ التمايز يمكن أن يستغرق فترة تصل إلى 10 يوما. تحقق لمعرفة ما إذا كان قد حدث التمايز تبدأ في اليوم حوالي 3. وسائل الإعلام التمايز هو DMEM مع مصل الحصان 2٪، و 200 U / البنسلين مل و 200 ملغ / مل الستربتومايسين، و 10 ميكروغرام / مل الانسولين.
  2. Morpholino ترنسفكأيشن من الكلب Myoblasts
    1. ثقافة CXMD myoblasts في متوسط ​​النمو كما هو موضح في الخطوة 2.1.
    2. التبديل إلى متوسطة التمايز (DM)، وإضافة 0.1 ملي morpholino الأوراق المالية إلى كل بئر لجعل تركيز النهائي 1 ميكرومتر. morpholinos كوكتيل الحرارة عند 65 درجة مئوية لمدة 10 دقيقة قبل ترنسفكأيشن أو الحقن لتجنب AON التجميع. إضافة كاشف تسليم الببتيد 39،51 والتكيف مع تركيز النهائي من 3-6 ميكرومتر.
    3. بعد 16-48 ساعة من الحضانة، وجمع خلايا لاستخراج الحمض النووي الريبي. إضافة 1 مل حامض guanidinium ثيوسيانات الفينول كلوروفورم إلى الخلايا لفصل الخلايا من لوحة. أداء RNA المقتطفنشوئها بعد هذه الخطوة.
      1. بدلا من ذلك، إضافة التربسين بحيث يغطي جميع الخلايا واحتضان لمدة 2 دقيقة عند 37 درجة مئوية.
        ملاحظة: اذا كان يعتزم القيام كيمياء المناعة، واستخدام النظارات شريحة غرف للزراعة. بعد تمايز الخلايا يمكن ان تكون ثابتة باستخدام بارافورمالدهيد (PFA) (4٪ لمدة 10 دقيقة).
  3. استخراج الحمض النووي الريبي والنسخ العكسي تفاعل البلمرة المتسلسل (RT-PCR)
    1. مرة واحدة يتم التمييز الخلايا في myotubes، وإزالة المتوسطة وإضافة 1 مل حامض guanidinium ثيوسيانات الفينول كلوروفورم، احتضان لمدة 10 دقيقة في RT.
    2. نقل إلى 1.5 مل أنابيب. تتحد مع 200 ميكرولتر الكلوروفورم واحتضانها في RT لمدة 2 دقيقة حتى يمكن رؤية ثلاث طبقات منفصلة. ثلاث طبقات من أعلى إلى أسفل هي: طبقة الحمض النووي الريبي، وطبقة الحمض النووي، وطبقة البروتين.
    3. أجهزة الطرد المركزي في 12000 × ز لمدة 15 دقيقة على 4 درجات مئوية. إزالة كبار طاف طبقة ومكان في أنبوب مع 500 & #181؛ ل الأيسوبروبانول (إذا كان وقف هنا، وتخزين طاف في -80 درجة مئوية). الطرد المركزي طاف في 12000 × ز لمدة 10 دقيقة في 4 درجات مئوية. بعد الطرد المركزي، والحفاظ الناتجة بيليه RNA وتجاهل طاف.
    4. غسل بيليه مع الايثانول وأجهزة الطرد المركزي في 8000 x ج لمدة 5 دقائق في 4 درجات مئوية. تتبخر الإيثانول المتبقية من أنبوب للقلب لمدة 15 دقيقة ثم قم بإضافة 15-30 ميكرولتر من ريبونوكلياز خالية من المياه. تحديد مجموع تركيز الحمض النووي الريبي باستخدام الولايات المتحدة / VIS الطيفي في 260 نانومتر.
    5. الجمع بين الكواشف اللازمة لرد فعل RT-PCR: 1.5 ميكرولتر 10 ميكرومتر التمهيدي إلى الأمام، 1.5 ميكرولتر 10 ميكرومتر التمهيدي العكسي، 1 ميكرولتر dNTP، 5 ميكرولتر من خطوة واحدة عازلة عدة PCR، 0.7 ميكرولتر ريبونوكلياز المانع 1 ميكرولتر انزيم خليط من واحد- خطوة PCR عدة، و 200 نانوغرام من الحمض النووي الريبي. مرة واحدة هذه كانت مختلطة، إضافة الماء إلى الحجم النهائي من 25 ميكرولتر.
    6. ضع الخليط في الحرارية cycler على. تشغيل دورة 30 دقيقة عند 50 درجة مئوية، لمدة 15 دقيقة0؛ دورة في 95 درجة مئوية، ثم 35 دورة من 94 درجة مئوية لمدة 1 دقيقة، 60 درجة مئوية لمدة 1 دقيقة، و 72 درجة مئوية لمدة 1 دقيقة. وأخيرا، تشغيل دورة 10 دقيقة عند 72 درجة مئوية. مخزن المنتج PCR في الثلاجة على 4 درجات مئوية أو -20 ° C
  4. الحمض النووي التكميلي (كدنا]) تسلسل
    1. تحديد اكسون 6 - العصابات 9 تخطي باستخدام الاغاروز الكهربائي للهلام. تحميل 5 ميكرولتر من كل عينة في آبار agarose هلام 1.5٪، تشغيل 135 V من خلال الجل لمدة 5 دقائق، ثم 120 V لمدة 20 دقيقة. بعد ذلك، احتضان الجل في وصمة عار هلام الحمض النووي في RT لمدة 30 دقيقة. تصور العصابات باستخدام برامج التصوير.
    2. استئصال الفرقة الاهتمام باستخدام مجموعة استخراج الهلام.
      1. استئصال جزء الحمض النووي وإذابة شريحة هلام باستخدام 200 ميكرولتر المعهد القومي للاتصالات / 100 هلام ملغ. اسمحوا هذا الاعتصام لمدة 5 إلى 10 دقيقة في 50 ° C حمام الماء. ثم نقل إلى السيليكا أنبوب الغشاء.
      2. أجهزة الطرد المركزي في 11000 x ج لمدة 30 ثانية. يغسل مرتين مع 700 العازلة NT3 ميكرولتر قبل مntrifuging مرة أخرى في 11000 x ج لمدة 30 ثانية.
      3. يجف الغشاء السيليكا بواسطة الطرد المركزي في 11000 x ج لمدة 1 دقيقة.
      4. إضافة 15 - عازلة NE 30 ميكرولتر والسماح لها الجلوس على RT لمدة 1 دقيقة. ثم، الطرد المركزي في 11000 x ج لمدة 1 دقيقة. إزالة هلام السيليكا والحفاظ على محتويات الأنبوب.
    3. استخدام مجموعة التسلسل لتحديد تسلسل وفقا لبروتوكول الشركة المصنعة.

3. العضل الحقن أو توسيع خزعة العضلات

  1. لصيانة ظروف معقمة أثناء الجراحة البقاء على قيد الحياة، وإزالة الشعر باستخدام كليبرز في المنطقة المحيطة بالموقع جراحة (أطرافهم الخلفية). استخدام iodophors أو chlorohexidine كمطهر. استخدام الستائر العقيمة لموقع الجراحية عن طريق وضع وتأمينها خلال كامل الحيوانية وطاولة العمليات.
    1. ارتداء الدعك نظيفة، أقنعة الوجه، غطاء الرأس، والقفازات المعقمة، وحذاء خاص لغرفة العمليات 52،53.
    2. </ رأ>
    3. حقن الكلاب CXMD مع 20 ملغ / كغ من الصوديوم ثيوبنتال إلى تخدير لهم. استخدام البيطري مرهم للعين لمنع العينين من الجفاف.
    4. استخدام 2-3٪ الأيزوفلورين استنشاق للحفاظ على التخدير العام (الشكل 3). تحقق ردود الفعل العضلات ومراقبة القلب ومعدل التنفس لتقييم عمق التخدير. المعدل الطبيعي التنفس (RR) ومعدل ضربات القلب (HR)، ومكتب التخطيط الاستراتيجي 2 تحت التخدير العام على النحو التالي: RR: 10-20 الأنفاس / دقيقة. مكتب التخطيط الاستراتيجي 2: 95 - 100٪، والموارد البشرية: 80 - 120 نبضة في الدقيقة (بي بي إم).
    5. باستخدام مشرط، وقطع الجلد فوق عظام الساق الجمجمة (CT)، المعروف أيضا باسم الأمامية الظنبوبي (TA)، وجعل قطع واحد حوالي 5 سم طوليا (للكلاب الشباب البالغين). بمناسبة مواقع الحقن، غرزة اللفافة العميقة باستخدام إبرة جراحية والخيط الجراحي وجعل اثنين من علامات غرزة في 2 سم فترات.
    6. حقن تركيز المطلوب من AONs في العضلات مع إبرة 27 G. وتركيزات المطلوبtration يختلف بين الظروف العلاج. لCT، وإعطاء حقنتين من 1 حجم مل لكل منهما، أي ما مجموعه 1.2 ملغ من أبطأ قليلا كوكتيل (0.4 ملغ لكل PMO) أو 0.4 ملغ من vPMOs كوكتيل (0.13 ملغ كل vPMO). لالباسطة للرسغ الزندي (ECU) في العضلات forelimb، وضخ مجلدين من 0.5 مل لكل منهما ليصبح المجموع 1.2 ملغ من أبطأ قليلا كوكتيل (0.4 ملغ لكل PMO) أو 0.4 ملغ من vPMOs كوكتيل (0.13 ملغ كل vPMO). مغادرة في إبرة لمدة 1 دقيقة. استخدام كمية متساوية من كل AON للكوكتيل.
    7. أداء مفتوح خزعة العضلات عن طريق إزالة جزء من الأنسجة العضلية ما يقرب من 2 سم في الطول من CT العضلات باستخدام مشرط جراحي.
    8. انتقل إلى الخطوة 6.5 لإعداد عينة العضلات.
    9. باستخدام إبرة، إدارة الحقن العضلي من 0.02 ملغم / كغم البوبرينورفين هيدروكلوريد قبل الصحوة من التخدير العام. وضع رباط العضلات والجلد إلى أكثر من العضلات وغرزة هذه باستخدام 3-0 موضوع قابل للامتصاص و3-0 النايلون موضوع اللفافة العضلية وإغلاق الجلد، respectivاعل.
    10. في حين عقد الفم مفتوحا، وتحديد ما إذا كان رد الفعل هفوة قد عاد. عندما عاد منعكس هفوة، ينزع الأنبوب الكلب.
    11. إدارة 15-30 ملغ / كغ سيفازولين أو سيفالكسين (المضادات الحيوية) لمدة تصل إلى 3 أيام عن طريق الحقن في الوريد أو العضل لمنع العدوى.
    12. إزالة الغرز في غضون سبعة أيام. لا تترك الكلب غير المراقب حتى استعاد وعيه كافية للحفاظ على الاستلقاء القصية، وعدم السماح للكلب لتتفاعل مع غيرها من الحيوانات حتى يتم الشفاء الكامل. الحفاظ على أنابيب القصبة الهوائية في مكان لأطول فترة ممكنة وإزالتها عندما يبدأ الحيوان لمضغ أو البلع. مراقبة الحيوان معدل ضربات القلب، والتنفس، والماء للتأكد من أنها مستقرة وضمن الحدود الطبيعية.
    13. للحصول على الرعاية بعد الجراحة، وتوفير تسكين الألم لمدة 3 أيام (على سبيل المثال، البوبرينورفين 0.01 ملغ / كلغ) ودعم التمريض، بما في ذلك هادئ، مكان مظلم يستريح، الجرح المناسب وصيانة ضمادة، لينةسطح يستريح، الإماهة مع السوائل الفموية أو الوريدية، والعودة إلى التغذية الطبيعية من خلال استخدام الأطعمة مستساغا للغاية أو يعامل. إذا تتطلب أي الحيوانات أدوية إضافية، وإعطاء الحقن العضلي من 0.3 ملغم / كغم من طرطرات بوتورفانول اعتمادا على الأعراض الألم.
      ملاحظة: الكلاب في الألم قد لدغة، الصفر، أو حراسة المناطق المؤلمة، وإذا ما تم تناوله، قد يكون تخوف غير عادي أو العدوانية. وبالإضافة إلى ذلك، ألم في أحد أطرافه عادة ما ينتج في يعرج أو عقد المتابعة في الطرف المصاب مع محاولات لاستخدامه. في مثل هذه الحالات، وإعطاء الحقن العضلي من 0.02 ملغ / كغ من هيدروكلوريد البوبرينورفين كل 6-8 ساعة.

    4. الجهازية الحقن

    ملاحظة: هذا الإجراء يمكن أن يتكرر أسبوعيا أو كل أسبوعين لالعدد المرغوب فيه من أسابيع.

    1. كبح جماح كلاب يدويا وبلطف عن طريق الحصول على الكلب على الاستلقاء على الأرض ثم ثنى الأسلحة على الأكتاف والوركين لاجراء الكلب في مكان في جميع أنحاء ركان الإجراء.
    2. حقن AONs. 120 - أبطأ قليلا 240 ملغم / كغم كوكتيل (40 - 80 ملغ في كل AON) باستخدام إبرة وريدية الساكن في الوريد الأطراف (المعروف باسم رأسي أو الوريد الصافن). كمية AON حقن يعتمد على حالة تجريبية. استخدام كمية متساوية من كل AON للكوكتيل.
    3. استخدام مضخة التسريب أو سائق حقنة لحقن 50 مل مجموعه بمعدل 2.5 مل / دقيقة لمدة 20 دقيقة، بعد تعليمات الشركة الصانعة. كرر حقن أسبوعية أو نصف شهرية (كل أسبوعين) على الأقل 5 مرات، والتعبير الدستروفين سوف تتراكم مع تكرار الحقن.
    4. إجراء اختبارات الدم أسبوعيا لدراسة سمية.
      1. باستخدام إبرة، وجمع 3 مل من الدم - 0.5 مل لتعداد الدم الكامل (CBC) و 2.5 مل للآخرين - من أحد الأوردة تحت الجلد في الصدارة أو hindlimb. تشمل CBC، ترانسفيراز غاما غلوتاميل (GGT)، اسبارتاتي الألانين (AST)، اليوريا في الدم النيتروجين (بون)، aminotra ألانينnsferase (ALT)، كيناز الكرياتين (CK)، والتقييمات الكرياتينين عند اختبار الدم التي تم جمعها، بعد تعليمات الشركة الصانعة من مجموعات اختبار الدم. 40،54

    5. تصنيف السريري للكلاب

    1. انشاء كاميرا فيديو وسلوك الكلب قياسي والمشية. تسجيل لقاء كامل مع الكلب لأن هذا سيكون بمثابة إشارة عندما الدرجات الكلب. هذا يعني أن كل فيديو يكون طول مختلفة اعتمادا على قدرات الكلب والاستعداد. استخدام معلمات التسجيل الافتراضي. تصوير يخلق سجل الدرجات بحيث يمكن مراجعتها في وقت لاحق.
    2. الصف مشية وحركة الاضطرابات.
      1. لمشية وحركة الاضطرابات، استخدام الدرجات التالية:
        الصف 1 = لا شيء، الصف 2 = يجلس مع أطرافه الخلفية الموسعة، الصف 3 = الارنب-القفزات مع الأطراف الخلفية، الصف 4 = خلط مشيا على الأقدام، ودرجة 5 = غير قادر على المشي.
      2. لاضطراب الحركة، استخدام الصفوف التالية: الصف 1 = لا شيء، غرامADE 2 = الاستلقاء أكثر من المعتاد، والصف 3 = لا يمكن القفز على أطرافه الخلفية، الصف 4 = زيادة صعوبة التنقل، ودرجة 5 = غير قادر على الحصول على ما يصل والتحرك.
    3. كم من الوقت يستغرق الكلب لتشغيل 15 م. قياس من 15 مترا، ووضع الكلب عند خط البداية وتشجيعها على تشغيل حتى علامة 15 مترا.
    4. تحديد ضمور العضلات في الطرف باستخدام مقياس الدرجات التالية:
      الصف 1 = لا شيء، الصف 2 = صلابة المشبوهة، الصف 3 = يمكن أن يشعر صلابة أو تظهر رقيقة، الصف 4 = بين الصفوف 3 و 5، ودرجة 5 = رقيقة جدا أو الثابت.
    5. الصف سيلان اللعاب باستخدام مقياس التالية: الصف 1 = لا شيء، الصف 2 = القطرات أحيانا اللعاب عند الجلوس، الصف 3 = بعض سال لعابه عند الأكل والشرب، الصف 4 = سلاسل من سال لعابه عند الأكل أو الشرب، ودرجة 5 = سال لعابه المستمر.
    6. الصف تضخم في اللسان (ضخامة اللسان) باستخدام مقياس التالية: الصف 1 = لا شيء، الصف 2 = الموسع قليلا، الصف 3 = الموسعة outsiدي الأسنان، الصف 4 = الموسع وسميكة قليلا، ودرجة 5 = الموسع وسميكة.
    7. الصف قدرة الكلب على ابتلاع باستخدام المقياس التالي: الصف 1 = أي صعوبة، الصف 2 = يستغرق وقتا وجهدا في اتخاذ الغذاء، الصف 3 = صعوبة في اتخاذ الطعام من طبق من ذهب، الصف 4 = صعوبة في المضغ والبلع، أو الشرب ، ودرجة 5 = غير قادر على تناول الطعام.
    8. حساب الدرجة الكلية بإضافة عشرات من كل فئة (باستثناء اختبار تشغيل 15 م) 55.
      ملاحظة: يجب أن يكون أعمى الدراسات حتى لا يعرض التحيز.

    6. التصوير بالرنين المغناطيسي (MRI)

    1. استخدام 3 تسلا (3T) التصوير بالرنين المغناطيسي و18 سم قطرها / 18 سم طول لفائف أقصى البشري للحصول على صور T2 المرجحة للهند-أطرافه.
    2. تخدير الحيوانات عن طريق حقن الكلاب CXMD مع 20 ملغ / كغ من ثيوبنتال. استخدام البيطري مرهم للعين لمنع العينين من الجفاف. استخدام استنشاق الأيزوفلورين 2-3٪ للحفاظ على التخدير العام.
      1. تحقق ردود الفعل العضلات ومراقبة القلب ومعدل التنفس لتقييم عمق التخدير. المعدل الطبيعي التنفس (RR) ومعدل ضربات القلب (HR) ومكتب التخطيط الاستراتيجي 2 تحت التخدير العام على النحو التالي: RR: 10-20 الأنفاس / دقيقة، ومكتب التخطيط الاستراتيجي 2: 95 - 100٪، والموارد البشرية: 80 - 120 نبضة في الدقيقة الواحدة (نبضة في الدقيقة ).
    3. استخدام الإعدادات التالية للحصول T2 المرجحة الصور: TR / TE = 4000/85 ميللي ثانية، شريحة سمك = 6 ملم، شريحة الفجوة = 0 ملم، مجال الرؤية = 18 سم × 18 سم، حجم المصفوفة = 256 × 256، و عدد من عمليات الاستحواذ = 3 خلال صدى تدور بسرعة (الشكل 4).

    7. العضلات أخذ العينات وإعداد (التشريح)

    ملاحظة: يجب أخذ عينات من العضلات واحد أو أسبوعين بعد الحقن AON الماضي.

    1. حقن الكلاب مع 20 ملغ / كغ من الصوديوم ثيوبنتال إلى تخدير لهم. استخدام البيطري مرهم على العينين أثناء التخدير لمنع جفاف العينين.
    2. استخدام 2-3٪ استنشاق الأيزوفلورين للحفاظ على أنسthesia. تحقق ردود الفعل العضلات ومراقبة القلب ومعدل التنفس لتقييم عمق التخدير. المعدل الطبيعي التنفس (RR) ومعدل ضربات القلب (HR) ومكتب التخطيط الاستراتيجي 2 تحت التخدير العام على النحو التالي: RR: 10-20 الأنفاس / دقيقة. مكتب التخطيط الاستراتيجي 2: 95 - 100٪، والموارد البشرية: 80-120 نبضة في الدقيقة.
      1. الموت ببطء الكلاب عن طريق استنزاف تحت التخدير العام (لتشريح فقط). استخدام استنزاف تحت التخدير العام عميقة لتفادي الآثار الناجمة عن العوامل المشتقة من الدم في التحليل الجزيئي (على سبيل المثال، عضلات القلب).
    3. تشريح العضلات التالية (الشكل 5): CT، باسطة إبهام اليد (مؤسسة كهرباء لبنان)، الفخذية الساق، النعلية، العضلة ذات الرأسين الفخذية، المستقيمة، العضلة ذات الرأسين العضدية، ثلاثية الرؤوس العضدية، الدالية، وحدة نقدية أوروبية، الكعبري الباسطة للرسغ (ائحة المجلس الأوروبي)، الزندي المثنية للرسغ (FCU )، الكعبري المثنية للرسغ (FCR)، الناحلة، وربي، عضلات البطن، الحجاب الحاجز، والظهرية الجانبية، المريء، القصية الترقوية الخشائية، والقلب. لفحص السمية، وجمع الكلى ولىعينات الاصدار. استخدام ايفانز والكسندر دي Lahunta (2009) كمرجع للتقنية تشريح 56.
    4. قطع CT، مؤسسة كهرباء لبنان، الساق، النعلية، العضلة ذات الرأسين الفخذية، الفخذية المستقيمة، العضلة ذات الرأسين العضدية، ثلاثية الرؤوس العضدية، الدالية، وحدة نقدية أوروبية، ائحة المجلس الأوروبي، FCU، FCR، الناحلة، وربي، عضلات البطن، والظهرية الجانبية، المريء، القصية الترقوية الخشائية، القلب، الكلى، والكبد إلى أقسام صغيرة تقريبا 1 - 1.5 سم في الطول. لفة الحجاب الحاجز وحتى ذلك الحين تقطع الى 1-1،5 سم أقسام 56.
    5. وضع الكثيراء اللثة بحيث يكون حوالي 0،5-1 سم سميكة على أقراص الفلين. أقراص التسمية مع تحديد والعضلات اسم الحيوان على الجانب الآخر من صمغ الكثيراء.
    6. وضع العضلات مع محور من طولي عمودي على الفلين في اللثة الكثيراء.
    7. وضع الفلين في وعاء يحتوي على نظير البنتان أن يجلس في النيتروجين السائل. تحريكه باستمرار مع ملاقط لمدة 1 دقيقة أو حتى تجميدها تماما. متجر العضلات على الفلينفي قارورة في -80 درجة مئوية. عند نقل، ووضع قارورة على الثلج الجاف.
    8. إعداد الشرائح الزجاجية المسمى مع الحيوان تحديد / اسم العضلات والتاريخ.
    9. في تبريد ناظم البرد إلى -25 درجة مئوية، وجبل كورك للموقف. تعيين سمك الباب إلى المستوى المطلوب. استخدام 8 ميكرون لالمناعية و 12 ميكرون لالهيماتوكسيلين ويوزين (سعادة) تلطيخ. استخدام 15 ميكرون لعينات لطخة غربية. تقليم حوالي ربع العضلات للحصول على عضلة مسطحة لأخذ العينات العضلات السليمة.
    10. قطع مقطع واحد من العضلات في وقت واحد، وضع كل قسم ال 6 على شريحة زجاجية نفسها إذا التخطيط لاستخدام عينات لالمناعية أو سعادة تلطيخ. في حالة استخدام عينات للالبقع الغربية، وضعت 30-40 المقاطع في أنبوب ومخزن في -80 درجة مئوية.
    11. بعد إعداد الشرائح، دعونا الشرائح الجافة 1.5 ساعة على RT. تخزين الشرائح في -80 درجة مئوية.

    8. المناعية

    1. إزالة شرائح محضرة من التخزين ووضعها فيغرفة الرطوبة للحفاظ على الشرائح فصل والحفاظ على الرطوبة. تملأ الغرفة الرطوبة بحيث يتم تغطية الجزء السفلي فقط مع الماء (حوالي 1 ملم من الماء).
    2. الهواء الجاف لمدة 0.5 ساعة. رسم مربع يحتوى على عينة العضلات على الشريحة باستخدام حاجز القلم مسعور.
    3. إضافة 15٪ مصل الماعز في الفوسفات مخزنة المالحة (PBS)، واحتضان لمدة 2 ساعة على RT في عرقلة كاشف.
    4. إضافة مكافحة الدستروفين نطاق قضيب (DYS-1) الماوس الأجسام المضادة وحيدة النسيلة الأساسي، أو الأجسام المضادة وحيدة النسيلة C-محطة (DYS-2) للكلب الدستروفين تلطيخ (1: 150 تمييع). تمييع باستخدام عامل حظر في 1.25 مل من برنامج تلفزيوني. احتضان O / N في الثلاجة 4 درجة مئوية.
    5. يغسل مع برنامج تلفزيوني لمدة 5 دقائق، وكرر ثلاث مرات. إضافة الضد الثانوية اليكسا 594 الماعز الأجسام المضادة ضد IgG1 الماوس (لDYS-2) أو IgG2 (لDYS-1) (1: 2500). تمييع مع كاشف حظر في برنامج تلفزيوني يحتوي على 0.1٪ الأوكتيل ethoxylate الفينول. احتضان لمدة 0.5 ساعة على RT.
    6. يغسل مع برنامج تلفزيوني لمدة 5 دقائق، ثلاث ربرامج تحرير أسلوب الإدخال. تسمح الشرائح لتجف. إضافة 1-2 قطرات (3 نانوغرام / مل) من 4، 6 diamidino-2-phenylindole (دابي) حل في تصاعد مستمر. باستخدام الملقط، ضع زلة الزجاج فوق الجزء العلوي من الفروع، وتجنب الفقاعات.
    7. عرض dystrophin- (DYS-1 / DYS-2) الألياف إيجابية تحت المجهر الفلورسنت في 594 نانومتر في 20X التكبير.

    9. الغربية التنشيف

    1. إضافة أقسام العضلات التي تم جمعها من البرد باجتزاء إلى 150 ميكرولتر من عينة العازلة على الجليد.
    2. باستخدام الخالط جهة، التجانس لفترة وجيزة على عينات البروتين. عينات الحرارة في أنبوب 1.5 مل في حاضنة كتلة التدفئة في 95 درجة مئوية لمدة 3-5 دقيقة. أجهزة الطرد المركزي في 16500 × ز لمدة 15 دقيقة، وجمع طاف.
    3. مخزن aliquots من طاف في -70 درجة مئوية. استخدام الماء المقطر لتمييع إلى 100X.
    4. تحديد تركيز البروتين باستخدام طقم التجارية وفقا لبروتوكول الشركة المصنعة. إضافة 2X عازلة Laemmli SDS-تحميل لعينات والحرارة لمدة 3 دقائق و# 160؛ في درجة حرارة 95 درجة مئوية.
    5. عينات الحمل إلى 3-8٪ هلام تريس، خلات قبل تشغيله لمدة 3 ساعة على 150 خامسا تشمل عدة المخفف من النوع البري (WT) عينات (على سبيل المثال، 1٪، 10٪، و 50٪) لتقدير. يجب أن يتم الكشف عن أقل من 1٪ مستويات WT من الدستروفين مع هذا الأسلوب.
    6. وضع الجل في المخزن الكاثود لمدة 20 دقيقة. خلال هذا الوقت، وأخذ تسع قطع من ورق الترشيح ووضعها في المخازن المؤقتة نقل (3 أوراق في المنطقة العازلة الكاثود [+]، المخزن المؤقت الأنود ([-]، والمخزن المؤقت الأنود المركزة [-]، على التوالي) هذا. يصف أسلوب النقل شبه الجافة التي يزيد من حساسية (الشكل 6).
    7. نقع غشاء PVDF في الميثانول لمدة 20 ثانية ثم وضع في المخزن المؤقت الأنود.
      إعداد هلام مع غشاء لنقل شبه الجافة والسماح لها لتشغيل 1.5 ساعة في 400 مللي أمبير في RT أو في غرفة باردة.
    8. يغسل الغشاء مع برنامج تلفزيوني. احتضان الغشاء في خليط من برنامج تلفزيوني مع توين 20 (PBST) ومسحوق الحليب 5٪ لمدة 2 ساعة.
    9. تمييع DYS-1 (الأجسام المضادة الأولية) في PBST و 5٪ مسحوق الحليب الخليط إلى التخفيف 1: 100. إضافته إلى الغشاء والسماح لها احتضان لمدة 1 ساعة على الأقل. يغسل ثلاث مرات مع PBST 100 مل لمدة 15 دقيقة لكل منهما.
    10. إضافة 65 ميكرولتر / حارة من HRP الضد الثانوية مترافق (المضادة للماوس IgG2a لDYS1) في 1: 5000 تخفيف مدة 1 ساعة على RT في منطقة مظلمة. ثم، ويغسل ثلاث مرات مع 200 مل PBST لمدة 20 دقيقة. مزيج الحلول من مجموعة الكشف وفقا لتوجيهات. احتضان لمدة 1 دقيقة.
    11. تطوير الفيلم للكشف عن عصابات وتحليل مع برنامج ImageJ 48،57،58.

Representative Results

في التجارب المختبرية

و transfected Myoblasts مع مختلف الظروف العلاج 2'OMePS من أجل مقارنة فعالية كل AON. وقد أجريت العلاجات AON واحدة مع 600 نيوتن متر من كل Ex6A، Ex6B، Ex8A، أو Ex8B، فضلا عن معالجة كوكتيل مع 600 نيوتن متر لكل من جميع متواليات AON 4. تم جمع عينات الحمض النووي الريبي بعد أربعة أيام ترنسفكأيشن. بعد RT-PCR، تم تشغيل عينات لكل معاملة على هلام جنبا إلى جنب مع عينات غير المعالجة (NT). عصابات أعلى على هلام تمثل خارج الإطار منتجات DMD. وينظر إلى هذه العصابات في NT، Ex8A، وEx8B تعامل myoblasts. أظهرت Ex6A، Ex6B، Ex8A، وmyoblasts المعالجة كوكتيل المنتجات في الإطار. أظهر كوكتيل وEx6A / B 100٪ منتجات في الإطار، في حين أظهرت Ex8A 30٪ فقط في الإطار منتجات (الشكل 7). لتأكيد تخطي اكسون وترميمفي إطار القراءة، تم إجراء كدنا] تسلسل. وأشارت النتائج إلى أن الإكسونات 6-9 قد تم بالفعل تخطي (الشكل 7). أظهرت المناعية أن الكلاب تعامل AON قد زادت الألياف الدستروفين إيجابي مقارنة عينات NT (الشكل 8).

في التجارب فيفو

لمقارنة كفاءة مختلف الظروف العلاج AON، والكلاب CXMD - تم حقن (0.5 5 سنوات من العمر) مرة واحدة مع 1.2 ملغ Ex6A أو مزيج من Ex6A، Ex6B، وEx8A على مختلف جرعات. بعد أسبوعين من الحقن، وقد تم جمع عينات العضلات وملطخة DYS-1 للمقارنة بين عدد من الألياف الدستروفين إيجابي. أظهرت جميع العينات المعالجة كوكتيل زيادة التعبير الدستروفين مقارنة عينات NT. ارتفعت الألياف الدستروفين الإيجابي مع AON الجرعة (الشكل 9). النظام التاليةحقن جيم، كانت ملطخة البرية من نوع (WT)، NT، وعينات العضلات CXMD المعالجة كوكتيل مع DYS-1 (الشكل 10). المعالجة كوكتيل الكلاب CXMD أظهرت زيادة التعبير الدستروفين بالمقارنة مع الكلاب NT CXMD، سواء في التصوير المقطعي وعينات عضلة القلب. ومع ذلك، أظهرت المعالجة AON العضلات والهيكل العظمي (CT) تعبير أعلى بكثير من الدستروفين مقارنة عضلة القلب المعالجة. وأدى طخة مناعية مقارنة WT، NT، ومختلف morpholino العضلات المعالجة كوكتيل إلى نفس النتيجة. كان هناك أيضا مجموعة واسعة من التعبير الدستروفين في عينات العضلات والهيكل العظمي المعالجة (الشكل 10). كشفت الهيماتوكسيلين ويوزين (سعادة) تلطيخ أن تعامل CXMD وأظهرت الكلاب تحسين التشريح المرضي، مع انخفاض ملحوظ في الألياف مركزيا الأنوية (كنف) بالمقارنة مع الكلاب NT CXMD (الشكل 11). وهذا يدل على أن هناك المزيد من انحطاط / تجديد تحدث في الكلب NT، علامة على أمراض التصنع العضلات. بالإضافة إلى ذلك، كانت الكلاب تعامل بشكل أسرعتشغيل مرات وتحسين الدرجات على مقياس الدرجات السريرية. وأظهرت معاملة الكلاب CXMD عشرات أفضل من الكلاب NT CXMD في جميع الفئات (الشكل 12).

شكل 1
الشكل 1. الطفرة نمط من الكلب CXMD وexons متماثلة 6 - 8 استراتيجيات تخطي باستخدام كوكتيل العقاقير الكلاب CXMD لديهم طفرة نقطة في اكسون 6 مما يؤدي إلى فقدان اكسون 7 في التصنع الكلب مرنا. وهذا يؤدي إلى مرنا يجري خارج الإطار وإنتاج بروتين الدستروفين تضيع. تم تصميم تسلسل AON قصيرة لربط اكسون 6 و 8، والذي ينتج في مرنا الربط تخطي فعال الإكسونات 6 - 8. الشريط الرمادي في الكلاب المعالجة كوكتيل AON يمثل تسلسل AON قصيرة. اكسون 9 بترميز مجال المفصلي وأحيانا تقسم بشكل عفوي خارجا مع AONs ضد اكسون 6 و 8. الناتجة رموز مرنا لالدستروفين البروتينات التي هي أقصر ولكن وظيفةآل. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
ويبين الشكل 2. الأعراض السريرية الرئيسية للحيوان البالغ من العمر 1-العاشر مرتبطة الناب ضمور العضلات (CXMD). ويبلغ من العمر 1-النوع البري بيغل والكلب CXMD. وعادة ما تكون لوحظ اشتراك الداني، أطرافه، والعضلات الزمنية من 2 أشهر من العمر. انكماش مشترك وتحول من الحوض وعلني من 4 أشهر من العمر. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. التخدير العام للكلب. أ) Intramusculيتم تنفيذ الحقن AR والخزعات العضلية تحت التخدير العام مع isoflurane. ب) عقد الحيوان لحقن النظامية. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (4)
الشكل 4. التصوير بالرنين المغناطيسي (MRI) من النوع البري، غير المعاملة CXMD، وتعامل CXMD. فحوصات الرنين المغناطيسي للأطرافهم هند في 3 أشهر و 5 أشهر في WT و NT CXMD الكلاب. وتظهر صورتان عينة من يعامل هند CXMD أطرافهم الرنين المغناطيسي ما قبل (1 قبل أسبوع من الحقنة الأولى) وبعد حقن AON. كان يعامل 2703MA أسبوعيا 7X مع 200 ملغ / كغ morpholinos كوكتيل. كان يعامل 2001MA مع 5X رابعا الحقن الأسبوعية من 120 ملغ / كغ morpholinos كوكتيل. كانت السيطرة والكلاب معاملة متساوية في العمر. الكلاب تعامل تظهر انخفض إشارات T2. الصور هي اداب تيد بإذن من يوكوتا وآخرون. (حقوق الطبع والنشر 2009، جون وايلي وأولاده) 40 الرجاء النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 5
ويحدد الشكل 5. العضلات إجراء خزعة للكلب. أ) والطرف السفلي للخزعة العضلات. ب) بمساعدة ملقط، ويقام الطرف السفلي. C) تتعرض العضلات CT. يستخدم تقنية خزعة مفتوحة للحصول على عينات العضلات من مواقع حقن. وتستخدم المواضيع لعقد عينات الخزعة. عينات D) العضلات على الصمغ الكثيراء بعد تشريح. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

/53776/53776fig6.jpg "/>
ويرد الشكل 6. أسلوب نقل نصف الجافة. وتمثيل طريقة نقل شبه الجافة لالنشاف الغربية. وضعت ثلاث ورقات غارقة في المخزن الأنود تتركز في أسفل السالب. مكدسة 3 ورقات غارقة في المخزن الأنود على رأس هذا. يتم استيعابه ورقة ميغابايت PVDF في الميثانول ثم عازلة الأنود قبل أن يوضع على رأس 6 أوراق. هلام، التي كانت غارقة في المخزن الكاثود، وضعت بلطف على ورقة PVDF. وأخيرا، وضعت 3 أوراق غارقة في المخزن الكاثود على أعلى من هلام. تم تعيين الموجب على القمة. لمدة 1 ساعة، 400 مللي أمبير تشغيل من خلال النظام. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 7
الرقم 7. اكسون الطفر في CXMD Myoblasts. وآخرون. (حقوق الطبع والنشر 2009، جون وايلي وأولاده) 40. يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 8
الرقم 8. زيادة Dystropو transfected هين التعبير في ميثليته 2'O-Phosphorothioate (2'OMePS) Transfected CXMD Myoblasts. myoblasts CXMD مع Ex6A وحدها أو مع 2'OMePS كوكتيل. وتظهر DYS-2 (أحمر) ودابي (الأزرق) تلطيخ. تتم مقارنة myoblasts المعالجة إلى البرية من نوع (WT) وmyoblasts غير المعالجة (NT). يتم تكييفها الصور بإذن من يوكوتا وآخرون. (حقوق الطبع والنشر 2009، جون وايلي وأولاده) 40. بار = 50 ميكرون. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 9
تم حقن الرقم 9. الإنقاذ التعبير الدستروفين مع العضل حقن Morpholinos في CXMD الكلاب. اما Ex6A وحدها أو مزيج من Ex6A، Ex6B، وEx8A في العضلات CT الكلاب CXMD. الدستروفين (DSY-1) تلطيخ من النوع البري(WT)، غير المعالجة (NT)، وترد تعامل الكلاب CXMD. تم علاج الكلاب إما مع 1.2 ملغ Ex6A وحدها أو 1.2 ملغ كوكتيل. يتم تكييفها الصور بإذن من يوكوتا وآخرون. (حقوق الطبع والنشر 2009، جون وايلي وأولاده) 40. بار = 100 ميكرون. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 10
الرقم 10. زيادة الدستروفين التعبير بعد كوكتيل الجهازية Morpholino العلاج في CXMD الكلاب. الدستروفين (DYS-1) استخدم تلطيخ لمقارنة التعبير الدستروفين في البرية من نوع (WT) (مراقبة إيجابية)، غير المعالجة (NT) (المراقبة السلبية)، والكلاب CXMD تعامل مع 120 ملغ / كغ morpholino كوكتيل (40 ملغ / كغ من كل AON). كوكتيل morpholino يرد Ex6A، Ex6B، وEx8A. تم حقن الكلاب عن طريق الوريد 5 مرات نحنekly مع هذا الكوكتيل. أ) مقارنة التعبير الدستروفين في عظام الساق الجمجمة (CT) عضلات WT، NT، والكلاب المعالجة. B) مقارنة التعبير الدستروفين في أنسجة القلب بين NT وmorpholino الكلاب المعالجة كوكتيل. ويرد C) طخة مناعية لالدستروفين مع desmin كما تحكم التحميل لWT، NT، وmorpholino الكلاب المعالجة كوكتيل. وتظهر عضلات التالية للكلاب المعالجة: ثلاثية الرؤوس العضدية (السل)، العضلة ذات الرأسين العضدية (BB)، والحجاب الحاجز (DIA)، المريء (ESO)، CT، المقرب (ADD)، باسطة إبهام اليد (مؤسسة كهرباء لبنان)، الماضغة (MAS)، والقلب. يتم تكييفها الصور بإذن من يوكوتا وآخرون. (حقوق الطبع والنشر 2009، جون وايلي وأولاده) 40. بار = 200 ميكرون. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 11
الشكل11. تحسين التشريح المرضي في CXMD الكلاب المعالجة لمدة 7 أسابيع مع 240 ملغ / كغ Morpholino كوكتيل. تم حقن الكلاب CXMD تتراوح بين عام ونصف العام لمدة خمس سنوات عن طريق الوريد مع 240 ملغ / كغ morpholino كوكتيل (Ex6A، Ex6B، وEx8A) مرة واحدة في الأسبوع لمدة 7 أسابيع. بعد أربعة عشر يوما من الحقن الماضي، اتخذت عضلات المريء وفعل الهيماتوكسيلين ويوزين (سعادة) تلطيخ. سعادة تلطيخ للعضلات المريء من غير المعالجة (NT) وmorpholino (المعالجة) الكلاب CXMD تعامل كوكتيل (40X عدسة الهدف). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 12
وتمت مقارنة الرقم 12. عشرات تحسين على الدرجات السريرية و 15 مترا مدة العرض بعد الكلاب تعامل Morpholino-Morpholino العلاج. إلى غير المعاملة (NT) littermateالصورة. أشرطة الخطأ في الرسم البياني تشير SEM. أ) تم حساب مجموع النقاط في امتحان التصنيف السريري قبل وبعد العلاج وتمت مقارنة الحيوانات تعامل مع تتزاحم NT. ب) مقارنة بين 15 مترا مرات تشغيل الكلاب المعالجة وNT. C) على غرار باء؛ ومع ذلك، تم استخدام الكلاب الأصغر سنا. يتم تكييفها الصور بإذن من يوكوتا وآخرون. (حقوق الطبع والنشر 2009، جون وايلي وأولاده) 40. يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

العقاقير قليل النوكليوتيد النوكليوتيدات تسلسل
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

الجدول 1. قليل النوكليوتيد العقاقير التصميم.

Discussion

اكسون تخطي هي تقنية علاجية واعدة لعلاج DMD. على حد سواء في التجارب المختبرية والتجارب المجراة أظهرت أن تعدد اكسون تخطي ممكنا. هنا، وتناقش استخدام نموذج الكلب CXMD. أولا، تم تصميم AONs باستخدام-جنوب شرقي الإنقاذ البرامج وESEfinder لاستهداف الإكسونات الدستروفين 6 - 8. تم استخدام الكيمياء 2'OMePS AON لCXMD ترنسفكأيشن بالخلايا العضلية الجذعية واختير العمود الفقري الكيمياء morpholino AON للتجارب في الجسم الحي. vPMOs هي أكثر كفاءة من أبطأ قليلا معدلة ولكن نظرا لسمية أعلى من أنها ليست مناسبة لحقن النظامية. أجريت استخراج الحمض النووي الريبي، RT-PCR، وتسلسل [كدنا على myoblasts CXMD. كانت الكلاب حقن مع كوكتيل PMO متدرج سريريا لتقييم التحسن في الأعراض السريرية. بعد الكلاب والموت الرحيم إنسانية، وتم أخذ عينات العضلات وتتوق إلى البرد باجتزاء. نصف العمر للبروتين الدستروفين الناجم عن وويعتقد مكتب الإحصاءات الوطنية إلى أن ما يقرب من 1-2 أشهر. واستخدمت الكلاب الشباب البالغين في هذه الدراسة، على الرغم من أن هذه التجارب يمكن القيام به مع الكلاب حديثي الولادة وكبار السن من الكلاب (> 5 سنوات من العمر). استخدمت أقسام العضلات مستعدة لتقييم التشريح المرضي وتقييم الإنقاذ بروتين الدستروفين من خلال النشاف الغربي والمناعية 48.

من المهم للتأكد من أن حجم محلول PMO هو الصحيح قبل الحقن. والفشل في القيام بذلك لها آثار كبيرة على النتائج. خلال الحقن في العضل، مطلوب ما يكفي من الضغط لإدخال الألياف العضلية. رصد صحة الكلب والتفتيش للموقع الجراحة مهمة لاستكشاف الأخطاء وإصلاحها. لمراقبة صحة الحيوان، ويجب أن يتم تنفيذ اختبارات الدم الأسبوعية وزنها. بعد euthanization للحيوان وإعداد عينات العضلات، خطوة حاسمة لضمان حساسية في الكشف عن بروتين الدستروفين هو استخدام كل من هلام تريس، خلات وطريقة النشاف شبه الجافةأثناء إجراء النشاف الغربي.

كما هو مبين في نتائج تمثيلية، myoblasts تعامل مع Ex6A، Ex6B، Ex8A، وكوكتيل (التي تحتوي على Ex6A، Ex6B، Ex8A، وEx8B) المنتجة في الإطار منتجات DMD. منذ Ex8B لم تسفر عن منتجات اكسون تخطي، لم يستخدم في اللاحقة في التجارب المجراة. أظهر كدنا] تسلسل أن الإكسونات 6-9 تخطي حدث ومناعية مع DYS-2 تلطيخ أظهرت استعادة تعبير الدستروفين في عينات المعالجة. وأظهرت الكلاب تعامل AON-زيادة كبيرة في الألياف الدستروفين إيجابي. هذا يدل على أن الإكسونات 6-8 ويجري تخطي وتم إنتاج بروتين تقصير. زيادة كمية الألياف الدستروفين إيجابي عندما تم استخدام مزيج من AONs وكان يتناسب مع AON الجرعة. Immunoblots أظهرت زيادة التعبير الدستروفين في الكلاب المعالجة morpholino النظامية. كان الهيكل العظمي والعضلات مستويات مختلفة من الألياف الدستروفين. ومع ذلك، المعالجة morpholino أنسجة القلب أظهرت قليلاتحسن في التعبير الدستروفين. منذ الدستروفين له وزن جزيئي عال (427 كيلو دالتون)، والكشف عن كميات قليلة من الدستروفين يمكن أن يكون صعبا. للحصول على أفضل النتائج، واستخدمت هلام تريس، خلات وطريقة نقل شبه الجافة. سعادة تلطيخ أظهرت تحسن التشريح المرضي في الكلاب المعالجة morpholino. الألياف الأنوية مركزيا (CNFs) هي علامة على العضلات صحية وتمثل دورات من ضمور العضلات وتجديد. وأظهرت تعامل Morpholino الكلاب CXMD انخفاضا في نسبة CNFs بالمقارنة مع الكلاب CXMD غير المعالجة. وكشف الدرجات السريرية تحسنا في الأعراض، مثل زيادة المشي والقدرة على التوالي، في معاملة الحيوانات morpholino. ويعتقد أن صلابة العضلات لتعكس ضمور العضلات، وبالتالي، تم تضمينه في نظام الدرجات 59. تم تقييم صلابة من الفخذ (هند الأطراف الاصطناعية) العضلات. ومع ذلك، فقد استبعدنا العضلات سارتوريوس الجمجمة لأنها تميل إلى إظهار تضخم بدلا من ضمور في CXMD. تظهر الكلاب تعاملإد انخفاض درجات التصنيف، وكان أسرع الأوقات في اختبار تشغيل 15 م. تحسين مرات على اختبار 15 م تدل على تحسين وظيفة العضلات 40. وتشير ارتفاع معدلات الدرجات الإجمالية سوء الحالة الصحية وزيادة ضمور العضلات.

في حين أن هذه النتائج واعدة ومتعددة اكسون تخطي لا يزال يعرض العديد من التحديات التي سوف تحتاج إلى التغلب عليها قبل أن التقنية تطبيق السريرية. نسيج القلب لا يزال يعرض انخفاض الإقبال على AONs، على الأرجح بسبب الفرق في الاتجار الخلوي بين أنسجة القلب والهيكل العظمي. وقد لوحظ عدم وجود آثار سامة في الحيوانات تحت نظم الجرعة الحالية. ومع ذلك، هناك المزيد من العمل الذي يتعين القيام به لتقييم السمية طويلة الأجل قبل استخدام المولوتوف AON يمكن أن تتحرك إلى التجارب السريرية. ومن الصعب الحصول على موافقة للأدوية كوكتيل AON لأن الهيئات التنظيمية تحدد كل تسلسل AON كدواء فريدة من نوعها. وهذا يعني أن كل تسلسل في كوكتيل سوف تحتاج لفحصها بشكل فردي لسافيتذ، الأمر الذي يتطلب المزيد من الوقت والمزيد من المال. حاجز آخر لاستخدام تخطي متعددة اكسون في عملية إعداد سريرية كمية كبيرة من منتجات البروتين وسيطة أنتجت مع وظائف غير معروفة. هذه البروتينات يمكن أن تؤدي إلى لا يمكن التنبؤ بها آثار جانبية، اعتمادا على طفرة الفردية 22. بالإضافة إلى ذلك، أنماط الطفرات المتاحة ضمن نماذج الكلب التصنع الحالية محدودة. هناك عدد قليل من الطفرات التي تحدث بشكل طبيعي، وليس كل الطفرات مفيدة لدراسة متعددة اكسون الطفر. نموذج خنزير التصنع وعود ليكون بديلا جيدا للمستقبل DMD اكسون تخطي الدراسات 33 و 34.

نماذج الكلب DMD لها بعض المزايا على نماذج DMD أخرى. كونها أكبر نموذج حيواني، والتصنيف السريري والتصوير بالرنين المغناطيسي ممكنة، والسماح لتحليل أكثر تفصيلا. منذ الكلاب هي الحيوانات الكبيرة بل هي أيضا أكثر ملاءمة للدراسات علم السموم وتمثل أكثر عن كثب الأمراض التي تصيب البشر بالمقارنة مع نموذج الفأر. كلب ميكون odels أيضا نائب العضو المنتدب للتسلسل الجينات التي هي أكثر مماثلة على البشر 23، 34، 45.

وعلى الرغم من صعوبة من الناحية الفنية، يمكن للنهج تخطي متعددة اكسون تستفيد في النهاية> 90٪ من المرضى DMD 24. وهذا يجعل من بديل أفضل بكثير لتخطي-اكسون واحد، كما هو واكسون واحد الطفر لا ينطبق إلا على مجموعة فرعية صغيرة من المرضى. وبالإضافة إلى ذلك، سوف متعددة اكسون تخطي تمكننا من تحديد أنماط الحذف التي تعمل على تحسين وظائف بروتينات الدستروفين تقصير. على سبيل المثال، حذف DMD الإكسونات 45-55 يرتبط بأعراض خفيفة بشكل استثنائي أو الأفراد غير متناظرة 14،19،60-63. وقد تم بالفعل أظهرت 55 في نموذج الفأر من DMD مع حذف اكسون 52 (mdx52) باستخدام الحقن النظامية من vPMOs 22،26 - لتخطي متعددة اكسون الإكسونات 45. ومع ذلك، أثبتت استخدام vPMOs كوكتيل في أشكال أخرى من الضمور العضلي، مثلكما فوكوياما ضمور العضلات الخلقي (FCMD). ويتسبب FCMD من محاصرة اكسون، الذي هو سبب الشاذة الربط مرنا من قبل الإدراج retrotransposon. وقد ثبت vPMOs لانقاذ نمط الربط في كل نموذج الفأر FCMD وفي خطوط الخلايا البشرية 64. ان الجيل القادم من AON كيمياء واظهار أعلى كفاءة وأقل سمية تسهيل الترجمة الفعلية لنهج تخطي متعددة اكسون في التطبيق السريري. بالإضافة إلى ذلك، من المحتمل أن يطبق تخطي متعددة اكسون إلى اضطرابات وراثية أخرى، مثل dysferlinopathies 24، 65.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
متعددة اكسون تخطي عن طريق أليغنوكليوتيد] كوكتيل العقاقير في ضمور العضلات المرتبطة X الناب
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter