Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

मल्टी एक्सॉन कुत्ते एक्स से जुड़े पेशी Dystrophy में कॉकटेल antisense oligonucleotides का प्रयोग लंघन

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

एक्सॉन लंघन वर्तमान में Duchenne पेशी dystrophy (डीएमडी) के लिए एक सबसे होनहार चिकित्सीय विकल्प है। डीएमडी रोगियों के लिए प्रयोज्यता का विस्तार करने के लिए और जिसके परिणामस्वरूप छोटा dystrophin प्रोटीन की स्थिरता / समारोह अनुकूलन करने के लिए, एक बहु-एक्सॉन कॉकटेल antisense oligonucleotides का उपयोग कर दृष्टिकोण लंघन विकसित किया गया था और हम एक कुत्ते के मॉडल में प्रणालीगत dystrophin बचाव का प्रदर्शन किया।

Abstract

Duchenne पेशी dystrophy (डीएमडी) सबसे आम घातक आनुवांशिक रोगों दुनिया भर में, dystrophin (डीएमडी) जीन में उत्परिवर्तन के कारण होता में से एक है। एक्सॉन लंघन कम डीएनए / आरएनए-तरह के अणुओं antisense oligonucleotides (AONs) कहा जाता है कि पढ़ने के फ्रेम को बहाल करने और छोटी लेकिन कार्यात्मक प्रोटीन का उत्पादन कार्यरत हैं। सीमित प्रयोज्यता (रोगियों के लिए एक एकल AON दवा के साथ इलाज किया जा सकता का केवल 13% अप करने के लिए), और छोटा प्रोटीन का अनिश्चित समारोह: हालांकि, एक्सॉन लंघन चिकित्सा दो प्रमुख बाधाओं का सामना। इन मुद्दों को एक कॉकटेल AON दृष्टिकोण के साथ संबोधित कर रहे थे। डीएमडी रोगियों के लगभग 70% एकल एक्सॉन लंघन द्वारा इलाज किया जा सकता है (सभी संयुक्त एक्सॉनों), एक संभावित डीएमडी रोगियों के 90% से अधिक का इलाज कर सकता है, तो कई कॉकटेल antisense दवाओं का उपयोग लंघन एक्सॉन महसूस किया जा सकता है। कुत्ते एक्स से जुड़े पेशी dystrophy (CXMD) कुत्ता मॉडल, जिसका phenotype अधिक मानव डीएमडी रोगियों के समान है, प्रणालीगत effic परीक्षण करने के लिए इस्तेमाल किया गया थाacy और एक्सॉनों 6 और 8. CXMD कुत्ते मॉडल की बहु एक्सॉन लंघन की सुरक्षा Intron 6 में एक ब्याह साइट उत्परिवर्तन बंदरगाहों, dystrophin mRNA में एक्सॉन 7 की कमी के लिए अग्रणी। CXMD में पढ़ने फ्रेम बहाल करने के लिए एक्सॉनों 6 और 8 के बहु-एक्सॉन लंघन की आवश्यकता है, इसलिए, CXMD प्रभावकारिता और बहु-एक्सॉन लंघन की सुरक्षा के परीक्षण के लिए एक अच्छा मध्यम आकार के पशु मॉडल है। वर्तमान अध्ययन में, लक्षित कर एक्सॉन 6 और एक्सॉन 8 antisense morpholinos के एक कॉकटेल तैयार किया गया था और यह शरीर चौड़ा कंकाल की मांसपेशियों में dystrophin अभिव्यक्ति बहाल। कॉकटेल ओलिगोस के अभिकर्मक / इंजेक्शन और प्रभावकारिता और CXMD कुत्ते मॉडल में बहु-एक्सॉन लंघन की सुरक्षा के मूल्यांकन के लिए तरीके प्रस्तुत कर रहे हैं।

Introduction

Duchenne पेशी dystrophy (डीएमडी) एक एक्स-लिंक्ड हटने पेशी प्रगतिशील मांसपेशियों में कमजोरी की विशेषता रोग, पहले डॉ Guillaume-बेंजामिन-Amand Duchenne (डी Boulogne) 1 द्वारा वर्णित है। डीएमडी एक आम आनुवंशिक बारे में 1 3,500 में लड़कों को प्रभावित कर दुनिया भर में, लगभग 20,000 प्रभावित प्रत्येक साल 2,3 पैदा हुए बच्चों के साथ बीमारी है। मोटर विकास देरी हो रही है और चाल गड़बड़ी बचपन 4 में देखा जाता है, जल्दी किशोर के बारे में व्हीलचेयर पर निर्भरता द्वारा पीछा किया। मौत को आम तौर पर सांस या हृदय की विफलता 5-8 के कारण 20 और 30 की उम्र के बीच होता है। वर्तमान में डीएमडी के लिए कोई इलाज नहीं है। Glucocorticoids के साथ उपचार कुछ हद तक मांसपेशी अध: पतन की प्रगति को धीमा कर सकते हैं लेकिन मोटापे और मधुमेह हो सकता 2,7,8 सहित महत्वपूर्ण दुष्प्रभाव, के साथ जुड़ा हुआ है। डीएमडी dystrophin (डीएमडी) जीन में उत्परिवर्तन का परिणाम है, कार्यात्मक dystrophin protei का एक नुकसान के लिए अग्रणीएन। डीएमडी 2 लाख से अधिक आधार जोड़े और 79 एक्सॉनों 9,10 के साथ एक बहुत बड़ी जीन है। विलोपन, बकवास है, और दोहराव म्यूटेशन के बाहर के फ्रेम म्यूटेशन के लिए अग्रणी डीएमडी phenotype का सबसे आम कारण हैं। 9 और एक्सॉनों 45 - - एक्सॉनों 3 के क्षेत्रों 55 "उत्परिवर्तन के आकर्षण के केंद्र 'कहा जाता है के रूप में सबसे अधिक रोगियों जीन के इन भागों के भीतर विलोपन म्यूटेशन है, डीएमडी रोगियों 3,9,11-16 में गैर कार्यात्मक dystrophin के लिए अग्रणी। dystrophin-ग्लाइकोप्रोटीन जटिल (क्लब), जो मांसपेशियों की झिल्ली स्थिरीकरण में एक प्रमुख भूमिका है के भीतर dystrophin कार्य करता है। जबकि केंद्रीय रॉड डोमेन एक कम महत्वपूर्ण भूमिका निभाता है 3,9,17 एन और सी-Termini, समारोह के लिए सबसे महत्वपूर्ण डोमेन हैं। एक हल्के बेकर पेशी dystrophy (बीएमडी), जो ज्यादातर डीएमडी जीन के भीतर में फ्रेम म्यूटेशन से परिणामों के साथ जुड़े phenotype के पालन, एक्सॉन डीएमडी के इलाज के लिए लंघन के आवेदन को प्रेरित किया। बीएमडी रोगियों को एक छोटा कर दिया है, लेकिन कार्यात्मकएल, dystrophin प्रोटीन है कि दोनों Termini 3,6,18 बनाए रखता है। एक्सॉन लंघन, सिद्धांत में, पढ़ने फ्रेम बहाल कर सकते हैं, छोटा है लेकिन कार्यात्मक dystrophin बीएमडी 3,19 में देखा उन लोगों के लिए इसी तरह के प्रोटीन में जिसके परिणामस्वरूप।

antisense oligonucleotides (AONs) के कई प्रकार 2'O-methylated phosphorothioates (2'OMePS) और phosphorodiamidate morpholino oligomers (PMOS) सहित क्लिनिकल परीक्षण में परीक्षण किया गया है। लंघन एक्सॉनों 51 और 53 इन AONs का उपयोग कर जांच की गई है और जब तक परिणाम आशाजनक हैं, एकल एक्सॉन लंघन प्रयोज्यता सीमित है, के रूप में यह उत्परिवर्तन विशेष 3, 19, 20,21, 22-26 है। सवाल यह भी एकल एक्सॉन लंघन 22,23 से उत्पादित जिसके परिणामस्वरूप छोटा dystrophin प्रोटीन की स्थिरता के बारे में रहते हैं। साथ ही, कुछ रोगियों की आवश्यकता होती है एक भी एक्सॉन की तुलना में अधिक आदेश पढ़ने फ्रेम 3 बहाल करने के लिए छोड़ दिया जाना चाहिए। जबकि तकनीकी रूप से अधिक कठिन है, बहु-एक्सॉन लंघन एक तरीका है किइन समस्याओं के समाधान के 3,19 सकता है। मल्टी एक्सॉन लंघन पहले dystrophic कुत्ते और इन विट्रो में मानव कोशिका लाइनों में प्रदर्शन किया गया है। इसके अतिरिक्त, mdx52 माउस और कुत्ते एक्स से जुड़े पेशी dystrophy (CXMD) कुत्ता मॉडल में विवो के लिए इस्तेमाल किया गया है अध्ययन 22, 24-27। कुत्ते एक्स से जुड़े पेशी dystrophy जापान (CXMD जे) बीगल यहां इस्तेमाल किया गया था, के रूप में CXMD जम्मू के पढ़ने फ्रेम एक्सॉनों 6 और 8, या अतिरिक्त एक्सॉनों (जैसे, एक्सॉनों 3 - 9) के बहु-एक्सॉन लंघन द्वारा बहाल किया जा सकता है (चित्रा 1)। बीगल आधारित CXMD गोल्डन कुत्ता पेशी dystrophy (GRMD) मॉडल के रूप में एक ही पैटर्न उत्परिवर्तन के शेयरों, लेकिन बीगल इस प्रकार डीएमडी 28,29 के लिए एक उपयोगी मॉडल उपलब्ध कराने के लिए अपने शरीर को आकार की वजह से छोटे और सस्ता बनाए रखने के लिए कर रहे हैं। CXMD कुत्तों और अधिक बारीकी से, छोटे पशु मॉडलों की तुलना में मानव डीएमडी phenotype नकल कृंतक की तरह है, और विषाक्तता आकलन 3,22,30,31 के लिए और अधिक विश्वसनीय हैं (चित्रा 2)। CXMD कुत्तों प्रगतिशील मांसपेशी क्षय, चाल गड़बड़ी, और हृदय और सांस की समस्याओं डीएमडी में देखा उन लोगों के लिए समान प्रदर्शित करते हैं। एकल एक्सॉन लंघन के साथ तुलना में, बहु-एक्सॉन लंघन रोगियों के लिए एक बहुत बड़ा अनुपात के लिए लागू है। तीन सबसे आम प्रकार उत्परिवर्तन (विलोपन, बकवास है, और दोहराव) के बीच, 80 - रोगियों के 98% बहु एक्सॉन लंघन 14,32,33 के माध्यम से, जबकि सभी डीएमडी रोगियों के 45% फायदा हो सकता है विशेष रूप से लंघन एक्सॉनों 45 से इलाज किया जा सकता - 55 3,19,22,34।

संशोधित morpholinos के विकास के साथ, एक्सॉन लंघन को सुविधाजनक बनाने पर AON कॉकटेल की दक्षता में सुधार हुआ है। Arginine अमीर सेल मर्मज्ञ पेप्टाइड संयुग्मित PMOS (PPMOs), और इन विवो-morpholinos (vPMOs) AON chemistries उल्लेखनीय है कि सेल मर्मज्ञ क्षमता और स्थिरता में सुधार हुआ है 3,35-38 हैं। चिंताएं लंबे समय तक AON विषाक्तता के बारे में रहते हैं; हालांकि, महत्वपूर्ण प्रगतितैयार किया गया है। रासायनिक संशोधनों morpholinos के लिए किए गए बहुत बंद लक्ष्य प्रभाव कम होती है और पूर्व नैदानिक ​​अध्ययन कोई महत्वपूर्ण विषाक्त प्रभाव 3,22,39,40 की सूचना है। बहु-एक्सॉन लंघन के लिए एक शेष चुनौती प्रत्येक एकल AON के लिए वर्तमान की आवश्यकता है, एक ही दवा के रूप में अकेले विषाक्तता के लिए परीक्षण किया जा सकता है, बजाय एक साथ एक कॉकटेल 3,19,22,41,42 के रूप में है। दोनों एकल और बहु-एक्सॉन को शामिल करने का लक्ष्य दिल लंघन डीएमडी अध्ययन में, वहाँ dystrophic हृदय के ऊतकों में थोड़ा सुधार हुआ है। दिल में morpholinos की प्रभावकारिता क्योंकि गरीब सेल मर्मज्ञ क्षमता के कम होने लगा है। पेप्टाइड संयुग्मित PPMOs AONs हृदय कोशिकाओं घुसना करने की क्षमता में सुधार हुआ है, दिल 3,19,38 में बचाया कार्यात्मक dystrophin प्रोटीन की मात्रा बढ़ रही है।

इधर, हमारे AON कॉकटेल दृष्टिकोण विस्तार से चर्चा की है, ESEfinder सॉफ्टवेयर का उपयोग कर 43 AON दृश्यों का डिजाइन भी शामिल है। Protocबहु-एक्सॉन लंघन के साथ कुत्ते के प्रयोगों के लिए OLS भी वर्णित हैं। CXMD जम्मू बीगल एक्सॉनों 6 और 8 लंघन प्रयोगों के लिए इस्तेमाल किया गया। मल्टी एक्सॉन CXMD कुत्ते मॉडल में लंघन आशाजनक परिणाम से पता चलता है, लेकिन चुनौतियां भी हैं इससे पहले कि वे चिकित्सकीय लागू कर रहे हैं कि जरूरत को दूर किया जा सके।

Protocol

नीचे सूचीबद्ध सभी प्रोटोकॉल जानवरों की देखभाल के दिशा निर्देशों जापान में तंत्रिका विज्ञान के राष्ट्रीय केन्द्र और मनोरोग (NCNP) द्वारा उल्लिखित के अनुसार हैं। सभी प्रयोगों NCNP के संस्थागत पशु की देखभाल और उपयोग समिति द्वारा अनुमोदित किया गया।

1. Antisense ओलिगोस का डिजाइन

  1. छात्र अध्ययन साइटों 44 पता लगाने के लिए 45-47 बचाव ese और ESEfinder कार्यक्रमों का प्रयोग करें।
  2. कि एक्सॉनों कि लक्षित किया जा रहे हैं करने के लिए antisense हैं डिजाइन 25 आधार जोड़ी (बीपी) दृश्यों। लक्ष्य एक्सॉनों 6 और कुत्ते के मॉडल में 8 (चित्रा 1)।
    1. 30 PMOS के लिए बीपी दृश्यों (तालिका 1) या 2'OMePS के लिए 25 बीपी - 25 का प्रयोग करें। 25 बीपी दृश्यों को डिजाइन करने के लिए, दृश्यों कि लक्ष्य क्षेत्र के भीतर हैं का चयन करें। स्थिर दृश्यों 43 बनाने के लिए माध्यमिक संरचना, heterodimers का परिहार, एक्सॉन splicing बढ़ाने रूपांकनों, और जीसी सामग्री पर विचार करें। के रूप में उपर्युक्त sof द्वारा की पहचान AONs छात्र अध्ययन साइटों की कम से कम एक लक्ष्य होना चाहिएtware।
    2. एक जीसी सामग्री है कि कम से कम 65% से कम 4 लगातार 'जी, और शामिल नहीं है आत्म पूरक दृश्यों के साथ, साथ AONs का चयन करें। एन सी बी आई ब्लास्ट सॉफ्टवेयर का प्रयोग बंद लक्ष्य annealing साइटों 22,48,49 भविष्यवाणी करने के लिए।
  3. एक उचित AON रीढ़ रसायन विज्ञान का चयन करें। इन विट्रो प्रयोगों के लिए 2'O मिथाइल ओलईगोन्युक्लियोटाईड्स (2'OMePS) या morpholinos का उपयोग करें। इन विवो प्रयोगों के लिए, 2'OMePS, morpholinos या vPMOs का उपयोग करें। 3,19,48,50

2. इन विट्रो प्रयोगों में (एक्सॉनों 6 और 8 CXMD मॉडल में लंघन)

  1. कुत्ता myoblasts की 2'OMePS अभिकर्मक
    1. 6 अच्छी तरह प्लेटों में मध्यम विकास के 3 मिलीलीटर में संस्कृति CXMD myoblasts। बीज 1 - 5 एक्स 10 3 कोशिकाओं / 2 सेमी 0.5 के साथ मिलीग्राम / myoblasts के लिए के माध्यम से 2 सेमी। मध्यम विकास के लिए, 10% भ्रूण गोजातीय सीरम (FBS) और 1% के साथ Dulbecco संशोधित ईगल मध्यम (DMEM) का उपयोग करेंपेनिसिलिन / स्ट्रेप्टोमाइसिन (पी / एस) 40।
    2. 80% मिला हुआ - 37 डिग्री सेल्सियस तक 60 पर सेते हैं। यह लगभग 12 से 24 मानव संसाधन लेता है।
    3. (: 1 के अनुपात Transfecting एजेंट: AONs, जैसे, बनाम lipofectin 10 μl 5 माइक्रोग्राम AONs 2) कम सीरम माध्यम में 100 μl की कुल करने के लिए एक cationic liposome Transfecting एजेंट पतला। 45 मिनट - मिश्रण 30 के लिए आरटी पर खड़ा करने के लिए अनुमति दें।
    4. कम हो सीरम माध्यम में 100 μl के अंतिम मात्रा को AONs (2'OMePS या morpholinos) पतला।
    5. पतला AONs से पतला परासंक्रमित एजेंट का मिश्रण है और 10 के लिए आरटी पर सेते - 15 मिनट।
    6. अभिकर्मक एजेंट / AON मिश्रण आरटी पर बैठा है, वहीं आकांक्षा के माध्यम से कोशिकाओं से पुराने मीडिया को हटाने और मीडिया के साथ कोशिकाओं को धो लें।
    7. अभिकर्मक एजेंट / AON मिश्रण करने के लिए 0.8 मिलीलीटर मीडिया जोड़ें और उसके बाद हौसले से धोया कोशिकाओं को पूरी समाधान जोड़ें। 37 डिग्री सेल्सियस पर 3 घंटे के लिए सेते हैं।
    8. incubating के बाद, differentiat साथ मीडिया की जगहआयन मीडिया (डीएम); भेदभाव 10 दिनों तक का समय लग सकता है। देखने के लिए आसपास दिन 3. भेदभाव मीडिया पर शुरू है कि क्या भेदभाव हुआ है की जाँच 2% घोड़े सीरम के साथ DMEM, 200 यू / एमएल पेनिसिलिन, 200 मिलीग्राम / मिलीलीटर स्ट्रेप्टोमाइसिन, और 10 माइक्रोग्राम / एमएल इंसुलिन है।
  2. कुत्ता myoblasts की morpholino अभिकर्मक
    1. संस्कृति CXMD 2.1 चरण में वर्णित के रूप में मध्यम विकास में myoblasts।
    2. भेदभाव मध्यम (डीएम) के लिए स्विच, और प्रत्येक अच्छी तरह से करने के लिए 0.1 मिमी स्टॉक morpholino जोड़ने के अंतिम एकाग्रता 1 माइक्रोन बनाने के लिए। अभिकर्मक या इंजेक्शन से पहले 10 मिनट के लिए 65 डिग्री सेल्सियस पर गर्मी कॉकटेल morpholinos AON एकत्रीकरण से बचने के लिए। एक पेप्टाइड वितरण अभिकर्मक 39,51 जोड़ें और 3 के अंतिम एकाग्रता को समायोजित - 6 माइक्रोन।
    3. 16 के बाद - ऊष्मायन के 48 घंटा, शाही सेना निकासी के लिए कोशिकाओं को इकट्ठा। कोशिकाओं के लिए 1 मिलीलीटर एसिड guanidinium thiocyanate फिनोल के क्लोरोफॉर्म जोड़े थाली से कोशिकाओं को अलग करने के लिए। आरएनए extrac प्रदर्शन करनाइस कदम के बाद tion।
      1. वैकल्पिक रूप से, trypsin जोड़ने इतना है कि यह सभी कोशिकाओं को शामिल किया गया है और 37 डिग्री सेल्सियस पर 2 मिनट के लिए सेते हैं।
        नोट: यदि, immunochemistry प्रदर्शन संवर्धन के लिए संभाग स्लाइड चश्मे का उपयोग करने के लिए इच्छुक है। भेदभाव के बाद, कोशिकाओं paraformaldehyde (पीएफए) (10 मिनट के लिए 4%) का उपयोग कर तय किया जा सकता है।
  3. शाही सेना निकालना और रिवर्स प्रतिलेखन पोलीमरेज़ चेन रिएक्शन (आरटी पीसीआर)
    1. एक बार कोशिकाओं myotubes में भेदभाव कर रहे हैं, मध्यम हटाने और 1 मिलीलीटर एसिड guanidinium thiocyanate फिनोल के क्लोरोफॉर्म जोड़ने; आरटी पर 10 मिनट के लिए सेते हैं।
    2. 1.5 मिलीलीटर ट्यूबों के लिए स्थानांतरण। 200 μl क्लोरोफॉर्म के साथ जुडा है और 2 मिनट के लिए आरटी पर सेते तीन अलग-अलग परतों में देखा जा सकता है जब तक। ऊपर से नीचे तक तीन परतें हैं: एक शाही सेना परत, एक डीएनए परत, और एक प्रोटीन की परत।
    3. 4 डिग्री सेल्सियस पर 15 मिनट के लिए 12,000 × छ अपकेंद्रित्र। 500 & # के साथ शीर्ष परत सतह पर तैरनेवाला और एक ट्यूब में जगह निकालें181, एल isopropanol (यहाँ रोक है, -80 डिग्री सेल्सियस पर सतह पर तैरनेवाला स्टोर)। अपकेंद्रित्र 4 डिग्री सेल्सियस पर 10 मिनट के लिए 12,000 × छ सतह पर तैरनेवाला; centrifuging के बाद, जिसके परिणामस्वरूप शाही सेना गोली रखने के लिए और सतह पर तैरनेवाला त्यागें।
    4. 4 डिग्री सेल्सियस पर 5 मिनट के लिए 8000 XG पर इथेनॉल और सेंट्रीफ्यूज के साथ गोली धो लें। 15 मिनट के लिए inverting ट्यूब द्वारा अवशिष्ट इथेनॉल लुप्त हो जाना और फिर 15 जोड़ - RNase मुक्त पानी के 30 μl। 260 एनएम पर अमेरिका / विज़ स्पेक्ट्रोस्कोपी का उपयोग कर कुल शाही सेना एकाग्रता यों।
    5. एक आरटी पीसीआर प्रतिक्रिया के लिए आवश्यक अभिकर्मकों गठबंधन: 1.5 μl 10 माइक्रोन के आगे प्राइमर, 1.5 μl 10 माइक्रोन रिवर्स प्राइमर, 1 μl dNTP, 5 μl एक कदम पीसीआर किट बफर, 0.7 μl RNase अवरोध, 1 μl एंजाइम मिश्रण से एक- पीसीआर किट, और शाही सेना के 200 एनजी कदम। एक बार इन मिलाया गया है, 25 μl के अंतिम मात्रा के लिए पानी जोड़ने।
    6. एक थर्मामीटरों cycler में मिश्रण रखें। 50 डिग्री सेल्सियस, एक 15 मिनट पर एक 30 मिनट के चक्र चलाने के लिए0; 95 डिग्री सेल्सियस पर चक्र, तो 1 मिनट के लिए 94 डिग्री सेल्सियस के 35 चक्र, 1 मिनट के लिए 60 डिग्री सेल्सियस, और 1 मिनट के लिए 72 डिग्री सेल्सियस। अन्त में, 72 डिग्री सेल्सियस पर एक 10 मिनट के चक्र चलाते हैं। 4 डिग्री सेल्सियस या -20 डिग्री सेल्सियस पर एक फ्रिज में स्टोर पीसीआर उत्पाद
  4. पूरक डीएनए (सीडीएनए) अनुक्रमण
    1. agarose जेल वैद्युतकणसंचलन का उपयोग 9 को छोड़ दिया बैंड - एक्सॉन 6 पहचानें। लोड 20 मिनट के लिए एक 1.5% agarose जेल के कुओं में प्रत्येक नमूने के 5 μl, 5 मिनट के लिए जेल के माध्यम से 135 वी चलाने के लिए, और फिर 120 वी। इसके बाद, 30 मिनट के लिए आरटी पर डीएनए जेल दाग में जेल सेते हैं। इमेजिंग सॉफ्टवेयर का उपयोग बैंड कल्पना।
    2. एक जेल निकासी किट का उपयोग ब्याज की बैंड आबकारी।
      1. डीएनए टुकड़ा आबकारी एवं 200 μl एनटीआई / 100 मिलीग्राम जेल का उपयोग कर जेल टुकड़ा solubilize। इस 5 से 10 मिनट के लिए बैठते हैं एक 50 डिग्री सेल्सियस पानी के स्नान में चलो। तब झिल्ली ट्यूब सिलिका के लिए स्थानांतरण।
      2. 30 सेकंड के लिए 11,000 XG पर अपकेंद्रित्र। सीई से पहले 700 μl NT3 बफर साथ दो बार धोने30 सेकंड के लिए 11,000 XG पर फिर से ntrifuging।
      3. 1 मिनट के लिए 11,000 XG पर centrifuging द्वारा सिलिका झिल्ली सूखी।
      4. 30 μl NE बफर और यह 1 मिनट के लिए आरटी पर बैठने की अनुमति - 15 जोड़ें। फिर, 1 मिनट के लिए 11,000 XG पर अपकेंद्रित्र। सिलिका जेल निकालें और ट्यूब में सामग्री रखने के लिए।
    3. निर्माता प्रोटोकॉल के अनुसार अनुक्रम का निर्धारण करने के लिए एक अनुक्रमण किट का प्रयोग करें।

3. इंट्रामस्क्युलर इंजेक्शन या ओपन मांसपेशी बायोप्सी

  1. अस्तित्व सर्जरी के दौरान बाँझ शर्तों के रखरखाव के लिए, सर्जरी साइट (हिंद अंग) के आसपास के क्षेत्र में क़ैंची का उपयोग बालों को हटा दें। एक कीटाणुनाशक के रूप में iodophors या chlorohexidine का प्रयोग करें। रखने और उन्हें पूरे पशु और ऑपरेटिंग टेबल पर हासिल करके शल्य साइट के लिए बाँझ पर्दे का प्रयोग करें।
    1. ऑपरेटिंग कमरे 52,53 के लिए स्वच्छ स्क्रब, चेहरे मास्क, सिर को कवर, बाँझ दस्ताने, और विशेष जूते पहनें।
    2. </ राजभाषा>
    3. 20 मिलीग्राम के साथ CXMD कुत्तों इंजेक्षन / thiopental सोडियम की किलो उन्हें anesthetize। बाहर सुखाने से आंखों को रोकने के लिए आंखों पर पशु चिकित्सक मरहम का प्रयोग करें।
    4. 3% isoflurane साँस लेना सामान्य संज्ञाहरण (चित्रा 3) बनाए रखने के लिए - 2 का प्रयोग करें। पेशी सजगता की जाँच और दिल की निगरानी और साँस लेने की दर संज्ञाहरण की गहराई का आकलन करने के लिए। आरआर: सामान्य श्वसन दर (आरआर), दिल की दर (मानव संसाधन), और एसपीओ 2 सामान्य संज्ञाहरण के तहत इस प्रकार हैं 10 - 20 साँस / मिनट; एसपीओ 2: 95 - 100%, मानव संसाधन: 80 - प्रति मिनट (बीपीएम) 120 धड़क रहा है।
    5. एक छुरी का प्रयोग, कपाल tibial (सीटी), भी tibialis पूर्वकाल (टीए) के रूप में जाना जाता है पर त्वचा में कटौती, और एक भी कटौती लगभग 5 सेमी longitudinally (युवा वयस्क कुत्तों के लिए) बनाते हैं। इंजेक्शन साइटों को चिह्नित करने के लिए, एक शल्य चिकित्सा सुई और धागे का उपयोग शल्य गहरी प्रावरणी सिलाई और 2 सेमी के अंतराल पर दो सिलाई मार्करों हैं।
    6. एक 27 जी सुई के साथ मांसपेशियों में AONs के वांछित एकाग्रता इंजेक्षन। वांछित ध्यान केंद्रितtration उपचार की स्थिति के बीच होती है। सीटी के लिए, कॉकटेल PMOS के 1.2 मिलीग्राम की कुल (0.4 मिलीग्राम प्रत्येक पीएमओ) या कॉकटेल vPMOs के 0.4 मिलीग्राम (0.13 मिलीग्राम प्रत्येक vPMO) के लिए, 1 मिलीलीटर मात्रा प्रत्येक के दो इंजेक्शन दे। प्रसारिणी मणिबंध ulnaris (ईसीयू) forelimb पेशी के लिए, कॉकटेल PMOS के 1.2 मिलीग्राम की कुल (0.4 मिलीग्राम प्रत्येक पीएमओ) या कॉकटेल vPMOs के 0.4 मिलीग्राम (0.13 मिलीग्राम प्रत्येक vPMO) के लिए 0.5 मिलीलीटर प्रत्येक के दो संस्करणों इंजेक्षन। 1 मिनट के लिए सुई में छोड़ दें। कॉकटेल के लिए प्रत्येक AON के बराबर राशि का प्रयोग करें।
    7. सीटी पेशी से मांसपेशियों के ऊतकों का एक टुकड़ा लंबाई में लगभग 2 सेमी हटाने एक शल्य छुरी का उपयोग करके खुले पेशी बायोप्सी प्रदर्शन करना।
    8. पेशी नमूना तैयार करने के लिए कदम करने के लिए 6.5 जाएं।
    9. एक सुई का प्रयोग, सामान्य संज्ञाहरण से जागरण से पहले 0.02 मिलीग्राम / किलो buprenorphine हाइड्रोक्लोराइड की एक इंट्रामस्क्युलर इंजेक्शन प्रशासन। पेशी प्रावरणी और त्वचा निर्धारित करना वापस पेशी पर और इन मांसपेशियों प्रावरणी और त्वचा बंद करने, respectiv के लिए 3-0 absorbable धागा और 3-0 नायलॉन के धागे का उपयोग कर सिलाईइली।
    10. मुंह खुला पकड़े, निर्धारित धोखा पलटा वापस आ गया है; जब धोखा पलटा वापस आ गया है, कुत्ते extubate।
    11. नसों में या इंट्रामस्क्युलर इंजेक्शन के माध्यम से 15 से 30 मिलीग्राम / ऊपर से 3 दिनों के लिए किलो cefazolin या Cephalexin (एंटीबायोटिक) के लिए प्रशासन के संक्रमण को रोकने के लिए।
    12. सात दिनों के भीतर टांके निकालें। जब तक यह पर्याप्त होश आ गया है स्टर्नल लेटना बनाए रखने के लिए और जब तक एक पूरी वसूली की है कुत्ता अन्य जानवरों के साथ बातचीत करने की अनुमति नहीं है कुत्ते छोड़ पहुंच से बाहर नहीं है। यथासंभव लंबे समय के रूप में जगह में अंतःश्वासनलीय ट्यूबों रखें और जब जानवर जुगल या निगल करने के लिए शुरू होता है उन्हें हटा दें। जानवर की हृदय गति, श्वसन, और हाइड्रेशन मॉनिटर यकीन है कि वे स्थिर और सामान्य सीमा के भीतर कर रहे हैं।
    13. बाद सर्जरी की देखभाल के लिए, 3 दिन (जैसे, buprenorphine 0.01 मिलीग्राम / किग्रा) और नर्सिंग समर्थन, एक शांत, अंधेरे जगह आराम, उचित घाव और पट्टी रखरखाव, एक नरम सहित के लिए पीड़ानाश प्रदानआराम की सतह, मौखिक या आंत्रेतर तरल पदार्थ के साथ पुनर्जलीकरण, और अत्यधिक स्वादिष्ट खाद्य पदार्थ या व्यवहार के उपयोग के माध्यम से सामान्य भोजन के लिए एक वापसी। किसी भी जानवरों अतिरिक्त दवा की आवश्यकता होती है, तो दर्द के लक्षणों के आधार पर butorphanol टारट्रेट के 0.3 मिलीग्राम / किलो के एक इंट्रामस्क्युलर इंजेक्शन दे।
      नोट: दर्द में कुत्तों, काट सकता खरोंच, या दर्दनाक क्षेत्रों की रक्षा, और अगर संभाला, असामान्य रूप से आशंकित या आक्रामक हो सकता है। इसके अलावा, एक अंग में दर्द आम तौर पर लंगड़ा या इसका इस्तेमाल करने के प्रयास के साथ प्रभावित अंग की होल्डिंग-अप में परिणाम है। 8 घंटा - ऐसी स्थितियों में, 0.02 मिलीग्राम / buprenorphine हाइड्रोक्लोराइड के हर किलो 6 के एक इंट्रामस्क्युलर इंजेक्शन दे।

    4. प्रणालीगत इंजेक्शन

    नोट: यह प्रक्रिया सप्ताह की वांछित संख्या के लिए साप्ताहिक या सप्ताह में दो बार दोहराया जा सकता है।

    1. नीचे झूठ बोलने के लिए कुत्ते को हो रही द्वारा मैन्युअल रूप से और धीरे कुत्तों को नियंत्रित करना और उसके कंधे और कमर के ऊपर हथियारों के कपड़ा टी भर में जगह में कुत्ता पकड़ के लिएवह प्रक्रिया है।
    2. AONs इंजेक्षन; 120 - 240 मिलीग्राम / किग्रा कॉकटेल PMOS (40 - 80 मिलीग्राम प्रत्येक AON) एक अंग नस में एक शिरापरक निबाह सुई (एक मस्तक या एक saphenous नस के रूप में जाना जाता है) का उपयोग कर। AON की राशि इंजेक्शन प्रयोगात्मक हालत पर निर्भर करता है। कॉकटेल के लिए प्रत्येक AON के बराबर राशि का प्रयोग करें।
    3. 20 मिनट के लिए 2.5 मिलीग्राम / मिनट की दर से 50 मिलीलीटर की कुल इंजेक्षन करने के लिए, निर्माता के निर्देशों का पालन एक प्रेरणा पंप या सिरिंज चालक का प्रयोग करें। दोहराएँ साप्ताहिक या सप्ताह में दो बार इंजेक्शन (हर दो सप्ताह) कम से कम 5 बार, के रूप में dystrophin अभिव्यक्ति दोहराया इंजेक्शन के साथ जमा करेंगे।
    4. विषाक्तता की जांच के लिए रक्त परीक्षण साप्ताहिक प्रदर्शन करना।
      1. और पूर्ण रक्त गणना (सीबीसी) के लिए 0.5 मिलीलीटर दूसरों के लिए 2.5 मिलीलीटर - - सामने या hindlimb के चमड़े के नीचे नसों में से एक से एक सुई का प्रयोग, खून के 3 मिलीलीटर इकट्ठा। सीबीसी, गामा glutamyl ट्रांस्फ़्रेज़ (GGT), aspartate aminotransferase (एएसटी), रक्त यूरिया नाइट्रोजन (BUN) को शामिल करें, alanine aminotransferase (ALT), creatine kinase (सी), और क्रिएटिनिन आकलन एकत्र रक्त परीक्षण जब रक्त परीक्षण किट से निर्माता के निर्देशों का पालन। 40,54

    5. कुत्तों के नैदानिक ​​ग्रेडिंग

    1. एक वीडियो कैमरा और रिकॉर्ड कुत्ते व्यवहार और चाल सेट करें। कुत्ता जब कुत्ते ग्रेडिंग के रूप में यह एक संदर्भ के रूप में कार्य करेगा के साथ पूरे मुठभेड़ रिकॉर्ड; इसका मतलब यह है प्रत्येक वीडियो एक अलग कुत्ते की क्षमता और इच्छा पर निर्भर करता लंबाई होगा। डिफ़ॉल्ट रिकॉर्डिंग मापदंडों का प्रयोग करें। फिल्माने तो यह एक बाद की तारीख में समीक्षा की जा सकती ग्रेडिंग का एक रिकार्ड बनाता है।
    2. ग्रेड चाल और आंदोलन गड़बड़ी।
      1. चाल और आंदोलन गड़बड़ी के लिए, निम्न ग्रेड का उपयोग करें:
        कक्षा 1 = कोई नहीं, ग्रेड 2 = हिंद अंग के साथ बैठे बढ़ाया, ग्रेड 3 = हिंद अंग के साथ बनी हॉप्स, ग्रेड = 4 चलना फेरबदल, और ग्रेड = 5 चलने में असमर्थ।
      2. जीआर ग्रेड 1 = कोई नहीं,: गतिशीलता अशांति के लिए, निम्न ग्रेड का उपयोगade 2 = लेटी सामान्य से अधिक, ग्रेड 3 = हिंद अंग, ग्रेड 4 पर कूद नहीं कर सकते = कठिनाई के आसपास घूम रहा है, और ग्रेड = 5 उठो और चारों ओर स्थानांतरित करने में असमर्थ बढ़ रही है।
    3. समय कितनी देर तक यह कुत्ता लेता है 15 मीटर से चलाने के लिए। बाहर उपाय 15 मीटर, शुरू लाइन पर कुत्ते जगह है और यह 15 मीटर के निशान तक चलाने के लिए प्रोत्साहित करते हैं।
    4. निर्धारित बनाने के अंग के बाद ग्रेडिंग पैमाने का उपयोग करने का मांसपेशी शोष:
      कक्षा 1 = कोई नहीं, ग्रेड 2 = संदिग्ध कठोरता, ग्रेड 3 = कठोरता लग रहा है या प्रकट होता है पतली, ग्रेड 4 ग्रेड 3 और 5 के बीच = सकते हैं, और ग्रेड = 5 अत्यंत पतली या मेहनत की है।
    5. ग्रेड निम्न पैमाने का उपयोग drooling: ग्रेड 1 = कोई नहीं, ग्रेड 2 = कभी कभी लार dribbles, जब बैठे ग्रेड 3 = कुछ लार जब खाने और पीने, ग्रेड 4 = लार के तार जब खाने या पीने, और ग्रेड = 5 निरंतर लार।
    6. जीभ (macroglossia) निम्नलिखित पैमाने का उपयोग कर के ग्रेड अतिवृद्धि: ग्रेड 1 = कोई नहीं, ग्रेड 2 = थोड़ा बढ़ा, ग्रेड 3 = बढ़ाया outsiडी दांत निकलना, ग्रेड 4 = बढ़े और थोड़ा गाढ़ा, और ग्रेड = 5 बढ़े और गाढ़ा।
    7. ग्रेड कुत्ते के निम्नलिखित पैमाने का उपयोग निगल करने की क्षमता: ग्रेड 1 = कोई कठिनाई नहीं, ग्रेड 2 =, चबाने में, ग्रेड = 4 कठिनाई एक थाली से भोजन लेने में भोजन, ग्रेड 3 = कठिनाई लेने के निगलने में समय और प्रयास लेता है, या पीने , और ग्रेड = 5 खाने के लिए असमर्थ है।
    8. (15 मीटर चल रहे परीक्षण के लिए छोड़कर) 55 प्रत्येक श्रेणी से स्कोर को जोड़कर कुल ग्रेड की गणना।
      नोट: पढ़ाई के रूप में तो पूर्वाग्रह परिचय नहीं अंधा किया जाना चाहिए।

    6. चुंबकीय अनुनाद इमेजिंग (एमआरआई)

    1. हिंद अंगों के टी 2 भारित छवियों को प्राप्त करने के लिए एक 3 टेस्ला (3T) एमआरआई और 18 सेमी व्यास / 18 सेमी लंबाई मानव सिरा तार का उपयोग करें।
    2. 20 मिलीग्राम / thiopental के साथ किलो CXMD कुत्तों इंजेक्शन द्वारा जानवरों anesthetize। बाहर सुखाने से आंखों को रोकने के लिए आंखों पर पशु चिकित्सक मरहम का प्रयोग करें। 2-3% isoflurane साँस लेना प्रयोग सामान्य संज्ञाहरण बनाए रखने के लिए।
      1. पेशी सजगता की जाँच और दिल की निगरानी और साँस लेने की दर संज्ञाहरण की गहराई का आकलन करने के लिए। 95 - 100%, मानव संसाधन: 80 - प्रति मिनट 120 धड़क रहा है (बीपीएम: - आरआर: 20 साँस / मिनट, एसपीओ 2 10 सामान्य श्वसन दर (आरआर), दिल की दर (मानव संसाधन) और एसपीओ 2 सामान्य संज्ञाहरण के तहत इस प्रकार हैं )।
    3. टी 2 भारित छवियों को प्राप्त करने के लिए निम्न सेटिंग्स का उपयोग करें: TR / ते = 4000/85 मिसे, टुकड़ा मोटाई = 6 मिमी, टुकड़ा खाई = 0 मिमी, देखें = 18 सेमी के क्षेत्र x 18 सेमी, मैट्रिक्स आकार = 256 x 256, और अधिग्रहण = 3 तेजी से स्पिन गूंज (चित्रा 4) के दौरान की संख्या।

    7. स्नायु सैम्पलिंग और तैयारी (Necropsy)

    नोट: स्नायु पिछले AON इंजेक्शन के बाद एक या दो सप्ताह से जांचा जाना चाहिए।

    1. 20 मिलीग्राम के साथ कुत्तों इंजेक्षन / thiopental सोडियम की किलो उन्हें anesthetize। आंखों के सूखने को रोकने के लिए anesthetization के दौरान आंखों पर पशु चिकित्सक मरहम का प्रयोग करें।
    2. ANES बनाए रखने के लिए 3% isoflurane साँस लेना - 2 का प्रयोग करेंथेसिया। पेशी सजगता की जाँच और दिल की निगरानी और साँस लेने की दर संज्ञाहरण की गहराई का आकलन करने के लिए। आरआर: सामान्य श्वसन दर (आरआर), दिल की दर (मानव संसाधन) और एसपीओ 2 सामान्य संज्ञाहरण के तहत इस प्रकार हैं 10 - 20 साँस / मिनट; एसपीओ 2: 95 - 100%, मानव संसाधन: 80 - 120 BPM।
      1. (केवल शव-परीक्षा के लिए) सामान्य संज्ञाहरण के तहत exsanguination द्वारा कुत्तों euthanize। गहरी सामान्य संज्ञाहरण के तहत exsanguination प्रयोग आणविक विश्लेषण में रक्त प्राप्त कारकों (जैसे, हृदय की मांसपेशियों) की वजह से प्रभाव से बचने के लिए।
    3. काटना निम्नलिखित मांसपेशियों (चित्रा 5): सीटी, extensor digitorum longus (EDL), gastrocnemius, soleus, मछलियां ग्रीवा, rectus ग्रीवा, मछलियां brachii, ट्राइसेप्स brachii, तिकोना, ईसीयू, प्रसारिणी मणिबंध radialis (ईसीआर), आकुंचिका मणिबंध ulnaris (FCU ), आकुंचिका मणिबंध radialis (एफसीआर), gracilis, पसलियों, पेट की मांसपेशियों, डायाफ्राम, पार्श्व dorsi, घेघा, sternocleidomastoid, और दिल। विषाक्तता की जांच करने के लिए, गुर्दे और ली इकट्ठादेखें नमूने हैं। उपयोग इवांस और अलेक्जेंडर डी Lahunta (2009) विच्छेदन तकनीक 56 के लिए एक संदर्भ के रूप में।
    4. कट सीटी, EDL, gastrocnemius, soleus, मछलियां ग्रीवा, rectus ग्रीवा, मछलियां brachii, ट्राइसेप्स brachii, तिकोना, ईसीयू, ईसीआर, FCU, एफसीआर, gracilis, पसलियों, पेट की मांसपेशियों, पार्श्व dorsi, घेघा, sternocleidomastoid, हृदय, गुर्दे, और छोटे वर्गों लगभग 1 में जिगर - लंबाई में 1.5 सेमी। डायाफ्राम ऊपर रोल और फिर 1 में यह कटौती - 1.5 सेमी वर्गों 56।
    5. tragacanth गम इतनी जगह है कि यह लगभग 0.5 है - 1 सेमी काग डिस्क पर मोटी। tragacanth गम के विपरीत दिशा में पशु की पहचान और मांसपेशियों के नाम के साथ लेबल डिस्क।
    6. उनकी अनुदैर्ध्य अक्ष के साथ मांसपेशियों tragacanth गम में काग को सीधा रखें।
    7. isopentane के एक कंटेनर है कि तरल नाइट्रोजन में बैठा है में corks रखें। 1 मिनट के लिए या पूरी तरह से स्थिर है जब तक लगातार चारों ओर कदम चिमटी के साथ। corks पर स्टोर की मांसपेशियों-80 डिग्री सेल्सियस पर शीशियों में। जब परिवहन, सूखी बर्फ पर शीशियों डाल दिया।
    8. गिलास स्लाइड पशु पहचान / पेशी नाम और तारीख के साथ लेबल तैयार करें।
    9. में एक cryostat -25 डिग्री सेल्सियस तक ठंडा, खड़ा करने के लिए काग माउंट। वांछित स्तर तक खंड मोटाई निर्धारित करें। immunohistochemistry के लिए 8 माइक्रोन और hematoxylin और eosin (एचई) धुंधला के लिए 12 माइक्रोन का प्रयोग करें। पश्चिमी धब्बा नमूने के लिए 15 माइक्रोन का प्रयोग करें। पेशी के बारे में एक-चौथाई ट्रिम उचित मांसपेशियों नमूना लेने के लिए एक फ्लैट पेशी प्राप्त करने के लिए।
    10. एक समय में पेशी के एक भाग काटना, एक ही गिलास स्लाइड पर हर 6 वें खंड जगह अगर नियोजन immunohistochemistry के लिए नमूने का उपयोग के लिए या वह धुंधला हो जाना। -80 डिग्री सेल्सियस पर एक ट्यूब और दुकान में 40 वर्गों - पश्चिमी blots के लिए नमूने का उपयोग करते हैं, तो 30 डाल दिया।
    11. स्लाइड्स की तैयारी के बाद, स्लाइड आरटी पर 1.5 घंटे के लिए सूखी। स्टोर -80 डिग्री सेल्सियस पर स्लाइड।

    8. Immunohistochemistry

    1. भंडारण से तैयार स्लाइड निकालें और में उन्हें जगहएक नमी कक्ष स्लाइड अलग रखने के लिए और नमी बनाए रखने के लिए। नमी चैम्बर भरें ताकि नीचे सिर्फ पानी (लगभग पानी की 1 मिमी) के साथ कवर किया जाता है।
    2. हवा शुष्क 0.5 घंटे के लिए। एक वर्ग एक हाइड्रोफोबिक बाधा पेन का उपयोग कर स्लाइड पर पेशी नमूना संलग्न ड्रा।
    3. फॉस्फेट बफर खारा (पीबीएस) में 15% बकरी सीरम जोड़ें और आरटी पर 2 घंटे के लिए सेते अभिकर्मक को रोकने में।
    4. (: 150 कमजोर पड़ने 1) कुत्ते dystrophin धुंधला के लिए विरोधी dystrophin रॉड डोमेन (Dys-1) माउस मोनोक्लोनल एंटीबॉडी प्राथमिक, या सी टर्मिनल मोनोक्लोनल एंटीबॉडी (Dys-2) जोड़ें। पीबीएस के 1.25 मिलीलीटर में एक अवरुद्ध एजेंट का उपयोग कर पतला। हे / एन एक रेफ्रिजरेटर में एक 4 डिग्री सेल्सियस सेते हैं।
    5. 5 मिनट के लिए पीबीएस के साथ धोने, तीन बार दोहराया। माध्यमिक एंटीबॉडी एलेक्सा 594 बकरी एंटीबॉडी या IgG2 (Dys-2 के लिए) (: 2,500 1) (DYS-1 के लिए) माउस IgG1 के खिलाफ जोड़े। पीबीएस में एक अवरुद्ध अभिकर्मक फिनोल ethoxylate octyl 0.1% से युक्त के साथ पतला। आरटी पर 0.5 घंटे के लिए सेते हैं।
    6. 5 मिनट, तीन टी के लिए पीबीएस के साथ धोनेIME में। स्लाइड सूखे की अनुमति दें। 2 बूँदें 4 (3 एनजी / एमएल) ', 6-diamidino-2-phenylindole (DAPI) बढ़ते समाधान - 1 जोड़ें। चिमटी का प्रयोग, वर्गों के शीर्ष पर एक गिलास पर्ची जगह, बुलबुले से परहेज।
    7. dystrophin- देखें (Dys-1 / Dys-2) 20X बढ़ाई पर 594 एनएम पर एक फ्लोरोसेंट खुर्दबीन के नीचे सकारात्मक फाइबर।

    9. पश्चिमी सोख्ता

    1. क्रायो सेक्शनिंग बर्फ पर नमूना बफर के 150 μl करने से एकत्र पेशी वर्गों जोड़ें।
    2. एक हाथ homogenizer का उपयोग, संक्षेप में प्रोटीन के नमूने homogenize। 5 मिनट - 3 के लिए 95 डिग्री सेल्सियस पर एक हीटिंग ब्लॉक मशीन में एक 1.5 मिलीलीटर ट्यूब में हीट नमूने हैं। अपकेंद्रित्र पर 15 मिनट के लिए 16,500 × छ और सतह पर तैरनेवाला इकट्ठा।
    3. -70 डिग्री सेल्सियस पर सतह पर तैरनेवाला के स्टोर aliquots। आसुत जल का उपयोग 100x को कमजोर करने के लिए।
    4. निर्माता प्रोटोकॉल के अनुसार एक वाणिज्यिक किट का उपयोग प्रोटीन एकाग्रता का निर्धारण। 3 मिनट के लिए नमूने और गर्मी के लिए 2x Laemmli एसडीएस लोड हो रहा है बफर जोड़ें और# 160; 95 डिग्री सेल्सियस पर।
    5. 3 में लोड नमूने - 150 वी पर 3 घंटे के लिए इसे चलाने से पहले 8% Tris-एसीटेट जेल में कई पतला जंगली प्रकार (डब्ल्यूटी) नमूने शामिल हैं (जैसे, 1%, 10%, और 50%) मात्रा का ठहराव के लिए। dystrophin कम से कम 1% WT स्तर इस विधि के साथ पता लगाया जाना चाहिए।
    6. कैथोड बफर में जेल 20 मिनट के लिए रखें। । यह क्रमश:) इस समय के दौरान, फिल्टर पेपर के नौ टुकड़े ले और उन्हें हस्तांतरण बफ़र्स में (कैथोड बफर [+], एनोड बफर (3 में डाल कागजात [- -], और केंद्रित एनोड बफर [] एक अर्द्ध शुष्क हस्तांतरण विधि है जो संवेदनशीलता (चित्रा 6) बढ़ जाती है वर्णन करता है।
    7. 20 सेकंड के लिए मेथनॉल में एक PVDF झिल्ली लेना और फिर एनोड बफर में जगह है।
      अर्द्ध शुष्क हस्तांतरण के लिए झिल्ली के साथ जेल की स्थापना की और यह आरटी में या एक ठंडे कमरे में 400 मा पर 1.5 घंटे चलाने के लिए अनुमति देते हैं।
    8. पीबीएस के साथ झिल्ली धो लें। बीच 20 (PBST) और 5% दूध पाउडर 2 घंटे के लिए पीबीएस के साथ का एक मिश्रण में झिल्ली सेते हैं।
    9. PBST में Dys-1 (प्राथमिक एंटीबॉडी) पतला और एक 1 से 5% दूध पाउडर मिश्रण: 100 कमजोर पड़ने। यह झिल्ली में जोड़ें और यह कम से कम 1 घंटे के लिए सेते हैं। 15 मिनट प्रत्येक के लिए 100 मिलीलीटर PBST के साथ तीन बार धोएं।
    10. 1 पर 65 μl / एचआरपी संयुग्मित माध्यमिक एंटीबॉडी (DYS1 के लिए विरोधी माउस IgG2a) के लेन जोड़ें: 5000 एक अंधेरे क्षेत्र में आरटी पर 1 घंटे के लिए कमजोर पड़ने। फिर, 20 मिनट के लिए 200 मिलीलीटर PBST के साथ तीन बार से धो लें। निर्देशन के रूप में एक का पता लगाने किट से समाधान मिक्स। 1 मिनट के लिए सेते हैं।
    11. बैंड का पता लगाने और ImageJ सॉफ्टवेयर 48,57,58 के साथ विश्लेषण करने के लिए फिल्म का विकास करना।

Representative Results

इन विट्रो प्रयोगों में

Myoblasts क्रम में प्रत्येक AON के प्रभाव की तुलना करने के लिए विभिन्न 2'OMePS उपचार शर्तों के साथ ट्रांसफ़ेक्ट थे। 600 एनएम Ex6A, Ex6B, Ex8A, या Ex8B से प्रत्येक के साथ एकल AON उपचार 600 एनएम सभी 4 AON दृश्यों में से प्रत्येक के साथ एक कॉकटेल उपचार के रूप में किया गया था, के रूप में अच्छी तरह से। शाही सेना के नमूने चार दिन अभिकर्मक के बाद एकत्र किए गए थे। आरटी पीसीआर के बाद, प्रत्येक उपचार के लिए नमूने गैर इलाज (एनटी) नमूने के साथ एक जेल पर चलाए जा रहे थे। जेल पर बैंड उच्च आउट-ऑफ-फ्रेम डीएमडी उत्पादों प्रतिनिधित्व करते हैं; इन बैंड NT, Ex8A में देखा गया था, और Ex8B इलाज किया myoblasts। Ex6A, Ex6B, Ex8A, और कॉकटेल का इलाज myoblasts में फ्रेम उत्पादों दिखाया। कॉकटेल और Ex6A / बी में 100% फ्रेम उत्पादों से पता चला है, Ex8A केवल 30% में फ्रेम उत्पादों से पता चला है, जबकि चित्रा (7)। एक्सॉन लंघन और की बहाली की पुष्टि करने केपढ़ने फ्रेम, सीडीएनए अनुक्रमण प्रदर्शन किया गया था; परिणाम संकेत दिया कि एक्सॉनों 6 - 9 वास्तव में (चित्रा 7) को छोड़ दिया गया था। Immunohistochemistry से पता चला कि AON इलाज कुत्तों NT के नमूने (8 चित्रा) की तुलना में dystrophin पॉजिटिव फाइबर वृद्धि हुई थी।

Vivo प्रयोगों में

विभिन्न AON उपचार की स्थिति की क्षमता की तुलना करने के लिए, CXMD कुत्तों (0.5 - 5 साल पुराने) 1.2 मिलीग्राम Ex6A या विभिन्न dosages में Ex6A, Ex6B, और Ex8A के एक कॉकटेल के साथ एक बार इंजेक्शन थे। दो हफ्ते इंजेक्शन के बाद, मांसपेशियों के नमूने एकत्र और dystrophin पॉजिटिव फाइबर की संख्या की तुलना करने के Dys-1 के साथ दाग रहे थे। सभी कॉकटेल इलाज के नमूने NT नमूनों की तुलना में वृद्धि dystrophin अभिव्यक्ति दिखाया। Dystrophin पॉजिटिव फाइबर AON खुराक (9 चित्रा) के साथ वृद्धि हुई है। निम्नलिखित प्रणालीआईसी इंजेक्शन, जंगली प्रकार (डब्ल्यूटी), NT, और कॉकटेल का इलाज CXMD पेशी के नमूने Dys-1 (चित्रा 10) के साथ दाग रहे थे। कॉकटेल का इलाज CXMD कुत्तों NT CXMD कुत्तों की तुलना dystrophin अभिव्यक्ति वृद्धि हुई पता चला, दोनों सीटी में और हृदय की मांसपेशी नमूने हैं। हालांकि, AON इलाज कंकाल की मांसपेशी (सीटी) में इलाज हृदय की मांसपेशी की तुलना में काफी ज्यादा dystrophin की अभिव्यक्ति दिखाया। एक immunoblot गुम्मट, NT, और विभिन्न morpholino कॉकटेल इलाज की मांसपेशियों की तुलना में एक ही निष्कर्ष करने के लिए नेतृत्व। (चित्रा 10) भी था इलाज किया कंकाल की मांसपेशी के नमूनों में dystrophin अभिव्यक्ति की एक बड़ी रेंज। Hematoxylin और eosin (एचई) धुंधला कि CXMD में इलाज का पता चला कुत्तों NT CXMD कुत्तों (11 चित्रा) की तुलना में केंद्रीय रूप से केन्द्रक फाइबर (CNF) में एक महत्वपूर्ण कमी के साथ बेहतर ऊतकविकृतिविज्ञानी दिखाया। यह इंगित करता है वहाँ अधिक अध: पतन / उत्थान NT कुत्ते में होने वाली है, dystrophic मांसपेशियों विकृति का एक संकेत है। इसके अतिरिक्त, इलाज कुत्तों तेजी से किया थानैदानिक ​​ग्रेडिंग पैमाने पर बार और बेहतर स्कोर चल रहा है। इलाज किया CXMD कुत्तों (चित्रा 12) सभी श्रेणियों में एनटी CXMD कुत्तों की तुलना में बेहतर स्कोर दिखाया।

आकृति 1
चित्रा 1. CXMD कुत्ता और एक्सॉनों 6 का उत्परिवर्तन पैटर्न -। 8 लंघन रणनीतियाँ एक Antisense कॉकटेल का उपयोग CXMD कुत्तों dystrophic कुत्ते mRNA में एक्सॉन 7 का एक नुकसान के लिए अग्रणी एक्सॉन 6 में एक बिंदु उत्परिवर्तन है। इस में mRNA जा रहा है के बाहर के फ्रेम और dystrophin प्रोटीन के उत्पादन को खो दिया है यह परिणाम है। 8. AON कॉकटेल का इलाज कुत्तों में ग्रे बार कम AON दृश्यों का प्रतिनिधित्व करता है - लघु AON दृश्यों 6 और 8, जो mRNA splicing प्रभावी ढंग से एक्सॉनों 6 लंघन में यह परिणाम एक्सॉन के लिए बाध्य करने के लिए तैयार कर रहे हैं। एक्सॉन 9 एक काज डोमेन encodes और कभी-कभी अनायास बाहर AONs साथ एक्सॉन 6 और 8 के खिलाफ परिणामस्वरूप mRNA कोड है कि कम कर रहे हैं प्रोटीन लेकिन समारोह dystrophin के लिए spliced ​​हैअल। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2 एक 1 वर्षीय कुत्ते एक्स से जुड़े पेशी Dystrophy (CXMD) पशु के प्रमुख नैदानिक ​​लक्षण। एक 1 वर्षीय जंगली प्रकार बीगल और एक CXMD कुत्ते दिखाए जाते हैं। समीपस्थ, अंग, और लौकिक मांसपेशियों की भागीदारी के लिए आम तौर पर उम्र के 2 महीने से मनाया जाता है। संयुक्त contracture और श्रोणि के स्थानांतरण उम्र के 4 महीने से प्रकट कर रहे हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
एक कुत्ता। एक के लिए चित्रा 3. सामान्य संज्ञाहरण) Intramusculएआर इंजेक्शन और मांसपेशी बायोप्सी isoflurane के साथ सामान्य संज्ञाहरण के तहत किया जाता है। बी) प्रणालीगत इंजेक्शन के लिए जानवर की होल्डिंग। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4. चुंबकीय अनुनाद जंगली प्रकार की इमेजिंग (एमआरआई), 3 महीने और गुम्मट और NT CXMD कुत्तों में 5 महीने में गैर इलाज CXMD, और CXMD इलाज किया। हिंद अंग का एमआरआई स्कैन। और AON के बाद इंजेक्शन (पहले इंजेक्शन से पहले 1 सप्ताह) में इलाज CXMD हिंद अंग MRIs पूर्व के दो नमूने चित्र दिखाए जाते हैं। 2703MA 200 मिलीग्राम / किग्रा कॉकटेल morpholinos साथ 7x साप्ताहिक इलाज किया गया था। 2001MA 120 मिलीग्राम / किग्रा कॉकटेल morpholinos की 5x साप्ताहिक चतुर्थ इंजेक्शन के साथ इलाज किया गया था। नियंत्रण और इलाज कुत्तों उम्र से मिलान किया गया। इलाज किया कुत्तों की कमी आई टी 2 संकेतों दिखा। छवियाँ adap हैं Yokota एट अल से अनुमति के साथ टेड। (कॉपीराइट 2009, जॉन विले एंड संस) 40 यहाँ यह आंकड़ा का एक बड़ा संस्करण देखने के लिए क्लिक करें।

चित्रा 5
चित्रा 5. स्नायु एक कुत्ता। ए के लिए बायोप्सी प्रक्रिया) एक कम अंग मांसपेशियों बायोप्सी के लिए तय हो गई है। बी) संदंश की मदद से, कम अंग आयोजित किया जाता है। सी) सीटी पेशी अवगत कराया है। ओपन बायोप्सी तकनीक इंजेक्शन साइटों की पेशी के नमूने प्राप्त करने के लिए प्रयोग किया जाता है। धागे बायोप्सी नमूने धारण करने के लिए उपयोग किया जाता है। विच्छेदन के बाद tragacanth गम पर डी) स्नायु नमूने हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

/53776/53776fig6.jpg "/>
चित्रा 6 अर्द्ध शुष्क स्थानांतरण विधि। पश्चिमी सोख्ता के लिए अर्द्ध शुष्क हस्तांतरण विधि का प्रतिनिधित्व प्रस्तुत किया है। तीन पत्रों केंद्रित एनोड बफर में भिगो नकारात्मक टर्मिनल पर निर्धारित कर रहे हैं; 3 कागजात एनोड बफर में भिगो इस के शीर्ष पर खड़ी दिखती हैं। एमबी PVDF कागज 6 कागजात के शीर्ष पर रखा जा रहा से पहले मेथनॉल और फिर एनोड बफर में लथपथ है। जेल है, जो कैथोड बफर में भिगो कर दिया गया है, PVDF कागज पर धीरे रखी है। अंत में, 3 कागजात कैथोड बफर में भिगो जेल के शीर्ष पर रखा जाता है। सकारात्मक टर्मिनल शीर्ष पर सेट किया जाता है। 1 घंटे के लिए, 400 मा प्रणाली के माध्यम से चलाया जाता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 7
चित्रा 7. CXMD myoblasts में एक्सॉन लंघन। एट अल। से अनुमति के साथ अनुकूलित कर रहे हैं (कॉपीराइट 2009, जॉन विले एंड संस) 40। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

आंकड़ा 8
8 चित्रा वृद्धि Dystrop2'O-methylated Phosphorothioate (2'OMePS) में हिन अभिव्यक्ति ट्रांसफ़ेक्ट CXMD myoblasts। CXMD myoblasts अकेले Ex6A के साथ या कॉकटेल 2'OMePS साथ ट्रांसफ़ेक्ट थे। Dys-2 (लाल) और DAPI (नीला) धुंधला दिखाई जाती हैं। इलाज किया myoblasts जंगली प्रकार (डब्ल्यूटी) और गैर इलाज (एनटी) myoblasts की तुलना में कर रहे हैं। छवियाँ Yokota एट अल से अनुमति के साथ अनुकूलित कर रहे हैं। (कॉपीराइट 2009, जॉन विले एंड संस) 40। बार = 50 माइक्रोन। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

9 चित्रा
9 चित्रा CXMD कुत्तों। या तो अकेले Ex6A में Morpholinos इंट्रामस्क्युलर इंजेक्शन या Ex6A, Ex6B, और Ex8A की एक कॉकटेल के साथ dystrophin अभिव्यक्ति का बचाव CXMD कुत्तों की सीटी की मांसपेशियों में इंजेक्शन थे। Dystrophin (DSY -1) जंगली प्रकार का धुंधला(डब्ल्यूटी), गैर इलाज (एनटी), और इलाज CXMD कुत्तों दिखाए जाते हैं। कुत्ते या तो 1.2 मिलीग्राम अकेले Ex6A या 1.2 मिलीग्राम कॉकटेल के साथ इलाज किया गया। छवियाँ Yokota एट अल से अनुमति के साथ अनुकूलित कर रहे हैं। (कॉपीराइट 2009, जॉन विले एंड संस) 40। बार = 100 माइक्रोन। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 10
चित्रा से 10 में वृद्धि dystrophin अभिव्यक्ति CXMD कुत्तों। Dystrophin में प्रणालीगत कॉकटेल morpholino उपचार (Dys-1) के बाद धुंधला हो जाना, जंगली प्रकार (डब्ल्यूटी) (सकारात्मक नियंत्रण) में dystrophin अभिव्यक्ति की तुलना करने के लिए इस्तेमाल किया गया था गैर इलाज (एनटी) (नकारात्मक नियंत्रण), और CXMD कुत्तों 120 मिलीग्राम / किग्रा morpholino कॉकटेल (40 मिलीग्राम / प्रत्येक AON की किग्रा) के साथ इलाज किया। morpholino कॉकटेल Ex6A, Ex6B, और Ex8A निहित। कुत्तों नसों के द्वारा इंजेक्शन थे 5 बार हमइस कॉकटेल के साथ ekly। ए) कपाल tibial (सीटी) गुम्मट, NT की मांसपेशियों में dystrophin अभिव्यक्ति, और इलाज कुत्तों की तुलना। बी) NT और morpholino कॉकटेल का इलाज कुत्तों के बीच हृदय के ऊतकों में dystrophin अभिव्यक्ति की तुलना। सी) एक लोडिंग नियंत्रण के रूप में desmin साथ dystrophin के लिए immunoblot गुम्मट, NT, और morpholino कॉकटेल का इलाज कुत्तों के लिए दिखाया गया है। निम्नलिखित मांसपेशियों में इलाज कुत्तों के लिए दिखाए जाते हैं: ट्राइसेप्स brachii (टीबी), मछलियां brachii (बी बी), डायाफ्राम (डीआइए), घेघा (ईएसओ), सीटी, adductor (जोड़ें), extensor digitorum longus (EDL), masseter (मास), और दिल। छवियाँ Yokota एट अल से अनुमति के साथ अनुकूलित कर रहे हैं। (कॉपीराइट 2009, जॉन विले एंड संस) 40। बार = 200 माइक्रोन। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

11 चित्रा
आकृति11. CXMD कुत्तों में हिस्तोपैथोलोजी बेहतर 240 मिलीग्राम / किग्रा morpholino कॉकटेल के साथ 7 सप्ताह के लिए इलाज किया। CXMD आधे से एक वर्ष से पांच वर्ष से लेकर कुत्तों बार एक साथ 240 मिलीग्राम / किग्रा morpholino कॉकटेल (Ex6A, Ex6B, और Ex8A) नसों के द्वारा इंजेक्शन थे 7 सप्ताह के लिए हफ्ते में। चौदह दिनों पिछले इंजेक्शन के बाद, घेघा की मांसपेशियों को ले जाया गया और hematoxylin और eosin (एचई) धुंधला किया गया था। गैर इलाज (एनटी) से घेघा की मांसपेशियों के महामहिम धुंधला और morpholino कॉकटेल का इलाज (इलाज) CXMD कुत्तों (40x उद्देश्य लेंस)। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 12
नैदानिक ​​ग्रेडिंग पर चित्रा 12. बेहतर स्कोर और 15 मीटर रनिंग टाइम morpholino उपचार। Morpholino इलाज कुत्तों के बाद गैर इलाज (एनटी) littermate की तुलना में थेएस। ग्राफ में त्रुटि सलाखों SEM संकेत मिलता है। ए) नैदानिक ​​ग्रेडिंग परीक्षा पर कुल स्कोर से पहले और बाद में इलाज गणना की गई और इलाज जानवरों NT littermates के साथ तुलना की गई। बी) का इलाज किया और NT कुत्तों की 15 मीटर चल बार की तुलना। सी) बी के लिए इसी प्रकार; हालांकि, छोटे कुत्तों का इस्तेमाल किया गया। छवियाँ Yokota एट अल। से अनुमति के साथ अनुकूलित कर रहे हैं (कॉपीराइट 2009, जॉन विले एंड संस) 40। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

antisense oligonucleotide न्यूक्लियोटाइड सीक्वेंस
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

तालिका 1 antisense oligonucleotide डिजाइन।

Discussion

एक्सॉन लंघन डीएमडी के उपचार के लिए एक आशाजनक चिकित्सीय तकनीक है। दोनों इन विट्रो और इन विवो प्रयोगों में पता चला है कि बहु-एक्सॉन लंघन संभव है। इधर, CXMD कुत्ते मॉडल के उपयोग पर चर्चा की है। 8. 2'OMePS AON रसायन विज्ञान CXMD myoblast अभिकर्मक और morpholino AON रीढ़ रसायन शास्त्र में विवो प्रयोगों के लिए चुना गया था के लिए इस्तेमाल किया गया था - सबसे पहले, AONs dystrophin एक्सॉनों 6 निशाना बनाने के लिए बचाव-ese और ESEfinder कार्यक्रमों का उपयोग कर बनाया गया था। vPMOs असंशोधित PMOS से अधिक कुशल हैं, लेकिन उनके उच्च विषाक्तता के कारण वे प्रणालीगत इंजेक्शन के लिए उपयुक्त नहीं हैं। शाही सेना निष्कर्षण, आरटी पीसीआर, और सीडीएनए अनुक्रमण CXMD myoblasts पर प्रदर्शन किया गया। पीएमओ कॉकटेल के साथ इंजेक्शन कुत्तों नैदानिक ​​नैदानिक ​​लक्षणों में कोई सुधार का आकलन करने के लिए वर्गीकृत किया गया। बाद कुत्तों नम्रता euthanized थे, मांसपेशियों के नमूने ले लिया है और क्रायो सेक्शनिंग के लिए तैयार थे। dystrophin प्रोटीन का आधा जीवन एक से प्रेरित2 महीने - ons लगभग 1 माना जा रहा है। युवा वयस्क कुत्तों, इस अध्ययन में इस्तेमाल किया, हालांकि इन प्रयोगों नवजात कुत्तों और बड़े कुत्तों (> 5 वर्ष) के साथ किया जा सकता है किया गया। तैयार पेशी वर्गों ऊतकविकृतिविज्ञानी मूल्यांकन और पश्चिमी सोख्ता और immunohistochemistry 48 के माध्यम से dystrophin प्रोटीन बचाव का आकलन करने के लिए इस्तेमाल किया गया।

यह सुनिश्चित करना है कि पीएमओ समाधान की मात्रा में इंजेक्शन से पहले सही है महत्वपूर्ण है; ऐसा करने में नाकाम रहने के परिणाम पर महत्वपूर्ण प्रभाव पड़ेगा। इंट्रामस्क्युलर इंजेक्शन के दौरान पर्याप्त दबाव मांसपेशी फाइबर में प्रवेश करने के लिए आवश्यक है। कुत्ते के स्वास्थ्य और सर्जरी साइट के निरीक्षण की निगरानी समस्या निवारण के लिए महत्वपूर्ण हैं। पशुओं के स्वास्थ्य की निगरानी करने के लिए, साप्ताहिक रक्त परीक्षण और वजन किया जाना चाहिए। जानवर और मांसपेशियों के नमूनों की तैयारी की euthanization के बाद, dystrophin प्रोटीन का पता लगाने में संवेदनशीलता सुनिश्चित करने के लिए एक महत्वपूर्ण कदम दोनों Tris- एसीटेट जेल और अर्द्ध शुष्क सोख्ता विधि का उपयोग करने के लिए हैपश्चिमी सोख्ता प्रक्रिया के दौरान।

जैसा प्रतिनिधि परिणामों में दिखाया गया है, myoblasts Ex6A, Ex6B, Ex8A, और कॉकटेल (Ex6A, Ex6B, Ex8A युक्त, और Ex8B) में फ्रेम डीएमडी उत्पादों का उत्पादन के साथ इलाज किया। चूंकि Ex8B कोई एक्सॉन-छोड़ उत्पादों का उत्पादन किया है, यह विवो प्रयोगों में बाद में इस्तेमाल नहीं किया गया था। 9 लंघन हुई और Dys-2 धुंधला के साथ immunocytochemistry इलाज के नमूने में dystrophin अभिव्यक्ति बहाल दिखाया - सीडीएनए अनुक्रमण कि एक्सॉनों 6 दिखाया। AON इलाज कुत्तों dystrophin पॉजिटिव तंतुओं में एक महत्वपूर्ण वृद्धि देखी गई। यह इंगित करता है कि एक्सॉनों 6 - 8 छोड़ जा रहे थे और एक छोटा प्रोटीन का उत्पादन किया गया था। dystrophin पॉजिटिव फाइबर की मात्रा में वृद्धि हुई जब AONs का कॉकटेल इस्तेमाल किया गया था और AON खुराक के लिए आनुपातिक था। Immunoblots प्रणालीगत morpholino इलाज कुत्तों में dystrophin अभिव्यक्ति वृद्धि हुई दिखाया। कंकाल की मांसपेशी dystrophin फाइबर के चर स्तर पर था; हालांकि, morpholino इलाज हृदय के ऊतकों थोड़ा दिखायाdystrophin अभिव्यक्ति में सुधार। चूंकि dystrophin एक उच्च आणविक भार (427 केडीए) है, dystrophin की कम मात्रा का पता लगाने के लिए मुश्किल हो सकता है। सर्वोत्तम परिणामों के लिए, Tris-एसीटेट जेल और अर्द्ध शुष्क हस्तांतरण विधि का इस्तेमाल किया गया था। महामहिम morpholino इलाज कुत्तों में सुधार हुआ है ऊतकविकृतिविज्ञानी दिखाया धुंधला हो जाना। केंद्र nucleated फाइबर (CNFs) अस्वस्थ मांसपेशियों का संकेत कर रहे हैं और मांसपेशियों के अध: पतन और उत्थान के चक्र का प्रतिनिधित्व करते हैं। Morpholino इलाज CXMD कुत्तों गैर इलाज CXMD कुत्तों की तुलना में CNFs के प्रतिशत में कमी देखी गई। नैदानिक ​​ग्रेडिंग बढ़ घूमना और चल क्षमता, morpholino इलाज जानवरों के रूप में लक्षण, में सुधार का पता चला। मांसपेशियों की कठोरता पेशी शोष, इस प्रकार, यह ग्रेडिंग स्कीम 59 में शामिल किया गया था प्रतिबिंबित करने के लिए माना जाता है। जांघ (हिंद अंग) मांसपेशियों की कठोरता मूल्यांकन किया गया था; हालांकि, हम कपाल Sartorius मांसपेशियों को बाहर रखा गया है, क्योंकि वे CXMD में शोष अतिवृद्धि के बजाय प्रदर्शन करने के लिए करते हैं। इलाज किया कुत्तों दिखानेकम ग्रेडिंग स्कोर एड और 15 मीटर चल परीक्षण पर तेजी से बार किया था। 15 मीटर परीक्षण पर सुधार बार सुधार मांसपेशी समारोह 40 के संकेत हैं। उच्च कुल स्कोर ग्रेडिंग गरीबों के स्वास्थ्य और वृद्धि की मांसपेशी शोष संकेत मिलता है।

जबकि इन परिणामों वादा कर रहे हैं, बहु एक्सॉन लंघन अभी भी कई चुनौतियों है कि इससे पहले कि तकनीक नैदानिक ​​प्रयोज्यता को दूर करने की आवश्यकता होगी प्रस्तुत करता है। हृदय के ऊतकों अभी भी हृदय और कंकाल ऊतक के बीच सेलुलर तस्करी में अंतर के कारण AONs, संभावना के कम तेज प्रदर्शित करता है। कोई विषाक्त प्रभाव वर्तमान खुराक परहेजों के तहत पशुओं में मनाया गया है; हालाँकि, और अधिक काम करने से पहले AON कॉकटेल के उपयोग के क्लिनिकल परीक्षण करने के लिए स्थानांतरित कर सकते हैं लंबे समय तक विषाक्तता का आकलन करने के लिए किया जाना चाहिए। ऐसा नहीं है क्योंकि नियामक एजेंसियों के लिए एक अनूठा दवा के रूप में प्रत्येक AON अनुक्रम को परिभाषित AON कॉकटेल दवाओं के लिए मंजूरी हासिल करने के लिए मुश्किल है। इसका मतलब यह है कि एक कॉकटेल में प्रत्येक दृश्य को व्यक्तिगत रूप से safet के लिए परीक्षण किया जा करने की आवश्यकता होगीवाई, और अधिक समय और अधिक पैसे की जरूरत पड़ेगी। एक नैदानिक ​​सेटिंग में बहु-एक्सॉन लंघन के उपयोग के लिए एक और बाधा मध्यवर्ती प्रोटीन अज्ञात कार्यों के साथ उत्पादित उत्पादों की एक बड़ी राशि है। ये प्रोटीन संभावित, अप्रत्याशित दुष्प्रभाव पैदा कर सकते हैं अलग-अलग उत्परिवर्तन 22 के आधार पर। इसके अतिरिक्त, उत्परिवर्तन वर्तमान dystrophic कुत्ते मॉडल के भीतर उपलब्ध पैटर्न सीमित हैं। वहाँ कुछ प्राकृतिक रूप से पाए म्यूटेशन हैं, और सभी म्यूटेशन बहु एक्सॉन लंघन के अध्ययन के लिए उपयोगी होते हैं। Dystrophic सुअर मॉडल भविष्य डीएमडी एक्सॉन लंघन अध्ययनों से 33, 34 के लिए एक अच्छा विकल्प हो वादा किया है।

डीएमडी कुत्ते मॉडल अन्य मॉडलों डीएमडी पर कुछ फायदे हैं। एक बड़ा पशु मॉडल, नैदानिक ​​ग्रेडिंग होने के नाते और एमआरआई और अधिक विस्तृत विश्लेषण के लिए अनुमति देने के लिए संभव हो रहे हैं। कुत्तों के बाद से बड़े जानवर हैं वे भी विष विज्ञान के अध्ययन के लिए अधिक अनुकूल हैं और अधिक बारीकी से माउस मॉडल की तुलना में मानव रोग प्रतिनिधित्व करते हैं। कुत्ता मीटरodels भी डीएमडी जीन दृश्यों कि अधिक मनुष्यों 23, 34, 45 के लिए समान हैं।

हालांकि तकनीकी रूप से चुनौतीपूर्ण, बहु एक्सॉन लंघन दृष्टिकोण अंततः डीएमडी रोगियों की 24> 90% फायदा हो सकता है। यह यह एकल एक्सॉन लंघन करने के लिए एक बेहतर विकल्प बनाता है, के रूप में एकल एक्सॉन लंघन केवल रोगियों के एक छोटे सबसेट के लिए लागू है। इसके अलावा, मल्टी-एक्सॉन लंघन विलोपन पैटर्न है कि छोटा dystrophin प्रोटीन की कार्यक्षमता का अनुकूलन का चयन करने के लिए सक्षम हो जाएगा। उदाहरण के लिए, डीएमडी का विलोपन एक्सॉनों 45 - 55 असाधारण हल्के लक्षण या स्पर्शोन्मुख व्यक्तियों 14,19,60-63 के साथ जुड़ा हुआ है। एक्सॉनों 45 के बहु-एक्सॉन लंघन - 55 पहले से ही एक एक्सॉन 52 विलोपन (mdx52) vPMOs 22,26 के प्रणालीगत इंजेक्शन के प्रयोग के साथ डीएमडी के एक माउस मॉडल में प्रदर्शन किया गया है। कॉकटेल vPMOs का उपयोग भी पेशी dystrophy के अन्य रूपों, ऐसे में प्रदर्शन किया गया हैफुकुयामा जन्मजात पेशी dystrophy (FCMD) के रूप में। FCMD एक्सॉन फँसाने, जिसमें न्यायपालिका mRNA splicing retrotransposon प्रविष्टि के कारण होता है के कारण होता है। vPMOs दोनों एक FCMD माउस मॉडल में और मानव कोशिका लाइनों 64 में splicing के पैटर्न को बचाने के लिए दिखाया गया है। अगली पीढ़ी के AON उच्च प्रभावकारिता और कम विषाक्तता का प्रदर्शन करते chemistries नैदानिक ​​आवेदन में बहु-एक्सॉन लंघन दृष्टिकोण के प्रभावी अनुवाद की सुविधा होगी। इसके अतिरिक्त, बहु-एक्सॉन लंघन संभवतः ऐसे dysferlinopathies 24, 65 के रूप में अन्य आनुवांशिक विकार, को लागू किया जा सकता है।

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
मल्टी एक्सॉन कुत्ते एक्स से जुड़े पेशी Dystrophy में कॉकटेल antisense oligonucleotides का प्रयोग लंघन
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter