Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Multi-exon Hoppe Bruke Cocktail Antisenseoligonukleotider i Canine X-linked muskeldystrofi

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

Exon hoppe er for tiden en mest lovende behandlingsalternativ for Duchenne muskeldystrofi (DMD). For å utvide anvendelsen for DMD pasienter og for å optimalisere stabilitet / funksjon av de resulterende avkortede dystrophin proteiner, ble en multi-ekson hoppe tilnærming ved hjelp av cocktail antisensoligonukleotider utviklet og vi demonstrert systemisk dystrophin redning i en hund modell.

Abstract

Duchenne muskeldystrofi (DMD) er en av de mest vanlige dødelige genetiske sykdommer i verden, forårsaket av mutasjoner i DMD (DMD) genet. Exon hoppe syssels kort DNA / RNA-molekyler som kalles Antisenseoligonukleotider (AONs) som gjenoppretter leserammen og produsere kortere, men funksjonelle proteiner. Imidlertid ekson hopper behandlingen står overfor to hoved hekk: begrenset gyldighets (opp til bare 13% av pasientene kan behandles med en enkelt AON medikament) og usikker funksjon av avkortede proteiner. Disse problemene ble løst med en cocktail AON tilnærming. Mens ca 70% av DMD pasienter kan behandles ved enkelt ekson hoppe (alle eksoner kombinert), kan man potensielt behandle mer enn 90% av DMD pasienter hvis flere exon hoppe bruker cocktail antisensprimere narkotika kan realiseres. Hunden X-bundet muskeldystrofi (CXMD) hund modell, som fenotype er mer lik menneskelige DMD pasienter, ble brukt til å teste den systemiske efficACY og sikkerhet av multi-ekson hopper av eksoner 6 og 8. CXMD hundemodellen huser et spleisesete mutasjon i intron 6, som fører til en manglende exon 7 i dystrofin mRNA. Hvis du vil gjenopprette leserammen i CXMD krever multi-exon hoppe av eksoner 6 og 8; derfor CXMD er en god mellomstore dyremodell for å teste effekt og sikkerhet av multi-exon hoppe. I denne studien ble en cocktail av antisense morpholinos rettet mot ekson 6 og ekson 8 designet og den restaurert dystrophin uttrykk i kroppsdekkende skjelettmuskulatur. Metoder for transfeksjon / injeksjon av cocktail oligos og evaluering av effekt og sikkerhet av multi-exon hoppe i CXMD hund modellen blir presentert.

Introduction

Duchenne muskeldystrofi (DMD) er en X-bundet recessiv muskel sykdom karakterisert ved progressiv muskelsvakhet, først beskrevet av Dr. Guillaume-Benjamin-Amand Duchenne (de Boulogne) 1. DMD er en felles genetisk sykdom som påvirker om en i 3500 gutter over hele verden, med rundt 20 000 berørte barn født hvert år 2,3. Motorisk utvikling er forsinket og ganglag forstyrrelser er sett i tidlig barndom 4, etterfulgt av rullestol avhengighet på om de tidlige tenårene. Døden inntreffer vanligvis mellom 20 og 30 på grunn av respirasjonssvikt eller hjertesvikt 5-8. Det er i dag ingen kur for DMD. Behandling med glukokortikoider kan bremse utviklingen av muskel degenerasjon til en viss grad, men er forbundet med betydelige bivirkninger, inkludert fedme og diabetes mellitus 2,7,8. DMD skyldes mutasjoner i dystrophin (DMD) genet, som fører til tap av funksjonelle dystrophin Proteinkonn. DMD er en ekstremt stor gen med over 2 millioner basepar og 79 eksoner 9,10. Sletting, tull, og duplisering mutasjoner fører til out-of-frame mutasjoner er den vanligste årsaken til DMD fenotype. De områder av exoner 3 - 9 og eksoner 45 - 55 betegnes som "mutasjon hotspots" og de ​​fleste pasienter har delesjonsmutasjoner innenfor disse partier av genet, som fører til ikke-funksjonell dystrofin i DMD pasienter 3,9,11-16. Dystrophin funksjoner innenfor dystrophin-glykoprotein kompleks (DGC), som har en viktig rolle i muskelmembran stabilisering. N- og C-termini er de viktigste domener for funksjon, mens den sentrale stang domenet spiller en mindre viktig rolle 3,9,17. Overholdelse av en mild fenotype forbundet med Becker muskeldystrofi (BMD), som hovedsakelig skyldes i-frame mutasjoner innenfor DMD-genet, inspirert bruk av ekson hoppe for behandling av DMD. BMD pasienter har en forkortet, men funksjonellel, dystrophin protein som opprettholder både termini 3,6,18. Exon hoppe i teorien kan gjenopprette leserammen, noe som resulterer i forkortet-men-funksjonelle dystrophin proteiner lik dem man ser i BMD 3,19.

Flere typer antisense oligonukleotider (AONs) har blitt testet i kliniske studier, inkludert 2'o-metylert fosforotioater (2'OMePS) og phosphorodiamidate morfolino oligomerer (PMOS). Hoppe exon 51 og 53 ved hjelp av disse AONs har blitt undersøkt, og mens resultatene er lovende, har enkelt-ekson hoppe begrenset anvendbarhet, da det er mutasjonsspesifikke 3, 19, 20,21, 22-26. Spørsmål også fortsatt om stabiliteten av de resulterende forkortede dystrophin proteiner produsert fra single-exon hoppe 22,23. I tillegg har noen pasienter krever mer enn en enkelt ekson som skal hoppes over, for å gjenopprette avlesningsrammen 3. Selv om det teknisk vanskeligere, er multi-exon hoppe en metode somkunne løse disse problemene 3,19. Multi-exon hoppetau har tidligere blitt demonstrert i dystrofiske hund og humane cellelinjer in vitro. I tillegg har mdx52 mus og canine X-linked muskeldystrofi (CXMD) hundemodeller blitt benyttet for in vivo-studier 22, 24-27. Canine X-bundet muskeldystrofi Japan (CXMD J) beagler ble anvendt her, da leserammen til CXMD J kan gjenopprettes ved multi-ekson hopper av eksoner 6 og 8, eller ekstra exoner (for eksempel exoner 3 - 9) (figur 1). Beagle-baserte CXMD deler den samme mutasjon mønster som Golden Retriever muskeldystrofi (GRMD) modell, men beagler er mindre og billigere å vedlikeholde på grunn av deres kroppsstørrelse, og dermed gi en nyttig modell for DMD 28,29. CXMD hunder nærmere etterligne den menneskelige DMD fenotype enn mindre dyremodeller, som gnager, og er mer pålitelig for toksikologiske vurderinger 3,22,30,31 (figur 2). CXMD hunder vise progressiv muskel forfall, gangart forstyrrelser, og hjerte-og luftveisproblemer lik dem sett i DMD. Sammenlignet med ett-ekson hopper over, er multi-ekson hoppe som gjelder for en mye større andel av pasientene. Blant de tre vanligste mutasjonstyper (slettinger, tull og duplikasjoner), 80 - kan 98% av pasientene bli behandlet gjennom multi-exon hoppe 14,32,33, mens 45% av alle DMD pasienter kan ha nytte av spesielt hoppe eksoner 45 - 55 3,19,22,34.

Med utviklingen av modifiserte morpholinos, har effektiviteten av AON cocktails ved tilrettelegging exon hoppe forbedret. Arginin-rike celle-gjennomtrengende peptid-konjugert PMOs (PPMOs), og vivo-morpholinos (vPMOs) er AON kjemi som har betydelig forbedret celle-gjennomtrengende evne og stabilitet 3,35-38. Bekymringer fortsatt om langsiktig AON toksisitet; imidlertid betydelig fremganghar blitt laget. Kjemiske modifikasjoner på morpholinos sterkt redusere off-target effekter og pre-kliniske studier har rapportert ingen signifikante toksiske effekter 3,22,39,40. En resterende utfordring for multi-exon hoppe er strømmen som kreves for hver enkelt AON å bli testet for toksisitet alene, som et enkelt medikament, i stedet for sammen som en cocktail 3,19,22,41,42. I DMD studier med både single og multi-ekson Hoppe målrettet til hjertet, har det vært lite forbedring i dystrofe hjertet vev. Effekten av morpholinos i hjertet er antatt å være lav på grunn av dårlig celle-gjennomtrengende evne. Peptid-konjugert PPMOs har forbedret evne til AONs til å trenge inn i hjerteceller, å øke mengden av funksjonelt protein dystrofin reddet i hjertet 3,19,38.

Her er vår AON cocktail tilnærming diskutert på lengden, inkludert utforming av AON sekvenser bruker ESEfinder programvare 43. Protocoler for hund eksperimenter med multi-exon og hopper er også beskrevet. CXMD J beagler ble brukt for eksoner 6 og 8 hoppe eksperimenter. Multi-exon hoppe i CXMD hund modellen viser lovende resultater, men utfordringer gjenstår som må overvinnes før de er klinisk relevant.

Protocol

Alle protokoller oppført nedenfor, er i samsvar med retningslinjene dyr omsorg fastsatt av National Center of Neurology og psykiatri (NCNP) i Japan. Alle forsøkene ble godkjent av Institutional Animal Care og bruk komité for NCNP.

1. Design av Antisens oligos

  1. Bruk rednings ESE og ESEfinder programmer for å oppdage ESE sider 44, 45-47.
  2. Motivet 25 basepar (bp) sekvenser som er antisense til eksoner som skal være målrettet. Target eksoner 6 og 8 i hunden modellen (figur 1).
    1. Bruk 25 - 30 bp sekvenser for PMOs (tabell 1) eller 25 bp for 2'OMePS. Å designe 25 bp sekvenser, velg sekvenser som er innenfor målområdet. Tenk sekundærstruktur, unngåelse av heterodimerer, exon spleising enhancer motiver, og GC innhold for å skape stabile sekvenser 43. AONs bør målrette minst ett av de ESE områder som er identifisert av de ovennevnte software.
    2. Velg AONs med GC-innhold som er mindre enn 65%, med færre enn 4 sammenhengende 'G, og ikke inneholder selvkomplementære sekvenser. Bruk NCBI Blast programvare for å forutsi off-target annealing områder 22,48,49.
  3. Velg en passende AON ryggrad kjemi. For in vitro eksperimenter bruke 2'o-metyl oligonukleotider (2'OMePS) eller morpholinos. For in vivo eksperimenter, bruker 2'OMePS, morpholinos eller vPMOs. 3,19,48,50

2. in vitro eksperimenter (Eksoner 6 og 8 Hoppe i CXMD Model)

  1. 2'OMePS Transfeksjon av Dog myoblasts
    1. Kultur myoblaster CXMD i 3 ml vekstmedium i 6-brønns plater. Seed 1 - 5 x 10 3 celler / cm2 med 0,5 ml / cm 2 av medium for myoblaster. For vekstmediet ved å bruke Dulbeccos modifiserte Eagles medium (DMEM) med 10% føtalt bovint serum (FBS) og 1%penicillin / streptomycin (P / S) 40.
    2. Inkuber ved 37 ° C inntil 60 - 80% sammenflytende. Dette tar ca 12 til 24 timer.
    3. Fortynn et kationisk liposom trans middel til totalt 100 pl i redusert serum medium (2: 1 ratio trans agenten: AONs, f.eks, 10 mL lipofectin vs. 5 mikrogram AONs). Tillat blandingen å stå ved romtemperatur i 30 - 45 min.
    4. Fortynn AONs (2'OMePS eller morpholinos) til et sluttvolum på 100 ul i redusert serummedium.
    5. Kombiner den fortynnede trans agent med utvannet AONs og inkuber ved RT i 10 - 15 min.
    6. Mens transfeksjon agent / AON blanding sitter ved RT, fjerne gamle media fra cellene via aspirasjon og vaske celler med media.
    7. Legg 0,8 ml media til transfeksjon agent / AON blanding og deretter legge hele løsningen til de ferske vaskede celler. Inkuber i 3 timer ved 37 ° C.
    8. Etter inkubasjon, erstatte media med differentiation media (DM); differensiering kan ta opptil 10 dager. Sjekk for å se hvorvidt differensiering har oppstått som starter på rundt dag 3. differensiering media er DMEM med 2% hesteserum, 200 U / ml penicillin, 200 mg / ml streptomycin, og 10 ug / ml insulin.
  2. Morpholino Transfeksjon av Dog myoblasts
    1. Kultur myoblaster CXMD i vekstmedium som beskrevet i trinn 2.1.
    2. Bytt til differensiering medium (DM), og legge til 0,1 mM lager morpholino til hver brønn for å gjøre den endelige konsentrasjonen 1fiM. Heat cocktail morpholinos ved 65 ° C i 10 min før transfeksjon eller injeksjon for å unngå AON aggregering. Legge til et peptid levering reagens 39,51 og justeres til en sluttkonsentrasjon på 3 - 6 pM.
    3. Etter 16-48 timers inkubasjon samle celler for RNA ekstraksjon. Tilsett 1 ml syre guanidiniumtiocyanat-fenol-kloroform til cellene for å løsne cellene fra platen. Utfør RNA extracsjon etter dette trinnet.
      1. Alternativt kan legge til trypsin slik at den dekker alle celler og inkuberes i 2 minutter ved 37 ° C.
        Merk: Hvis tenkt å utføre immunkjemi, bruker kamret lysbilde briller for dyrking. Etter differensiering, kan cellene bli løst ved bruk av paraformaldehyd (PFA) (4% i 10 min).
  3. RNA Utvinning og revers transkripsjon Polymerase Chain Reaction (RT-PCR)
    1. Når cellene er differensiert i myotubes, fjerne medium og tilsett 1 ml syre guanidiumtiocyanat-fenol-kloroform; inkuberes i 10 min ved RT.
    2. Overføring til 1,5 ml rør. Kombiner med 200 ul kloroform og inkuber ved romtemperatur i 2 minutter inntil tre separate lag kan sees. De tre lag fra topp til bunn er: et RNA-lag, et DNA-lag, og et protein lag.
    3. Sentrifuger ved 12000 x g i 15 min ved 4 ° C. Fjern det øverste laget supernatanten og plasser i et rør med 500 & #181; l isopropanol (hvis stoppe her, lagre supernatanten ved -80 ° C). Sentrifuger supernatanten ved 12.000 x g i 10 minutter ved 4 ° C; etter sentrifugering, holde den resulterende RNA pellet og kast supernatanten.
    4. Vask pelleten med etanol og sentrifuger ved 8000 xg i 5 min ved 4 ° C. Fordamp gjenværende etanol ved å snu røret i 15 min og deretter legge til 15 - 30 ul RNase-fritt vann. Kvantifisere total RNA konsentrasjon ved hjelp av amerikanske / VIS-spektroskopi ved 260 nm.
    5. Kombiner de nødvendige reagensene for RT-PCR-reaksjon: 1,5 ul 10 uM forover primer, 1,5 ul 10 uM revers primer, 1 ul dNTP, 5 ul ett-trinns PCR-kit-buffer, 0,7 ul RNase-inhibitor, en pl enzymblanding fra en- trinn PCR kit, og 200 ng av RNA. Når disse har blitt blandet, tilsett vann til et endelig volum på 25 ul.
    6. Sett blandingen i en termo-cycler. Kjøre en 30 min syklus ved 50 ° C, en 15 min0; syklus ved 95 ° C, deretter 35 sykluser ved 94 ° C i 1 min, 60 ° C i 1 min, og 72 ° C i 1 min. Endelig kjøre en 10 min syklus ved 72 ° C. Lagres PCR-produkt i et kjøleskap ved 4 ° C eller -20 ° C
  4. Komplementær DNA (cDNA) Sekvense
    1. Identifisere exon 6-9-hoppet bånd med agarosegel-elektroforese. Belastning 5 pl av hver prøve inn i brønnene i en 1,5% agarosegel, kjørt 135 V gjennom gelen i 5 minutter, og deretter 120 V i 20 min. Deretter inkuberes gelen i DNA gel flekk ved RT i 30 min. Visual bandene bruker bildebehandlingsprogrammer.
    2. Eksisere band av interesse å bruke en gel utvinning kit.
      1. Eksisere DNA-fragmentet og oppløseliggjøre den gelskive ved anvendelse av 200 ul NTI / 100 mg gel. La dette stå i 5 til 10 minutter i et 50 ° C vannbad. Deretter overfører silika membran tube.
      2. Sentrifuger ved 11000 x g i 30 sek. Vask to ganger med 700 mL NT3 buffer før centrifuging igjen ved 11 000 xg i 30 sek.
      3. Tørk silisiumdioksyd membranen ved sentrifugering ved 11 000 x g i 1 min.
      4. Legg 15-30 mL NE buffer og la den sitte ved RT i 1 min. Så, sentrifuger ved 11 000 xg i 1 min. Fjern det silikagel og holde innholdet i røret.
    3. Bruke en sekvenserings-settet for å bestemme sekvensen i henhold til produsentens protokoll.

3. intramuskulære injeksjoner eller Åpne muskelbiopsi

  1. For vedlikehold av sterile forhold under overleve operasjonen, fjerne hår ved hjelp clippers i området rundt operasjonen nettstedet (hind lem). Bruk jodoforer eller klorheksidin som et desinfeksjonsmiddel. Bruk sterile gardiner for det kirurgiske området ved å plassere og sikre dem over hele dyret og operasjonsbordet.
    1. Bruk rene skrubb, ansiktsmasker, hodeplagg, sterile hansker, og spesielle sko for operasjonsstuen 52,53.
    2. </ Ol>
    3. Sprøyt CXMD hunder med 20 mg / kg av tiopental natrium til bedøve dem. Bruk dyrlege salve på øynene for å hindre at øynene tørker ut.
    4. Bruk 2-3% isofluran innånding å opprettholde generell anestesi (figur 3). Sjekk muskel reflekser og overvåke hjerte og pustefrekvens for å vurdere anestesidybden. Den normale pusterytme (RR), hjertefrekvens (HR), og SpO 2 under generell anestesi er som følger: RR: 10 - 20 åndedrag / min; SpO2: 95 - 100%, HR: 80 - 120 slag per minutt (bpm).
    5. Ved hjelp av en skalpell, skjære huden over den kraniale tibial (CT), også kjent som den tibialis anterior (TA), og lage et enkelt kutt omtrent 5 cm i langsgående retning (for unge voksne hunder). For å markere injeksjons, sy den dype fascia ved hjelp av en kirurgisk nål og kirurgisk tråd og lage to maskemarkører på 2 cm intervaller.
    6. Injiser den ønskede konsentrasjon av AONs inn i muskelen med en 27 G nål. Ønsket konsensjons varierer mellom behandlingsforhold. For CT, gi to injeksjoner av 1 ml volum hver, for totalt 1,2 mg av cocktail PMOs (0,4 mg hver PMO) eller 0,4 mg av cocktail vPMOs (0,13 mg hver vPMO). For forbena muskel extensor carpi ulnaris (ECU), injisere to volumer av 0,5 ml hver for totalt 1,2 mg av cocktail PMOs (0,4 mg hver PMO) eller 0,4 mg av cocktail vPMOs (0,13 mg hver vPMO). La nålen inn til 1 min. Bruke en lik mengde av hver AON for cocktail.
    7. Utføre åpen muskelbiopsi ved å fjerne et stykke av muskelvev ca. 2 cm i lengde fra CT muskelen ved anvendelse av en kirurgisk skalpell.
    8. Gå til trinn 6.5 for muskelprøveopparbeidelse.
    9. Ved hjelp av en nål, administrere en intramuskulær injeksjon av 0,02 mg / kg buprenorfinhydroklorid før oppvåkning fra narkose. Lå muskel fascia og huden tilbake over muskel og sy disse ved hjelp av en 3-0 absorberbare tråden og 3-0 nylontråd for muskel fascia og hud nedleggelse, respectivEly.
    10. Mens du holder munnen åpen, avgjøre om brekningsrefleksen har returnert; når brekningsrefleksen har returnert, extubate hunden.
    11. Administrere 15 til 30 mg / kg cefazolin eller Cephalexin (antibiotika) i inntil tre dager via intravenøs eller intramuskulær injeksjon for å unngå smitte.
    12. Fjern suturer innen syv dager. Ikke la hunden være uten tilsyn før det har gjenvunnet nok bevissthet til å opprettholde sternal recumbency og ikke la hunden til å samhandle med andre dyr til en full gjenoppretting er gjort. Hold endotrakealtuber på plass så lenge som mulig og fjerne dem når dyret begynner å tygge eller svelge. Overvåk dyrets puls, åndedrett, og hydrering å sørge for at de er stabile og innenfor normale grenser.
    13. For post-kirurgi omsorg, gi analgesi i 3 dager (for eksempel buprenorfin 0,01 mg / kg) og sykepleier støtte, blant annet en rolig, mørkt hvilested, passende sår og bandasje vedlikehold, en mykhvileflate, rehydrering med orale eller parenterale væsker, og en tilbakevending til normal fôring gjennom bruk av svært velsmakende mat eller godbiter. Hvis noen av dyrene krever ytterligere medisinering, gi en intramuskulær injeksjon av 0,3 mg / kg av butorphanoltartrat avhengig av smertesymptomer.
      Merk: Hunder i smerte kan bite, scratch, eller beskytte smertefulle områder, og hvis håndtert, kan være uvanlig engstelig eller aggressiv. I tillegg smerter i en lem resulterer vanligvis i limping eller holde opp av de berørte lem med forsøk på å bruke det. I slike tilfeller gi en intramuskulær injeksjon av 0,02 mg / kg av buprenorfin-hydroklorid hver 6 - 8 time.

    4. Systemiske injeksjoner

    Merk: Denne prosedyren kan gjentas hver uke eller annenhver uke for det ønskede antall uker.

    1. Beherske hunder manuelt og forsiktig ved å få hunden til å legge seg ned og deretter drapere armene over skuldrene og hoftene for å holde hunden på plass hele than prosedyre.
    2. Injisere AONs; 120 - 240 mg / kg cocktail PMOs (40 - 80 mg hver AON) ved hjelp av en venøs iboende nål i en lem vene (kjent som en hode eller en saphenous vene). Mengden av AON injiseres avhenger av den eksperimentelle betingelse. Bruke en lik mengde av hver AON for cocktail.
    3. Bruk en infusjonspumpe eller sprøyte driver å injisere 50 ml totalt med en hastighet på 2,5 ml / min i 20 min, etter produsentens anvisninger. Gjentatte injeksjoner ukentlig eller annenhver uke (annenhver uke) minst 5 ganger, som dystrophin uttrykk vil akkumulere med gjentatte injeksjoner.
    4. Utfør blodprøver hver uke for å undersøke toksisitet.
      1. Ved hjelp av en nål, samle 3 ml blod - 0,5 ml til telling av blodceller (CBC) og 2,5 ml for andre - fra en av de subkutane venene i forgrunnen eller bakben. Inkluder CBC, gamma-glutamyltransferase (GGT), aspartataminotransferase (AST), blod urea nitrogen (BUN), alanin aminotransferase (ALT), kreatin kinase (CK) og kreatinin vurderinger ved testing av samlet blod, etter produsentens instruksjoner fra blod test kits. 40,54

    5. Klinisk Grading of Dogs

    1. Sett opp et videokamera og ta opp hunden atferd og gangart. Spill hele møtet med hunden da dette vil fungere som en referanse når gradering hunden; Dette betyr at hver video vil være en annen lengde, avhengig av hundens evner og vilje. Bruk standardopptaksparametere. Filming skaper en registrering av gradering slik at det kan bli vurdert på et senere tidspunkt.
    2. Vurder ganglag og bevegelsesforstyrrelser.
      1. For ganglag og bevegelsesforstyrrelser, kan du bruke følgende kvaliteter:
        klasse 1 = ingen, grad 2 = sitter med bakben utvidet, grad 3 = bunny-hopp med bakbena, grad 4 = subbende gange, og karakteren 5 = ute av stand til å gå.
      2. For mobilitet forstyrrelse, kan du bruke følgende klassetrinn: grad 1 = ingen, grade 2 = liggende nede mer enn normalt, grad 3 = kan ikke hoppe på bakbena, grad 4 = økende vanskeligheter med å bevege seg rundt, og karakteren 5 = klarte ikke å komme opp og flytte rundt.
    3. Tiden hvor lang tid det tar hunden å løpe 15 m. Mål opp 15 m, legg hunden på startstreken, og oppfordrer den til å kjøre inntil 15 m mark.
    4. Bestem muskelatrofi av lem ved hjelp av følgende karakterskala:
      klasse 1 = ingen, grad 2 = mistenkt hardhet, grad 3 = kan føle hardhet eller vises tynne, grad 4 = mellom karakterene 3 og 5, og karakteren 5 = svært tynne eller hardt.
    5. Grade sikler etter følgende skala: grad 1 = ingen, grad 2 = tidvis driblet spytt når du sitter, grad 3 = noen sikle når du spiser og drikker, grad 4 = strenger av sikle når du spiser eller drikker, og karakteren 5 = kontinuerlig sikle.
    6. Grade hypertrofi av tungen (macroglossia) med følgende skala: grad 1 = ingen, grad 2 = litt forstørret, grad 3 = utvidet outside tannsett, grad 4 = forstørret og litt tykkere, og karakteren 5 = forstørret og fortykket.
    7. Grade hundens evne til å svelge hjelp av følgende skala: grad 1 = ingen problemer, klasse 2 = tar tid og krefter i å ta mat, grad 3 = vanskeligheter med å ta mat fra en plate, grad 4 = vanskeligheter med å tygge, svelge, eller drikke og klasse 5 = ikke klarer å spise.
    8. Beregn totalkarakteren ved å legge resultatet fra hver kategori (bortsett fra 15 m løpetest) 55.
      Merk: Studiene skal bli blindet for ikke å innføre bias.

    6. Magnetic Resonance Imaging (MRI)

    1. Bruk en 3 Tesla (3T) MR og 18 cm diameter / 18 cm lengde menneskelige ytterpunkt coil å få T2-vektede bilder av hind-lemmer.
    2. Bedøve dyr ved å injisere CXMD hunder med 20 mg / kg av tiopental. Bruk dyrlege salve på øynene for å hindre at øynene tørker ut. Bruke 2-3% isofluran inhalering for å opprettholde generell anestesi.
      1. Sjekk muskel reflekser og overvåke hjerte og pustefrekvens for å vurdere anestesidybden. Den normale pusterytme (RR), hjertefrekvens (HR) og SpO2 under narkose er som følger: RR: 10 - 20 pust / min, SpO2: 95 - 100%, HR: 80 - 120 slag per minutt (bpm ).
    3. Bruk følgende innstillinger for å få T2-vektede bilder: TR / TE = 4000/85 ms, skivetykkelse = 6 mm, skive gap = 0 mm, synsfelt = 18 cm x 18 cm, matrise size = 256 x 256, og rekke oppkjøp = 3 under rask spin ekko (figur 4).

    7. Muskel Prøvetaking og klargjøring (Obduksjon)

    Merk: Muskler bør prøves en eller to uker etter siste AON injeksjon.

    1. Injiser hunder med 20 mg / kg tiopental av natrium for å bedøve dem. Bruk dyrlege salve på øynene under bedøvelsen for å hindre uttørking av øynene.
    2. Bruk 2-3% isofluran innånding å opprettholde anesthesia. Sjekk muskel reflekser og overvåke hjerte og pustefrekvens for å vurdere anestesidybden. Den normale pusterytme (RR), hjertefrekvens (HR) og SpO 2 under generell anestesi er som følger: RR: 10 - 20 åndedrag / min; SpO2: 95 - 100%, HR: 80-120 bpm.
      1. Avlive hundene ved avblødning under narkose (for obduksjon bare). Bruk exsanguination henhold dyp narkose for å unngå virkningene forårsaket av blod-avledede faktorer i molekylær analyse (f.eks kardiale muskler).
    3. Dissekere følgende muskler (figur 5): CT, extensor digitorum longus (EDL), gastrocnemius, soleus, biceps femoris, rectus femoris, biceps brachii, triceps brachii, deltoid, ECU, extensor carpi radialis (ECR), flexor carpi ulnaris (FCU ), flexor carpi radialis (FCR), gracilis, interkostalrom, magemusklene, mellomgulvet, lateral dorsi, spiserør, sternocleidomastoideus og hjerte. For å undersøke toksisitet, samle nyre og liver prøver. Bruk Evans og Alexander de Lahunta (2009) som en referanse for disseksjon teknikk 56.
    4. Skjær CT, EDL, gastrocnemius, soleus, biceps femoris, rectus femoris, biceps brachii, triceps brachii, deltoid, ECU, ECR, FCU, FCR, gracilis, interkostalrom, magemusklene, lateral dorsi, spiserør, sternocleidomastoideus, hjerte, nyre, og lever i små seksjoner ca 1 til 1,5 cm i lengde. Rull mellomgulvet opp og deretter klippe den i 1 - 1,5 cm seksjoner 56.
    5. Plasser tragantgummi, slik at det er tilnærmet 0,5 - 1 cm tykk på korkplater. Etikett plater med dyrets identifikasjon og muskel navnet på den motsatte side av tragantgummi.
    6. Plassere muskler med sin lengdeakse vinkelrett på korken i tragantgummi.
    7. Plasser korkene i en beholder av isopentan som sitter i flytende nitrogen. Flytt den rundt hele tiden med pinsett i 1 min eller til det er helt frossen. Lagre musklene på korkeri ampuller ved -80 ° C. Ved transport sette ampuller på tørris.
    8. Forbered glass merket med dyr identifikasjon / muskel navn og dato.
    9. I en cryostat avkjølt til -25 ° C, montere kork til stativet. Still seksjon tykkelsen til det ønskede nivå. Bruk 8 mikrometer for immunhistokjemi og 12 mikrometer for hematoxylin og eosin (HE) farging. Bruk 15 mikrometer for Western blot prøver. Trim om lag en fjerdedel av muskel å få en flat muskel for riktig muskel prøvetaking.
    10. Kutte en del av muskler på en gang, legger hver 6. avsnitt på samme glass lysbilde hvis du planlegger å bruke prøvene for immunhistokjemi eller HE flekker. Hvis du bruker prøver for Western blot, satte 30 - 40 seksjoner i et rør og oppbevar ved -80 ° C.
    11. Etter preparering av objektglass, la slides tørke i 1,5 timer ved romtemperatur. Oppbevares lysbilder ved -80 ° C.

    8. Immunohistokjemi

    1. Fjern forberedt lysbilder fra lagring og plassere dem iet fuktkammer for å holde skinnene separert og opprettholde fuktigheten. Fyll fuktighet kammeret slik at bunnen er bare dekket med vann (ca. 1 mm vann).
    2. Lufttørke i 0,5 timer. Tegn en firkant som omslutter muskelprøven på lysbildet ved hjelp av en hydrofob barriere penn.
    3. Tilsett 15% geiteserum i fosfatbufret saltvann (PBS) og inkuberes i 2 timer ved RT Ved blokkering reagens.
    4. Legg anti-dystrofin stang domene (DYS-1) mus monoklonalt primært antistoff, eller C-terminale monoklonalt antistoff (DYS-2) for hund dystrofin farging (1: 150 fortynning). Fortynn ved hjelp av et blokkeringsmiddel i 1,25 ml PBS. Inkuber O / N i et kjøleskap en 4 ° C.
    5. Vask med PBS i 5 minutter, gjentatt tre ganger. Legg sekundært antistoff Alexa 594 geit-antistoff mot mus lgG1 (for DYS-2) eller IgG2 (for DYS-1) (1: 2500). Fortynn med et blokkerende reagens i PBS inneholdende 0,1% oktylfenol-etoksylat. Inkuber i 0,5 timer ved romtemperatur.
    6. Vask med PBS i 5 minutter, tre tIME. Tillat lysbilde tørke. Legg 1 - 2 dråper (3 ng / ml) av 4 ', 6-diamidino-2-fenylindol (DAPI) monteringsløsning. Ved hjelp av pinsett, plassere et glass slip over toppen av delene, unngå bobler.
    7. Vis dystrophin- (DYS-1 / DYS-2) positive fibre i fluorescerende mikroskop ved 594 nm på 20X forstørrelse.

    9. Western blotting

    1. Legg innsamlede muskel seksjoner fra Cryo-seksjonering til 150 ul prøve buffer på is.
    2. Ved hjelp av en hånd homogenisator, kort homogenisere proteinprøver. Varme prøver i et 1,5 ml rør i en varmeblokk inkubator ved 95 ° C i 3 - 5 minutter. Sentrifuger ved 16500 x g i 15 min, og samle supernatanten.
    3. Oppbevar alikvoter av supernatanten ved -70 ° C. Bruk destillert vann for å fortynne til 100x.
    4. Bestem proteinkonsentrasjonen ved hjelp av et kommersielt sett i overensstemmelse med fabrikantens protokoll. Legg 2x Laemmli SDS-lasting buffer til prøver og varme i 3 min &# 160, ved 95 ° C.
    5. Belastningsprøver i 3 - 8% Tris-acetat gel før kjøring av det i 3 timer ved 150 V. inkluderer flere fortynnet villtype (WT) prøver (f.eks, 1%, 10% og 50%) for kvantifisering. Mindre enn 1 vekt% nivå av dystrofin skal påvises med denne metoden.
    6. Plassere gelen på katoden buffer i 20 min. I løpet av denne tid og ta ni biter av filterpapir og sette dem i overføringsbuffer (3 papirer i katoden buffer [+], anoden buffer ([-], og den konsentrerte anodebuffer [-], henholdsvis) Et. beskriver en halvtørr overføringsmetode som øker sensitiviteten (figur 6).
    7. Sug en PVDF membran i metanol i 20 sekunder og deretter plassere i anoden buffer.
      Sett opp gelen med membranen for semi-tørr overføring og la den gå 1,5 time ved 400 mA i RT eller i et kaldt rom.
    8. Vask membranen med PBS. Inkuber membranen i en blanding av PBS med Tween 20 (PBST) og 5% melkepulver i 2 timer.
    9. Fortynn DYS-1 (primære antistoff) i PBST og 5% melkepulver blandingen til en 1: 100 fortynning. Legge den til membranen og la det inkuberes i minst 1 time. Vask tre ganger med 100 ml PBST, 15 minutter hver.
    10. Legg 65 pl / kjørefelt av HRP-konjugert sekundært antistoff (anti-mus IgG2a for DYS1) ved 1: 5000 fortynning i 1 time ved romtemperatur i et mørkt område. Deretter vaskes med tre ganger med 200 ml PBST i 20 min. Bland løsninger fra en oppdagelse kit som anvist. Inkuberes i 1 min.
    11. Utvikle film å oppdage band og analysere med ImageJ programvare 48,57,58.

Representative Results

In vitro-forsøk

Myoblasts ble transfektert med ulike 2'OMePS behandlingsforhold for å sammenligne effektiviteten til hver AON. Enkelt AON behandlinger med 600 nM hver av Ex6A, Ex6B, Ex8A eller Ex8B ble gjort, samt en cocktail behandling med 600 nM hver av alle 4 AON sekvenser. RNA-prøver ble samlet fire dager etter transfeksjon. Etter RT-PCR, ble prøver for hver behandling kjørt på en gel sammen med ikke-behandlede (NT) prøver. Bånd høyere på gelen representerer ut-av-ramme DMD produkter; disse bandene ble sett i NT, Ex8A, og Ex8B behandlet myoblasts. Ex6A, Ex6B, Ex8A, og cocktail-behandlet myoblasts viste i-frame produkter. Den cocktail og Ex6A / B viste 100% i-frame produkter, mens Ex8A viste bare 30% i-frame produkter (figur 7). For å bekrefte ekson hoppe og restaurering avleserammen, cDNA-sekvensering ble utført; Resultatene indikerte at exon 6 - 9 faktisk hadde blitt hoppet over (figur 7). Immunhistokjemi viste at AON-behandlede hunder hadde økt dystrophin-positive fiber i forhold til NT prøver (Figur 8).

In vivo-forsøk

For å sammenligne effektiviteten av ulike AON behandlingsforhold, CXMD hunder - ble (0,5 5 år) injisert én gang med 1,2 mg Ex6A eller en cocktail av Ex6A, Ex6B, og Ex8A i ulike doser. To uker etter injeksjonen ble muskelprøver innsamlet og farget med DYS-1 for å sammenligne antall dystrophin-positive fibre. Alle cocktail-behandlede prøvene viste økt dystrophin uttrykk i forhold til NT prøver. Dystrofin-positive fibre økte med AON dosering (figur 9). Etter systemic injeksjon ble villtype (WT), NT, og cocktail-behandlede CXMD muskelprøver farget med DYS-1 (figur 10). Cocktail-behandlet CXMD hunder viste økt dystrophin uttrykk i forhold til NT CXMD hunder, både i CT og hjertemuskelprøver. Men AON behandlet muskulaturen (CT) viste mye høyere uttrykk av dystrophin forhold til behandlet hjertemuskelen. En immunoblot sammenligne WT, NT, og ulike morfolino cocktail-behandlet muskler førte til samme konklusjon. Det var også et stort utvalg av dystrophin uttrykk i de behandlede skjelettmuskelprøver (Figur 10). Hematoxylin og eosin (HE) farging viste at behandlet CXMD hunder viste forbedret histopatologi, med en signifikant reduksjon i sentral-kjerneholdige fibre (CNF) sammenlignet med NT CXMD hunder (figur 11). Dette indikerer at det er mer degenerasjon / regenerering forekommer i NT hund, et tegn på dystrofe muskelen patologi. I tillegg behandlet hundene hadde raskerekjøretider og bedre score på klinisk karakterskalaen. Behandlet CXMD hunder viste bedre score enn NT CXMD hunder i alle kategorier (figur 12).

Figur 1
Figur 1. Mutasjon mønster av CXMD Dog og Eksoner 6 -. 8 Hoppetau Strategier Bruke et anti Cocktail CXMD hunder har en punktmutasjon i ekson 6 fører til et tap av ekson 7 i dystrofe hund mRNA. Dette resulterer i mRNA blir ut-av-ramme og dystrofin proteinproduksjon går tapt. Korte AON sekvenser som er utformet for å binde seg til ekson 6 og 8, noe som resulterer i mRNA-spleising effektivt å hoppe eksoner 6 - 8. Det grå bar om AON cocktail-behandlede hunder representerer korte AON sekvenser. Exon 9 koder for et hengsel domene og er noen ganger spontant skjøtes med AONs mot exon 6 og 8. De resulterende mRNA koder for dystrofin proteiner som er kortere, men funksjonal. Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Store kliniske symptomer på en ett år gammel Canine X-bundet muskeldystrofi (CXMD) Animal. A 1-åring villtype beagle og en CXMD hund vises. Involvering av proksimale, lem, og tidsmessige muskler er vanligvis observert fra 2 måneders alder. Joint kontraktur og en forskyvning av bekkenet er åpen fra 4 måneders alder. Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. narkose for en hund. A) Intramuscular injeksjoner og muskelbiopsi utføres under generell anestesi med isofluran. B) Gjennomføring av dyret for systemiske injeksjoner. Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. Magnetic Resonance Imaging (MRI) av Wild-type, ikke-behandlede CXMD, og behandlet CXMD. MR av bakbenet på 3 måneder og 5 måneder i WT og NT CXMD hunder. To eksempler på bilder av behandlede CXMD bakben MRI pre- (en uke før første injeksjon) og etter injeksjon av AON vises. 2703MA ble behandlet 7x ukentlig med 200 mg / kg cocktail morpholinos. 2001MA ble behandlet med 5 x ukentlig IV-injeksjon av 120 mg / kg cocktail morpholinos. Kontroll og behandlet hundene var samme alder. Behandlede hunder viser redusert T2 signaler. Bildene er ADAP ted med tillatelse fra Yokota et al. (copyright 2009, John Wiley & Sons) 40 Klikk her for å se en større versjon av dette tallet.

Figur 5
Figur 5. musicelbiopsiprosedyren for en hund. A) En lavere lem er fast for muskelbiopsi. B) Ved hjelp av tang, er den nedre lem holdt. C) Et CT-muskelen er eksponert. Åpne biopsi teknikk som benyttes for å oppnå prøver av muskel injisert områder. Tråder brukes til å holde biopsiprøver. D) Muscle prøver på tragantgummi etter disseksjon. Klikk her for å se en større versjon av dette tallet.

/53776/53776fig6.jpg "/>
Figur 6. Semi-tørr overføringsmetode. En representasjon av den halvtørre overføringsmetode for Western blotting er presentert. Tre avisene dynket i konsentrert anode buffer er lagt ned på minuspolen; 3 papirer dynket i anode buffer er stablet oppå dette. Den Mb PVDF papiret er fuktet i metanol og deretter anode-buffer før de blir lagt på toppen av de 6 papirer. Den gel, som er blitt dyppet i katode-buffer, legges forsiktig over på PVDF-papir. Endelig er 3 papirer dynket i buffer katoden lagt på toppen av gelen. Den positive terminalen er satt på toppen. For en time, 400 mA kjøres gjennom systemet. Klikk her for å se en større versjon av dette tallet.

Figur 7
Figur 7. Exon Hoppetau i CXMD myoblasts. et al. (Copyright 2009, John Wiley & Sons) 40. Klikk her for å se en større versjon av dette tallet.

Figur 8
Figur 8. Økt Dystrophin Expression i 2'o-metylert phosphorothioate (2'OMePS) Transfekterte CXMD myoblasts. CXMD myoblasts ble transfektert med Ex6A alene eller sammen med cocktail 2'OMePS. DYS-2 (rød) og DAPI (blå) fargingen er vist. De behandlede myoblaster blir sammenlignet med villtype (WT) og ikke-behandlede (NT) myoblaster. Bildene er tilpasset med tillatelse fra Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 50 mikrometer. Klikk her for å se en større versjon av dette tallet.

Figur 9
Figur 9. Rescue av dystrophin Expression med intramuskulære injeksjoner av Morpholinos i CXMD Dogs. Enten Ex6A alene eller en cocktail av Ex6A, Ex6B, og Ex8A ble injisert i CT musklene CXMD hunder. Dystrofin (DSY-1) farging av villtype(WT), ikke-behandlede (NT), og behandlet CXMD hunder er vist. Hundene ble enten behandlet med 1,2 mg Ex6A alene eller 1,2 mg cocktail. Bildene er tilpasset med tillatelse fra Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 100 mikrometer. Klikk her for å se en større versjon av dette tallet.

Figur 10
Figur 10. Økt dystrophin Expression Etter Systemisk Cocktail Morpholino Behandling i CXMD Dogs. Dystrophin (DYS-1) farging ble brukt til å sammenligne dystrophin uttrykk i villtype (WT) (positiv kontroll), ikke-behandlede (NT) (negativ kontroll), og CXMD hunder behandlet med 120 mg / kg morfolino cocktail (40 mg / kg av hver AON). Den morfolino cocktail inneholdt Ex6A, Ex6B, og Ex8A. Hundene ble injisert intravenøst ​​5 ganger viekly med denne cocktail. A) En sammenligning av dystrophin uttrykk i kranie tibial (CT) musklene i WT, NT, og behandlede hunder. B) En sammenligning av dystrophin uttrykk i hjertet vev mellom NT og morfolino cocktail-behandlede hunder. C) Immun for dystrophin med desmin som en lasting kontroll er vist for WT, NT, og morfolino cocktail-behandlede hunder. Følgende musklene vises for behandlede hunder: triceps brachii (TB), biceps brachii (BB), diafragma (DIA), spiserør (ESO), CT, adductor (ADD), extensor digitorum longus (EDL), tygge (MAS), og hjerte. Bildene er tilpasset med tillatelse fra Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 200 nm. Klikk her for å se en større versjon av dette tallet.

Figur 11
Figur11. Forbedret Histopatologi i CXMD hunder behandlet i 7 uker med 240 mg / kg Morpholino Cocktail. CXMD hunder alt fra et halvt år til fem år gammel ble injisert intravenøst ​​med 240 mg / kg morfolino cocktail (Ex6A, Ex6B, og Ex8A) en gang uke i 7 uker. Fjorten dager etter siste injeksjon, ble spiserør muskler tatt og hematoxylin og eosin (HE) farging ble gjort. HE farging av spiserøret muskler fra ikke-behandlede (NT) og morfolino cocktail-behandlet (behandlet) CXMD hunder (40X objektiv). Klikk her for å se en større versjon av dette tallet.

Figur 12
Figur 12. Forbedret Score på Klinisk Grading og 15 m Spilletid Etter Morpholino Treatment. Morpholino-behandlede hunder ble sammenlignet med ikke-behandlede (NT) littermates. Feilfelt i grafen indikerer SEM. A) Total score på det kliniske gradering eksamenen ble beregnet før og etter behandling og behandlede dyr ble sammenlignet med NT littermates. B) En sammenligning av 15 m løpetider behandlet og NT hunder. C) På samme måte som B; imidlertid, ble unge hunder anvendt. Bildene er tilpasset med tillatelse fra Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Klikk her for å se en større versjon av dette tallet.

antisensoligonukleotid nukleotidsekvens
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

Tabell 1. antisensoligonukleotid Design.

Discussion

Exon hoppe er et lovende terapeutisk metode for behandling av DMD. Både in vitro og in vivo eksperimenter har vist at fler exon hopping er gjennomførbart. Her er anvendelsen av den CXMD hundemodellen diskutert. Først AONs ble utformet ved hjelp av Rescue-ESE og ESEfinder programmer for å målrette dystrophin eksoner 6 - 8. 2'OMePS AON kjemi ble brukt for CXMD myoblast transfeksjon og morpholino AON ryggrad kjemi ble valgt for in vivo eksperimenter. vPMOs er mer effektive enn umodifiserte PMOs men på grunn av deres høyere toksisitet er de ikke egnet for systemiske injeksjoner. RNA-ekstraksjon, RT-PCR og cDNA-sekvensering ble utført på CXMD myoblaster. Hunder injisert med PMO cocktail var klinisk gradert til å vurdere noen bedring i kliniske symptomer. Etter at hundene ble humant avlivet, ble muskelprøver tatt og forberedt for kryo-seksjonering. Halveringstiden av dystrofin protein indusert av AONS er antatt å være ca 1-2 måneder. Unge voksne hunder ble brukt i denne undersøkelsen, selv om disse eksperimentene kan gjøres med neonatale hunder og eldre hunder (> 5 år gamle). Preparerte muskel delene ble brukt til å evaluere histopatologi og vurdere dystrophin protein redning gjennom Western blotting og immunhistokjemi 48.

Det er viktig å sikre at volumet av den PMO oppløsningen er riktig før injeksjoner; unnlater å gjøre dette vil ha vesentlig innvirkning på resultatene. Under intramuskulære injeksjoner, er tilstrekkelig trykk nødvendig å gå inn i muskelfibrene. Overvåking av hund helse og inspeksjon av kirurgi området er viktig for feilsøking. For å overvåke dyrehelse, bør ukentlige blodprøver og veiing utføres. Etter euthanization av dyret og fremstillingen av muskelprøver, et kritisk trinn for å sikre sensitivitet ved påvisning av dystrofin-proteinet er å bruke både Tris-acetat gel og halvtørr blottingmetodeni løpet av Western blotting prosedyren.

Som vist i de representative resultater, myoblaster behandlet med Ex6A, Ex6B, Ex8A, og den cocktail (inneholdende Ex6A, Ex6B, Ex8A, og Ex8B) produsert i-ramme DMD-produkter. Siden Ex8B produserte ingen ekson-hoppet produkter, ble det ikke brukt i påfølgende in vivo eksperimenter. cDNA-sekvensering viste at exon 6 - 9 hopper forekom og immunocytokjemi med DYS-2-farging viste gjengitte dystrofin-ekspresjon i behandlede prøver. AON-behandlede hunder viste en signifikant økning i dystrofin-positive fibre. Dette indikerer at exon 6 - 8 var å være utelatt og en forkortet protein ble produsert. Mengden av dystrofin-positive fibere øker når en cocktail av AONs ble anvendt, og var proporsjonal med AON dosering. Immunoblotter viste økt dystrophin uttrykk i systemiske morfolino-behandlede hunder. Skjelettmuskulatur hadde varierende grad av dystrophin fiber; Men morfolino behandlet hjerte vev viste litenforbedring i dystrophin uttrykk. Siden dystrofin har en høy molekylvekt (427 kDa), kan påvisning av lave mengder av dystrofin være vanskelig. For best resultat, ble Tris-acetat gel og den halvtørre overføringsmetode som brukes. HE farging viste forbedret histopatologi i morfolino-behandlede hunder. Sentralt kjerneholdige fibre (CNFs) er et tegn på usunn muskel og representerer sykluser av muskel degenerasjon og regenerasjon. Morfolino-behandlede CXMD hunder viste en reduksjon i prosentandelen av CNFs i forhold til ikke-behandlede CXMD hunder. Klinisk gradering viste en bedring i symptomer, for eksempel økt gåing og løping evne, morfolino-behandlede dyr. Hardheten av muskler antas å reflektere muskelatrofi, og dermed ble det inkludert i sorteringsordningen 59. Hardheten av låret (hind-lem) muskler ble evaluert; imidlertid utelukket vi kranie Sartorius muskler fordi de har en tendens til å stille ut hypertrofi snarere enn svekket i CXMD. Behandlede hunder visered lavere gradering score og hadde raskere tider på 15 m løpetest. Bedre tider på 15 m test indikerer økt muskelfunksjon 40. Høyere totale gradering score indikerer dårlig helse og økt muskelatrofi.

Selv om disse resultatene er lovende, fortsatt presenterer multi-exon hopper mange utfordringer som må overvinnes før teknikken har klinisk anvendelse. Cardiac vev viser fortsatt redusert opptak av AONs, sannsynligvis på grunn av forskjellen i mobilhandel mellom hjerte- og skjelettvevet. Ingen giftige effekter er observert i dyr under dagens doseringsregime; men trenger mer arbeid som må gjøres for å vurdere langsiktig giftighet før bruk av AON cocktails kan flytte til kliniske studier. Det er vanskelig å få gjennomslag for AON cocktail narkotika fordi etatene definere hver AON sekvens som en unik narkotika. Dette betyr at hver sekvens i en cocktail ville trenge å bli testet individuelt for ovy, som krever mer tid og mer penger. Et annet hinder for bruk av multi-exon hoppe i et klinisk miljø er en stor mengde mellomproteinprodukter fremstilt med ukjente funksjoner. Disse proteinene kan potensielt føre til uforutsigbare bivirkninger, avhengig av den enkelte mutasjon 22. I tillegg er mutasjonsmønstre som er tilgjengelige i dagens dystrofe hunde modeller er begrenset. Det er få naturlig forekommende mutasjoner, og ikke alle mutasjoner er nyttige for å studere fler exon hopping. Den dystrofe gris modell lover å være et godt alternativ for framtidig DMD exon hoppe studier 33, 34.

DMD hunde modellene har noen fordeler fremfor andre DMD-modeller. Å være en større dyremodell, klinisk gradering og MR er mulig, noe som åpner for mer detaljerte analyser. Siden hunder er store dyr er de også mer egnet for toksikologiske studier og nærmere representere den humane sykdommen i forhold til musemodell. Dog models har også DMD gensekvenser som er mer like mennesker 23, 34, 45.

Selv om teknisk utfordrende, kan multi-exon hoppe tilnærming slutt nytte> 90% av DMD pasienter 24. Dette gjør det til et mye bedre alternativ til single-exon hoppe, som single-exon hoppe gjelder kun for en liten del av pasientene. I tillegg vil flere exon hoppe gjør oss i stand til å velge sletting mønstre som optimaliserer funksjonaliteten til de forkortede dystrophin proteiner. For eksempel sletting av DMD eksoner 45 - 55 er forbundet med svært milde symptomer eller asymptomatiske individer 14,19,60-63. Den multi-ekson hopper av eksoner 45 - 55 er allerede blitt påvist i en musemodell av DMD med en exon delesjon 52 (mdx52) under anvendelse av systemiske injeksjoner av vPMOs 22,26. Bruken av cocktail vPMOs har også blitt demonstrert i andre former for muskulær dystrofi, sliksom Fukuyama medfødt muskeldystrofi (FCMD). FCMD er forårsaket av exon fangst, der avvikende mRNA skjøting er forårsaket av retrotransposon innsetting. vPMOs har blitt vist å redde skjøtemønsteret i både en FCMD musemodell og i humane cellelinjer 64. Neste generasjons AON kjemi stiller høyere effekt og lavere toksisitet vil lette den faktiske oversettelsen av multi-exon hoppe tilnærming til klinisk anvendelse. I tillegg, multi-ekson hopper kan potensielt brukes på andre genetiske sykdommer, slik som dysferlinopathies 24, 65.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
Multi-exon Hoppe Bruke Cocktail Antisenseoligonukleotider i Canine X-linked muskeldystrofi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter