Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Multi-пропуск экзонов Использование Коктейль антисмысловые олигонуклеотиды в собачьих Х-хромосомой мышечной дистрофии

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

Пропуск экзонов в настоящее время является наиболее перспективным методом лечения мышечной дистрофии Дюшенна (МДД). Для того, чтобы расширить применимость для пациентов с МДД и оптимизировать стабильность / функции полученных усеченных дистрофина белков, был разработан мульти-пропуска экзонов подход с использованием коктейль антисмысловые олигонуклеотиды и мы продемонстрировали системное дистрофина спасение в модели собаки.

Abstract

Мышечная дистрофия Дюшенна (МДД) является одним из наиболее распространенных смертельных генетических заболеваний во всем мире, вызванных мутациями в дистрофина (DMD) гена. Пропуск экзонов используются короткие ДНК / РНК-подобные молекулы, называемые антисмысловые олигонуклеотиды (АОН), которые восстанавливают рамку считывания и производят более короткие, но функциональные белки. Однако пропуска экзонов терапия сталкивается с двумя основными препятствиями: ограниченную применимость (только до 13% пациентов можно лечить с помощью одного препарата AON), а также неопределенную функцию укороченных белков. Эти вопросы были рассмотрены с коктейлем AON подхода. В то время как около 70% пациентов с МДД можно лечить с помощью одного пропуска экзона (экзоны все вместе взятых), можно было бы потенциально относиться к более чем 90% пациентов с МДД, если несколько пропуска экзонов с использованием антисмысловых коктейль препаратов могут быть реализованы. Собачьей Х-хромосомой мышечной дистрофии (CXMD) модель собаки, чей фенотип больше похож на пациентов с МДД человека, был использован для тестирования системного efficНКД и безопасность мульти-пропуск экзонов экзонов 6 и 8. модель собака CXMD таит в сплайс - сайт мутации в интроне 6, что приводит к отсутствию экзон 7 мРНК дистрофина. Для восстановления рамки считывания в CXMD требует нескольких пропуска экзона экзонов 6 и 8; Таким образом, CXMD хороший среднего размера модели на животных для проверки эффективности и безопасности мульти-пропуск экзонов. В текущем исследовании, коктейль из антисмысловых Morpholinos таргетингом экзона 6 и 8-й экзон был разработан и восстановлен экспрессию дистрофина в теле для всей скелетной мускулатуры. Способы трансфекции / инъекции коктейля олигомеров и оценки эффективности и безопасности многоосных пропуска экзона в модели собаки CXMD представлены.

Introduction

Мышечная дистрофия Дюшенна (МДД) является Х-хромосомой рецессивное заболевание мышц характеризуется прогрессирующей мышечной слабостью, впервые описанный доктором Гийом-Benjamin-Аманд Дюшенна (де Булонь) 1. DMD является распространенное генетическое заболевание , поражающее примерно 1 из 3500 мальчиков по всему миру, с примерно 20 000 пострадавших детей , рожденных каждый год 2,3. Разработка двигателя задерживается и нарушения походки проявляются в раннем детстве 4, а затем пользоваться креслом - коляской приблизительно в раннем подростковом возрасте. Смерть обычно происходит в возрасте от 20 до 30 лет из - за дыхательной или сердечной недостаточности 5-8. Там в настоящее время нет лечения для МДД. Лечение глюкокортикоидами может замедлить прогрессирование дегенерация мышц в какой - то степени , но связано со значительными побочными эффектами, включая ожирение и сахарный диабет 2,7,8. МДД является результатом мутации в дистрофина (DMD) гена, что приводит к потере функциональных дистрофина Proteiп. DMD является чрезвычайно большой ген с более чем 2 миллиона пар оснований и 79 экзонов 9,10. Делеции, нонсенс, и дублирование мутации, приводящие к вышедших из кадра мутаций являются наиболее частой причиной фенотипа МДД. Области экзонов 3 - 9 и экзонов 45 - 55, называются «мутационные горячие точки" , поскольку большинство пациентов имеют делеции мутации в пределах этих участков гена, что приводит к нефункциональным дистрофина у пациентов с МДД 3,9,11-16. Дистрофина функций в рамках дистрофина-гликопротеина комплекса (DGC), который играет важную роль в стабилизации мышечной мембраны. N- и С-концы являются наиболее важными для функции домены, в то время как центральный домен стержень играет менее важную роль 3,9,17. Соблюдение мягкого фенотипа , связанного с мышечной дистрофии Беккера (БМД), которая в основном является результатом в рамке мутации в гене дистрофина, вдохновленный применение пропуска экзонов для лечения МДД. Пациенты BMD имеют укороченный, но functionaл, белок дистрофина , который поддерживает как TERMINI 3,6,18. Пропуск экзонов, в теории, может восстановить рамку считывания, в результате чего укороченных-но-функциональных белков дистрофина , подобных тем , которые наблюдаются в БМД 3,19.

Несколько типов антисмысловые олигонуклеотиды (АОН) были протестированы в клинических испытаниях, в том числе 2'O-метилированных фосфоротиоатов (2'OMePS) и phosphorodiamidate морфолино олигомеров (PMOS). Пропуск экзонов 51 и 53 с использованием этих AONs был рассмотрен и в то время как результаты являются многообещающими, одной пропуск экзонов имеет ограниченную применимость, так как она является мутация конкретных 3, 19, 20,21, 22-26. Вопросы остаются о стабильности полученных укороченных дистрофина белков , полученных из одного пропуска экзонов 22,23. Кроме того, некоторые пациенты требуют более чем одного экзона, пропускаемых, чтобы восстановить рамку считывания 3. В то время как технически более сложным, мульти-пропуск экзонов один метод, которыймогли бы решить эти проблемы 3,19. Мульти-пропуск экзонов ранее была продемонстрирована в дистрофических собак и линий клеток человека в лабораторных условиях . Кроме того, mdx52 мыши и собачьи модели собаки Х-сцепленные мышечной дистрофии (CXMD) были использованы для Исследования in vivo 22, 24-27. Собачий Х-хромосомой мышечной дистрофии Япония (CXMD J) здесь гончие были использованы, так как рамка считывания из CXMD J может быть восстановлен с помощью нескольких пропуска экзона экзонов 6 и 8, или дополнительных экзонов (например, экзоны 3 - 9) (рис 1). Бигль на основе CXMD разделяет ту же схему мутации как модель Golden Retriever мышечная дистрофия (GRMD), но гончие имеют меньшие размеры и дешевле в обслуживании из - за их размера тела, обеспечивая тем самым полезную модель для МДД 28,29. CXMD собаки более тесно имитировать человеческий фенотип DMD , чем меньшие модели животных, как грызуна, и являются более надежными для оценки токсикологических 3,22,30,31 (Рисунок 2). CXMD собаки дисплей прогрессивное загнивание мышц, нарушения походки, а также сердечной и дыхательной проблемы, аналогичные тем, которые наблюдаются в ДМД. По сравнению с одним пропуска экзона, мульти-пропуск экзона применим к гораздо большей части пациентов. Среди трех наиболее распространенных типов мутаций (делеции, нонсенс, и дублирующие), 80 - 98% пациентов можно лечить с помощью нескольких пропуска экзонов 14,32,33, в то время как 45% всех пациентов с МДД может извлечь выгоду из специально пропуске экзонов 45 - 55 3,19,22,34.

С развитием модифицированных Morpholinos, эффективность AON коктейлей на облегчение пропуска экзона улучшилось. Аргинин богатых клеток-проникающей пептид-конъюгированного СВУП (PPMOs) и естественных условиях Morpholinos (vPMOs) являются AON биохимический , что значительно улучшилась , клеточную проникающую способность и стабильность 3,35-38. Сохраняется озабоченность в долгосрочной AON токсичности; Тем не менее, значительный прогрессбыло изготовлено. Химические изменения , внесенные в Morpholinos значительно уменьшить вне цели эффекты и доклинические исследования не сообщали о каких - либо существенных токсических эффектов 3,22,39,40. Оставшаяся задача для мульти-пропуска экзона является текущим требованием для каждого отдельного AON быть проверены на токсичность в одиночку, как один препарат, а не вместе , как коктейль 3,19,22,41,42. В исследованиях с участием как DMD с одним и несколькими пропуска экзона ориентированы на сердце, было мало улучшение дистрофии сердечной ткани. Эффективность Morpholinos в сердце, как полагают, будет низкой из-за плохой клеточной проникающей способности. Пептидные-конъюгированные PPMOs улучшили способность AONs проникнуть на кардиомиоциты, увеличивая количество функционального белка дистрофина спасенных в сердце 3,19,38.

Вот, наш AON коктейль подход подробно обсуждается, в том числе при разработке AON последовательностей с использованием программного обеспечения ESEfinder 43. Protocолы для экспериментов собака с несколькими пропуска экзона также описаны. CXMD J гончие использовались для экзонов 6 и 8 пропуске экспериментов. Multi-пропуска экзонов в модели собаки CXMD показывает обнадеживающие результаты, но проблемы остаются, которые необходимо преодолеть, прежде чем они клинически применимы.

Protocol

Все протоколы, перечисленные ниже, в соответствии с руководящими указаниями по уходу за животными, установленными Национальным центром неврологии и психиатрии (NCNP) в Японии. Все эксперименты были одобрены Institutional Animal Care и использования Комитетом по NCNP.

1. Конструкция антисмысловые олигонуклеотиды

  1. Используйте спасательные ESE и программы ESEfinder для обнаружения ESE сайтов 44, 45-47.
  2. Конструкция 25 пар оснований (п.о.), последовательности, которые являются антисмысловыми для экзонов, которые должны быть направлены. Целевые экзонов 6 и 8 в модели собаки (рисунок 1).
    1. Используйте 25 - 30 п.н. последовательности для метеорологов (таблица 1) или 25 пар оснований для 2'OMePS. Для разработки 25 последовательностей Б.П., выберите последовательности, которые находятся в пределах целевой области. Рассмотрим вторичную структуру, избегание гетеродимеров, экзон сплайсинга усиливающие мотивы и содержание GC для создания стабильных последовательностей 43. AONs должны быть направлены по меньшей мере, один из ESE участков, определенных вышеупомянутым Софtware.
    2. Выберите AONs с содержанием GC, что составляет менее 65%, с менее чем 4 последовательных 'G, и не содержат самодополнительных последовательностей. Используйте программное обеспечение Blast NCBI для прогнозирования офф-мишени сайты отжига 22,48,49.
  3. Выберите соответствующий AON магистральную химии. Для экспериментов в пробирке использовать 2'O-метил олигонуклеотиды (2'OMePS) или Morpholinos. Для экспериментов в естественных условиях, использовать 2'OMePS, Morpholinos или vPMOs. 3,19,48,50

2. В пробирке эксперименты (экзонов 6 и 8 Пропустив в CXMD модели)

  1. 2'OMePS Трансфекция миобластов собак
    1. Культура CXMD миобласты в 3 мл среды для роста в 6-луночные планшеты. Seed 1 - 5 х 10 3 клеток / см 2 с 0,5 мл / см 2 среды для миобластов. Для ростовой среды используют модифицированную среду Дульбекко Игла (DMEM) с добавлением 10% эмбриональной телячьей сыворотки (FBS) и 1%пенициллина / стрептомицина (P / S) 40.
    2. Инкубируют при 37 ° С до 60 - 80% сплошности. Это занимает примерно от 12 до 24 ч.
    3. Развести катионной липосомы трансфекцию агента в общей сложности до 100 мкл в уменьшенной сыворотки среде (2: 1 соотношение трансфекцию агента: AONs, например, 10 мкл липофектина против прогноза 5 мкг AONs). Разрешить смесь выдерживают при комнатной температуре в течение 30 - 45 мин.
    4. Развести AONs (2'OMePS или Morpholinos) до конечного объема 100 мкл в уменьшенной сыворотки среде.
    5. Смешайте разбавленный трансфекцию агента с разбавленных AONs и инкубировать при комнатной температуре в течение 10 - 15 мин.
    6. В то время как трансфекция агент / AON смесь сидит при комнатной температуре, удалите старые носители из клеток с помощью аспирации и мыть клетки со средствами массовой информации.
    7. Добавьте 0,8 мл среды для трансфекции агента / AON смеси, а затем добавить весь раствор в свеже-промытых клеток. Выдержите в течение 3 ч при 37 ° С.
    8. После инкубирования, замените носитель с differentiatионных медиа (ДМ); дифференциация может занять до 10 дней. Проверьте, чтобы увидеть, имело ли место дифференциация начиная примерно с 3-й день Дифференцировка медиа является DMEM с 2% лошадиной сыворотки, 200 ед / мл пенициллина, 200 мг / мл стрептомицина и 10 мкг / мл инсулина.
  2. Morpholino Трансфекция миобластов собак
    1. Культура CXMD миобластов в среде роста, как описано в шаге 2.1.
    2. Переход к дифференциации среды (DM), и добавьте 0,1 ммоль запаса морфолино в каждую лунку, чтобы конечная концентрация 1 мкМ. Тепло коктейль Morpholinos при 65 ° С в течение 10 мин до трансфекции или инъекции, чтобы избежать агрегации AON. Добавление реагента пептидного доставки 39,51 и регулировать до конечной концентрации 3 - 6 мкм.
    3. Через 16 - 48 ч инкубации, собирают клетки для экстракции РНК. Добавить 1 мл кислоты гуанидина тиоцианата-фенол-хлороформа к клеткам, чтобы отделить клетки от пластины. Выполнение РНК Extracции после этого шага.
      1. В качестве альтернативы, добавьте трипсина, так что она охватывает все элементы и инкубировать в течение 2 мин при 37 ° С.
        Примечание: Если вы намерены выполнить иммунохимия, использовать камерных слайд-очки для культивирования. После дифференцировки клетки могут быть зафиксированы с помощью параформальдегида (PFA) (4% в течение 10 мин).
  3. Экстракция РНК и обратной транскрипции полимеразной цепной реакции (ОТ-ПЦР)
    1. После того, как клетки дифференцируются в мышечные трубки, удалить среднего и добавьте 1 мл кислоты гуанидина тиоцианата-фенол-хлороформ; инкубировать в течение 10 мин при комнатной температуре.
    2. Передача в 1,5 мл пробирки. Совместимый с 200 мкл хлороформа и инкубируют при комнатной температуре в течение 2 мин до тех пор, три отдельных слоя не могут быть видны. Три слоя сверху вниз: РНК-слой, слой ДНК, и слой белка.
    3. Центрифуга при 12000 х г в течение 15 мин при температуре 4 ° С. Снимите верхний супернатант слой и поместите в пробирку с 500 & #181; л изопропанола (если остановка здесь, хранить супернатант при -80 ° С). Центрифуга супернатант при 12000 х г в течение 10 мин при 4 ° С; после того, как центрифугирование, сохранить полученный осадок РНК и отбросить супернатант.
    4. Промывают осадок этанолом и центрифуге при 8000 х г в течение 5 мин при 4 ° C. Выпаривают остаточного этанола путем переворачивания пробирки в течение 15 мин, а затем добавляют 15 - 30 мкл РНКазы без воды. Количественно общую концентрацию РНК с помощью США / VIS спектроскопии при 260 нм.
    5. Смешайте необходимые реагенты для реакции RT-PCR: 1,5 мкл 10 мкМ праймера, 1,5 мкл 10 мкМ обратного праймера, 1 мкл дНТФ, 5 мкл одностадийного ПЦР-комплект буфера, ингибитора РНКазы 0,7 мкл, 1 мкл фермента смесь из одно- шаг ПЦР-комплект и 200 нг РНК. После того, как они были смешаны, добавляют воду до конечного объема 25 мкл.
    6. Поместите смесь в термо-термоячейке. Запуск 30 мин цикл при 50 ° С, 15 мин0; цикл при 95 ° С, затем 35 циклов при 94 ° С в течение 1 мин, 60 ° С в течение 1 мин и 72 ° С в течение 1 мин. И, наконец, запустить 10 мин цикл при 72 ° C. Хранить продукт ПЦР в холодильнике при 4 ° С или -20 ° C
  4. Комплементарной ДНК (кДНК) Секвенирование
    1. Определение экзоне 6 - 9-пропуски полос с помощью электрофореза в агарозном геле. Нагрузка 5 мкл каждого образца в лунки геля агарозы 1,5%, которыми управляют 135 V через гель в течение 5 мин, а затем 120 В в течение 20 мин. Затем, инкубировать гель в геле ДНК красителем при комнатной температуре в течение 30 мин. Визуализируйте полосы с помощью программного обеспечения визуализации.
    2. Акцизный Соответствующую полосу с использованием набора для экстракции геля.
      1. Вырежьте фрагмент ДНК и солюбилизации кусочек геля с использованием 200 мкл NTI мг геля / 100. Пусть это сидеть в течение от 5 до 10 мин в C водяной бане при 50 °. Затем передать Silica мембраны трубку.
      2. Центрифуга при 11000 мкг в течение 30 сек. Промыть дважды 700 мкл буфера NT3 перед СЕснова ntrifuging при 11000 мкг в течение 30 сек.
      3. Сушат мембрану кремнезем путем центрифугирования при 11000 х г в течение 1 мин.
      4. Добавить 15 - 30 мкл буфера NE и позволить ему сидеть при комнатной температуре в течение 1 мин. Затем центрифуге при 11000 мкг в течение 1 мин. Удалите силикагель и сохранить содержимое в трубе.
    3. С помощью набора для секвенирования для определения последовательности в соответствии с протоколом производителя.

3. внутримышечных инъекциях или Open биопсию мышцы

  1. Для обеспечения стерильных условий во время операции выживания, удаления волос с помощью машинки для стрижки в районе, прилегающем к месту хирургии (задних конечностей). Используйте йодофоры или хлоргексидин в качестве дезинфицирующего средства. Используйте стерильными пеленками для хирургического участка путем размещения и закрепления их в течение всего животного и операционный стол.
    1. Носите чистые скрабы, маски для лица, головной убор, стерильные перчатки и специальную обувь для операционной 52,53.
    2. </ Ол>
    3. Вводят CXMD собак с 20 мг / кг тиопентала натрия обезболить их. Используйте ветеринара мазь для глаз, чтобы предотвратить глаз от высыхания.
    4. Используйте 2 - 3% изофлуран ингаляции для поддержания общей анестезии (рисунок 3). Проверьте мышечные рефлексы и контролировать сердце и частота дыхания, чтобы оценить глубину анестезии. Нормальная частота дыхания (RR), частота сердечных сокращений (ЧСС), и SpO 2 под общим наркозом следующим образом : ОР: 10 - 20 вдохов / мин; SpO 2: 95 - 100%, HR: 80 - 120 ударов в минуту (BPM).
    5. Используя скальпель, порезать кожу над черепной большеберцовой (CT), также известный как передней большеберцовой (TA) и сделать один разрез приблизительно 5 см в продольном направлении (для молодых взрослых собак). Для того, чтобы отметить места инъекций, стежок глубокую фасцию с использованием хирургической иглы и хирургической нити и сделать два маркера стежка с интервалом 2 см.
    6. Вводят желаемую концентрацию AONs в мышцу с иглой 27 G. Нужный концентрарация варьируется от условий обработки. Для КТ, дают две инъекции объемом 1 мл каждый, в общей сложности на 1,2 мг коктейльных СВУП (0,4 мг каждый PMO) или 0,4 мг коктейль vPMOs (0,13 мг каждый vPMO). Для локтевого разгибателя запястья (ECU) мышцы передней конечности, вводят два объема 0,5 мл каждая на общую сумму 1,2 мг коктейльных СВУП (0,4 мг каждый PMO) или 0,4 мг коктейль vPMOs (0,13 мг каждый vPMO). Оставьте иглу в течение 1 мин. Используйте равное количество каждого AON для коктейля.
    7. Выполнение открытой биопсии мышц путем удаления кусок мышечной ткани около 2 см в длину от КТ мышцы с помощью хирургического скальпеля.
    8. Переходите к шагу 6.5 для подготовки мышц образца.
    9. С помощью иглы, управлять внутримышечную инъекцию 0,02 мг / кг гидрохлорида бупренорфина до пробуждения от общей анестезии. Lay мышечной фасции и кожу обратно на мышцы и сшить их, используя рассасывающиеся нити 3-0 и 3-0 нейлоновой нити для мышечной фасции и закрытия кожи, respectivEly.
    10. Удерживая открыть рот, определить, является ли вернулся рвотный рефлекс; когда рвотный рефлекс вернулся, экстубации собаку.
    11. Администрирование от 15 до 30 мг / кг цефазолин или цефалексин (антибиотики) в течение 3 дней с помощью внутривенной или внутримышечной инъекции, чтобы предотвратить инфекцию.
    12. Удалить швами в течение семи дней. Не оставляйте собаку без присмотра, пока он не пришел в сознание достаточное для поддержания грудины лежачее и не позволяйте собаке взаимодействовать с другими животными, пока полное восстановление не сделано. Хранить эндотрахеальной трубки на месте до тех пор, как это возможно, и удалить их, когда животное начинает жевать или глотать. Монитор животного сердечного ритма, дыхания и гидратацию, чтобы убедиться, что они являются стабильными и в пределах нормы.
    13. Для ухода за послеоперационной, обеспечивают обезболивание в течение 3 дней (например, бупренорфин 0,01 мг / кг) и поддержки престарелых, в том числе в тихом, темном месте отдыха, соответствующей раны и поддержания бандаж, мягкийотдыхая поверхность, регидратация с устными или парентеральных жидкостей, а также возвращение к нормальной кормления за счет использования очень вкусной пищей или лечит. Если какие-либо животные требуют дополнительного лекарства, внутримышечной инъекции 0,3 мг / кг буторфанола тартрата в зависимости от симптомов боли.
      Примечание: Собаки в боли может укусить, царапина, или охранять болезненные участки, и если обращаться с ними, может быть необычно опасающийся или агрессивным. Кроме того, боль в одной конечности обычно приводит к хромоте или удерживаемого планом пораженной конечности с попытками использовать его. В таких ситуациях, внутримышечной инъекции 0,02 мг / кг бупренорфина гидрохлорида каждые 6 - 8 ч.

    4. Системные Инъекции

    Примечание: Эту процедуру можно повторять раз в неделю или раз в две недели в течение требуемого количества недель.

    1. Сдерживать собак вручную и осторожно, получая собаку лечь, а затем задрапировать руки на плечи и бедра, чтобы держать собаку на месте на протяжении тПроцедура он.
    2. Вводят AONs; 120 - 240 мг / кг коктейль СВУП (40 - 80 мг каждый AON) с использованием венозного пребывающего иглу в вену конечности (известный как головное или в подкожную вену). Количество AON впрыскивается зависит от условия эксперимента. Используйте равное количество каждого AON для коктейля.
    3. Используйте инфузионный насос или драйвер шприца впрыснуть 50 мл общего со скоростью 2,5 мл / мин в течение 20 мин, в соответствии с инструкциями изготовителя. Повторные инъекции еженедельно или раз в две недели (каждые две недели), по крайней мере в 5 раз, а экспрессия дистрофина будет скапливаться при повторных инъекций.
    4. Провести анализы крови еженедельно для изучения токсичности.
      1. С помощью иглы, собрать 3 мл крови - 0,5 мл для полного анализа крови (CBC) и 2,5 мл для других - от одного из подкожных вен на передний план или задних конечностей. Включите CBC, гамма-глутамилтрансферазы (ГГТ), аспартатаминотрансферазы (АСТ), азота мочевины крови (АМК), аланин aminotransferase (ALT), креатинкиназы (CK), а также оценки креатинин при тестировании собранной крови, следуя инструкциям производителя от анализа крови комплектов. 40,54

    5. Клиническая классификация собак

    1. Настройка видеокамеры и записывать поведение собаки и походку. Запишите всю встречу с собакой, так как это будет действовать в качестве эталона при классификации собаки; это означает, что каждое видео будет разной длины в зависимости от способностей и желания собаки. Используйте параметры записи по умолчанию. Съемки фильма создает запись о классификации, поэтому он может быть рассмотрен на более позднем этапе.
    2. Оценка походки и движения нарушения.
      1. Для походки и движения нарушений, используйте следующие классы:
        не класс 1 = нет, класс 2 = сидя с задней конечности продлен, 3 класс = Зайка-хмель с задних конечностей, 4-й степени = перетасовка ходьбы, и 5-го класса = не в состоянии ходить.
      2. Для нарушения подвижности используйте следующие классы: Класс 1 = нет, грADE 2 = лежа больше, чем обычно, класс 3 = не может прыгать на задних конечностей, 4 класс = возрастающей сложности передвигаться, и 5-го класса = Невозможно встать и передвигаться.
    3. Время, как долго это берет собаку бежать 15 м. Отмерьте 15 м, поместите собаку на стартовой линии и поощрять его не запускать до 15 м марки.
    4. Определить атрофию мышц конечности с помощью следующей оценочной шкалы:
      класс 1 = нет, класс 2 = подозреваемым твердость, 3 класс = не может чувствовать твердость или кажется тонким, 4 класс = от 3 до 5 классов, а 5-го класса = очень тонкие или трудно.
    5. Оценка не слюни, используя следующую шкалу: 1-й класс = нет, сорт 2 = иногда обводит слюну при сидении, струны слюни класса 3 = некоторые слюни, когда есть и пить, 4 класс = при приеме пищи или питья, и 5-го класса = непрерывного слюной.
    6. Оценка гипертрофия языка (макроглоссия), используя следующую шкалу: 1-й класс = нет, класс 2 = немного увеличено, класс 3 = расширенный outsiде дентиция, класс 4 = увеличенный и слегка загустеет, и 5-го класса = увеличенный и загустеет.
    7. Оценка способности собаки, чтобы проглотить, используя следующую шкалу: 1-й класс = без затруднений, класс 2 = занимает много времени и усилий в принятии пищи, 3-й степени = трудности при принятии пищи из пластины, 4 класс = трудности при жевании, глотании, или пить и 5-го класса = не в состоянии съесть.
    8. Вычислить общую оценку путем сложения баллов из каждой категории (для запуска теста 15 м , за исключением) 55.
      Примечание: исследования должны быть ослеплены, чтобы не вводить смещения.

    6. Магнитно-резонансная томография (МРТ)

    1. Используйте 3 Тесла (3T) МРТ и катушки диаметром человеческого оконечность 18 см / 18 см в длину, чтобы получить T2-взвешенные изображения задних конечностей.
    2. Обезболить животных путем введения CXMD собак с 20 мг / кг тиопентала. Используйте ветеринара мазь для глаз, чтобы предотвратить глаз от высыхания. Используйте 2-3% изофлуран ингаляции для поддержания общей анестезии.
      1. Проверьте мышечные рефлексы и контролировать сердце и частота дыхания, чтобы оценить глубину анестезии. Нормальная частота дыхания (RR), частота сердечных сокращений (ЧСС) и SpO 2 под общим наркозом следующим образом : ОР: 10 - 20 вдохов / мин, SpO 2: 95 - 100%, HR: 80 - 120 ударов в минуту (BPM ).
    3. Используйте следующие параметры для получения T2-взвешенные изображения: TR / TE = 4000/85 мсек, толщина среза = 6 мм, срез зазор = 0 мм, поле зрения = 18 см х 18 см, размер матрицы = 256 х 256, и количество приобретений = 3 во время быстрого спинового эха (рис 4).

    7. Мышцы Отбор и подготовка (Вскрытие)

    Примечание: Мышцы должны быть выбраны один или две недели после последней инъекции AON.

    1. Вводят собак с 20 мг / кг тиопентала натрия обезболить их. Используйте ветеринара мазь на глаза во время обезболиванием, чтобы предотвратить высыхание глаз.
    2. Используйте 2 - 3% изофлуран ингаляции для поддержания АНЭthesia. Проверьте мышечные рефлексы и контролировать сердце и частота дыхания, чтобы оценить глубину анестезии. Нормальная частота дыхания (ОР), частоту сердечных сокращений (HR) и ПОФ 2 под общим наркозом являются следующие: RR: 10 - 20 вдохов / мин; SpO 2: 95 - 100%, HR: 80 - 120 ударов в минуту.
      1. Эвтаназии собак от обескровливания под общим наркозом (только для аутопсии). Используйте обескровливания при глубокой общей анестезии , чтобы избежать эффектов , вызванных факторами крови , полученных в молекулярном анализе (например, сердечной мышцы).
    3. Проанализируйте следующие мышцы (рисунок 5): CT, разгибатель большого пальца (EDL), икроножной, камбаловидной, двуглавой мышцы бедра, прямая мышца бедра, двуглавой мышцы плеча, трехглавой мышцы плеча, дельтовидные, ECU, разгибателя лучевого (ECR), сгибателей Карпи локтевой (FCU ), Карпи сгибателей лучевого (FCR), гасШз, межреберные, брюшные мышцы, диафрагма, боковые мышцы спины, пищевод, кивательной, и сердце. Для изучения токсичности, собирать почки и Ливер образцов. Используйте Эванс и Александр де Lahunta (2009) в качестве эталона для техники рассечение 56.
    4. Обрежьте CT, EDL, икроножной, камбаловидной, двуглавой мышцы бедра, прямая мышца бедра, двуглавой мышцы плеча, трехглавой мышцы плеча, дельтовидной, ECU, ECR, FCU, FCR, гасШз, межреберные, брюшные мышцы, боковые мышцы спины, пищевод, кивательной, сердце, почки, и печень на небольшие участки примерно 1 - 1,5 см в длину. Раскатайте диафрагму , а затем разрезать его на 1 - 1,5 см 56 секций.
    5. Поместите трагаканта таким образом, что она составляет приблизительно 0,5 - 1 см толщиной на пробковых дисков. Этикетка дисков с идентификацией и мышц именем животного на противоположной стороне трагаканта.
    6. Поместите мышцы с их продольной оси, перпендикулярной к пробке в трагаканта.
    7. Поместите пробки в контейнер изопентана, который сидит в жидком азоте. Переместить его постоянно с помощью пинцета в течение 1 мин или пока полностью заморожены. Храните мышцы на пробкамиво флаконах при -80 & deg; С. При транспортировке, положить чаш на сухом льду.
    8. Подготовьте стеклянные слайды, меченные идентификации / названия мышц животного и дату.
    9. В криостат охлаждают до -25 ° C, установите пробку на стенд. Установить толщину профиля до нужного уровня. Используйте 8 мкм для иммуногистохимии и 12 мкм для окрашивания гематоксилином и эозином (HE). Используйте 15 мкм для западных образцов клякс. Обрежьте около одной четверти мышцы, чтобы получить плоскую мышцу для правильного отбора проб мышц.
    10. Режущий одну часть мышцы в то время, место каждые 6 - й раздел на том же стекле , если вы планируете использовать образцы для иммуногистохимии или HE окрашивание. При использовании образцов для вестерн-блоттинга, положить 30 - 40 секций в трубе и хранят при -80 ° С.
    11. После подготовки слайдов, пусть слайды высохнуть в течение 1,5 ч при комнатной температуре. Хранить слайды при температуре -80 ° C.

    8. Immunohistochemistry

    1. Удалить подготовленные слайды из хранилища и поместить их вкамеру влаги, чтобы сохранить слайды, разделенные и поддержания влажности. Заполнить камеру влаги так, чтобы нижний край только покрыта водой (примерно 1 мм воды).
    2. Воздух сухой в течение 0,5 ч. Нарисуйте квадрат, охватывающую образец мышц на слайде, используя гидрофобный барьер пера.
    3. Добавить 15% сыворотки козьего в фосфатном буферном растворе (PBS) и инкубируют в течение 2 ч при комнатной температуре в блокирующий реагент.
    4. Добавить анти-дистрофина домен шатуна (DYS-1) мышиное моноклональное первичное антитело или С-концевой моноклональные антитела (DYS-2) для собак дистрофина окрашивания (1: 150 разведение). Разбавляют с помощью блокирующего агента в 1,25 мл PBS. Выдержите O / N в холодильнике 4 ° С.
    5. Мытье с PBS в течение 5 мин, повторяли три раза. Добавить вторичного антитела Alexa 594 козьего антитела против IgG1 мыши (для DYS-2) или IgG2 (для DYS-1) (1: 2500). Разбавить блокирующий реагент в PBS, содержащем 0,1% октилфенол этоксилата. Инкубируют в течение 0,5 ч при комнатной температуре.
    6. Мытье с PBS в течение 5 мин, три тРедакторы IME. Разрешить слайд высохнуть. Добавьте 1 - 2 капли (3 нг / мл) 4 ', 6-диамидино-2-фенилиндола (DAPI) решение для монтажа. С помощью пинцета поместите стеклянную скользить по верхней части секций, избегая пузырьков.
    7. Просмотр dystrophin- (DYS-1 / DYS-2) положительные волокна под флуоресцентным микроскопом при 594 нм при увеличении 20Х.

    9. Вестерн блот

    1. Добавить собранные секции мышцы от крио-секционирования до 150 мкл буфера для образцов на льду.
    2. С помощью ручного гомогенизатора, кратко гомогенизировать образцы белка. Образцы зной в 1,5 мл трубки в нагревательном блоке инкубаторе при температуре 95 ° С в течение 3 - 5 мин. Центрифуга при 16500 х г в течение 15 мин и собирают супернатант.
    3. Хранить аликвоты надосадочной жидкости при -70 ° С. Используйте дистиллированную воду для разбавления до 100х.
    4. Определение концентрации белка с использованием коммерческого набора в соответствии с протоколом производителя. Добавить 2x буфер Laemmli SDS-загрузки для образцов и высокой температуре в течение 3 мин &# 160; при 95 & deg; С.
    5. Образцы нагрузки в 3 - 8% Трис-ацетата гель перед его запуском в течение 3 ч при 150 В. Включите несколько разбавленный дикого типа (WT) образцы (например, 1%, 10% и 50%) для количественной оценки. Менее 1% масс уровни дистрофина должны быть обнаружены с помощью этого метода.
    6. Поместите гель в катодном буфере в течение 20 мин. За это время сделать девять кусков фильтровальной бумаги и поместить их в буфер передачи (3 бумаги в катодном буфере [+], анодным буфер ([-], и концентрированная анодном буфере [-], соответственно) Это. описывает полусухой способ передачи , который повышает чувствительность (рисунок 6).
    7. Смочить PVDF мембрану в метаноле в течение 20 с, а затем поместить в буфер анода.
      Установите гель с мембраной для полусухого переноса и позволяют ему работать 1,5 часа при 400 мА в РТ или в холодном помещении.
    8. Промывают мембрану с PBS. Инкубируйте мембрану в смеси PBS с Tween 20 (PBST) и 5% сухого молока в течение 2 часов.
    9. Развести Дыс-1 (первичное антитело) в PBST и 5% сухого молока смесь до 1: 100 разбавлении. Добавьте его к мембране и пусть инкубировать в течение по крайней мере 1 часа. Промыть три раза 100 мл PBST в течение 15 мин каждый.
    10. Добавьте 65 мкл / полосу HRP конъюгированного вторичного антитела (анти-мышиного IgG2a для DYS1) в соотношении 1: 5000 разбавление в течение 1 ч при комнатной температуре в темном месте. Затем, промывают три раза 200 мл PBST в течение 20 мин. Смешайте решения из набора обнаружения в соответствии с указаниями. Инкубировать в течение 1 мин.
    11. Разработка пленки для обнаружения и анализа полос с ImageJ программного обеспечения 48,57,58.

Representative Results

В пробирке эксперименты

Миобластов трансфицировали с различными условиями 2'OMePS лечения для того, чтобы сравнить эффективность каждого AON. Одиночные процедуры AON с 600 нМ каждого из Ex6A, Ex6B, Ex8A или Ex8B были сделаны, а также лечение коктейль с 600 нМ каждого из всех 4 AON последовательностей. Образцы РНК собирали через четыре дня после трансфекции. После того, как RT-PCR, образцы для каждой обработки были проведены на геле вместе с необработанными (NT) образцов. Полосы выше на геле представляют из собственного кадра продуктов DMD; эти полосы были замечены в NT, Ex8A и Ex8B лечение миобластов. Ex6A, Ex6B, Ex8A, и коктейль обработанных миобласты показали в кадре продукты. Коктейль и Ex6A / B показал 100% в рамке продуктов, в то время как Ex8A показал только 30% в рамке изделия (рисунок 7). Для подтверждения пропуска экзона и восстановлениерамка считывания, кДНК последовательность была выполнена; Результаты показали , что экзоны 6 - 9 действительно был пропущен (рисунок 7). Иммуногистохимия показали , что AON лечение собак увеличилось дистрофина-положительных волокон по сравнению с образцами NT (рисунок 8).

In Vivo эксперименты

Для сравнения эффективности различных условий обработки AON, CXMD собаки (0,5 - 5 лет) вводили однократно 1,2 мг Ex6A или коктейль из Ex6A, Ex6B и Ex8A при различных дозировках. Через две недели после инъекции, образцы мышц были собраны и окрашивали DYS-1 для сравнения количества дистрофина-положительных волокон. Все коктейль обработанные образцы показали повышенную экспрессию дистрофина по сравнению с образцами NT. Дистрофин-положительных волокон увеличилась с дозировкой AON (рисунок 9). После системыIC инъекции, дикого типа (WT), NT, а также коктейль-обработанных образцов CXMD мышц окрашивали DYS-1 (рисунок 10). Коктейль обработанных CXMD собак показали повышенную экспрессию дистрофина по сравнению с NT CXMD собак, как в КТ и образцы сердечной мышцы. Тем не менее, AON обработанных скелетных мышц (КТ) показали значительно более высокую экспрессию дистрофина по сравнению с обработанной сердечной мышцы. Иммуноблот сравнения WT, NT, а также различные морфолино коктейль обработанных мышц привело к такому же выводу. Был также большой диапазон экспрессии дистрофина в обработанных образцах скелетных мышц (Рисунок 10). Гематоксилином и эозином окрашивания (ОН) показало, что лечение CXMD Собаки показали улучшенную гистопатологии, со значительным уменьшением центрально структурообразователя волокон (УТС) по сравнению с НТ CXMD собак (рисунок 11). Это указывает на то есть больше дегенерации / регенерации происходит у собаки NT, знак дистрофические мышечной патологии. Кроме того, лечение собак были быстрееработает раз и улучшенные оценки по клинической шкале оценок. Обработанные собаки CXMD показали лучшие результаты , чем NT CXMD собак во всех категориях (рисунок 12).

Рисунок 1
Рисунок 1. Структура Мутация в CXMD Собака и экзонов 6 - 8 . Пропуск стратегий с использованием антисмыслового коктейль CXMD собаки имеют точечная мутация в экзоне 6 приводит к потере экзона 7 в мРНК дистрофических собак. Это приводит к мРНК быть вне кадра и производства дистрофина теряется. Короткие последовательности AON предназначены для связывания с экзоном 6 и 8, что приводит к сплайсинга мРНК эффективно скачущей экзонов 6 - 8. Серая полоса в коктейле обработанных собак AON представляет короткие последовательности AON. Экзон 9 кодирует шарнирный домен и иногда самопроизвольно сращены с AONs против экзона 6 и 8. Полученные в результате коды мРНК дистрофина белки, которые короче, но функциии др. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2. Основные клинические симптомы 1-летний Собачий Х-хромосомой мышечной дистрофии (CXMD) животного. А 1-летний дикого типа Бигл и CXMD собаки показаны. Участие проксимальной, конечности, и височной мышцы, как правило, наблюдается с 2-месячного возраста. Совместное контрактуры и смещение таза являются откровенное от 4 -х месячного возраста. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3. Общий наркоз для собаки. А) IntramusculА.Р. инъекции и мышечные биопсии проводится под общим наркозом с изофлуран. Б) Проведение животного для системных инъекций. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 4
Рисунок 4. Магнитно - резонансная томография (МРТ) дикого типа, Необработанные CXMD и обработали CXMD. МРТ задней конечности через 3 месяца и 5 месяцев в WT и NT CXMD собак. Два образца изображения, подвергнутых обработке CXMD задних конечностей MRIS pre- (за 1 неделю до первой инъекции) и после инъекции AON показаны. 2703MA обрабатывали 7x еженедельно с 200 мг / кг коктейль Morpholinos. 2001MA обрабатывали 5-кратным недельной внутривенной инъекции 120 мг / кг коктейль Morpholinos. Контроль и лечение собаки были подобраны по возрасту. Обработанные собаки показывают уменьшились Т2 сигналы. Изображения УРАФ Тэд с разрешения Йокота и др. (авторское право 2009, John Wiley & Sons) 40 Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 5
Рисунок 5. биопсию мышцы Процедура собаки. А) нижних конечностей фиксируется для биопсии мышц. Б) С помощью пинцета, нижняя конечность удерживается. C) мышцы CT подвергается воздействию. Метод открытой биопсии используется для получения образцов мышечных закачанного сайтов. Нити используются для хранения образцы биопсии. Образцы D) Мышечные на трагакант после рассечения. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

/53776/53776fig6.jpg "/>
Рисунок 6. полусухой способ передачи. Представление полусухого способа переноса для Вестерн - блоттинга представлена. Три работы замачивают в концентрированном буфере анода укладывают на отрицательном терминале; 3 бумаги, смоченные в анодной буфере уложены на вершине этого. Бумага Мб ПВДФ замачивают в метаноле, а затем анодной буфера перед тем, как укладывают поверх 6 бумаг. Гель, который был замачивают в катодном буфере, укладывают осторожно через PVDF бумагу. И, наконец, 3 бумаги, пропитанные в катодном буфере укладывают поверх геля. Положительный вывод устанавливается на вершине. В течение 1 ч, 400 мА проходит через систему. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 7
Рисунок 7. Пропуск экзонов в CXMD миобластов. др. (Copyright 2009, John Wiley & Sons) 40. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 8
Рисунок 8. Увеличение Dystropхин Экспрессия в 2'O-метилированных фосфотиоатных (2'OMePS) трансфицировали CXMD миобластов. CXMD миобластов трансфицировали только Ex6A или коктейль 2'OMePS. DYS-2 (красный) и (синий) окрашивание DAPI, показаны. Обработанные миобласты сравнивают с диким типом (WT) и необработанными (NT) миобластов. Изображения выполнены с разрешения Йокота и др. (Авторское право 2009, John Wiley & Sons) 40. Bar = 50 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 9
Рисунок 9. Спасение дистрофина экспрессии с внутримышечных инъекциях из Morpholinos в одиночку CXMD Собаки. Либо Ex6A или коктейль из Ex6A, Ex6B и Ex8A вводили в мышцы КТ CXMD собак. Дистрофина (DSY-1) Окрашивание дикого типа(WT), необработанный (НТ), и обработанные собаки CXMD показаны. Собаки были либо обработаны только 1,2 мг Ex6A или 1,2 мг коктейлем. Изображения выполнены с разрешения Йокота и др. (Авторское право 2009, John Wiley & Sons) 40. Bar = 100 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 10
Рисунок 10. Увеличение Дистрофин Expression После Системной Коктейль морфолино Лечение в CXMD собак. Дистрофина (DYS-1) окрашивание использовали для сравнения экспрессии дистрофина в дикого типа (WT) (положительный контроль), необработанный (NT) (отрицательный контроль), и CXMD собак, получавших 120 мг / кг морфолино коктейль (40 мг / кг каждого AON). Морфолино коктейль содержал Ex6A, Ex6B и Ex8A. Собаки внутривенно вводили 5 раз, мыekly с этим коктейлем. A) Сравнение экспрессии дистрофина в черепных большеберцовой (КТ) мышц WT, NT, и лечение собак. B) Сравнение экспрессии дистрофина в сердечной ткани между NT и морфолино коктейль лечение собак. C) иммуноблот для дистрофина с десмина в качестве контроля нагрузки показан для WT, NT, и морфолино коктейль лечение собак. Следующие мышцы показаны для обработанных собак: трехглавой мышцы плеча (ТБ), двуглавой мышцы плеча (BB), диафрагма (АСВ), пищевод (ESO), CT, аддуктор (ADD), разгибатель большого пальца (EDL), жевательные (MAS), и сердце. Изображения выполнены с разрешения Йокота и др. (Авторское право 2009, John Wiley & Sons) 40. Bar = 200 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 11
фигура11. Улучшение гистопатология в CXMD Собаки Обработанные в течение 7 недель с 240 мг / кг морфолино коктейль. CXMD собак , начиная от полугода до пяти лет внутривенно вводили 240 мг / кг морфолино коктейль (Ex6A, Ex6B и Ex8A) один раз в неделю в течение 7 недель. Через четырнадцать дней после последней инъекции, были взяты пищевод мышцы и гематоксилином и эозином окрашивания (ОН) было сделано. HE окрашивание мышц пищевода из необработанной (NT) и морфолино коктейль обработанный (Обработанные) CXMD собаки (40X объектив). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 12
Рисунок 12. Улучшенные результаты по клинической классификации и 15 м Время выполнения После Morpholino лечения. Morpholino лечение собак сравнивали с необработанными (NT) однопометницаs. Столбики ошибок в графике показывают SEM. А) Общий балл по клинической классификации экзамена была рассчитана до и после лечения и обработанных животных сравнивали с однопометные NT. B) Сравнение 15 м погонных раз обработанных и NT собак. С) По аналогии с B; Тем не менее, были использованы молодые собаки. Изображения выполнены с разрешения Йокотой и др. (Copyright 2009, John Wiley & Sons) 40. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

антисмысловой олигонуклеотид нуклеотидная последовательность
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

Таблица 1. антисмысловой олигонуклеотид Design.

Discussion

Пропуск экзонов является перспективным терапевтическим методом для лечения МДД. В пробирке и в естественных условиях экспериментов показали , что мульти-пропуск экзонов выполнима. Здесь, использование модели собаки CXMD обсуждается. Во- первых, AONs были разработаны с использованием программ Rescue-ESE и ESEfinder целевому дистрофина экзонов 6 - 8. Химия 2'OMePS AON использовали для CXMD миобластов трансфекции и морфолино AON основой химии была выбрана для проведения экспериментов в естественных условиях. vPMOs являются более эффективными, чем немодифицированные СВУП но из-за их более высокой токсичности, они не подходят для системного введения. Выделение РНК, ОТ-ПЦР, и кДНК, секвенирование проводили на миобластов CXMD. Собаки, инъецированные коктейль ОУП были клинически градуированный для оценки какого-либо улучшения клинических симптомов. После того, как собаки были гуманно усыпляют, образцы мышц были приняты и подготовлены к крио-секционирования. Полураспада белка дистрофина, индуцированное AОНы, как полагают, примерно 1 - 2 месяцев. Молодые взрослые собаки были использованы в данном исследовании, хотя эти эксперименты могут быть сделаны с неонатальной собак и собак старшего возраста (> 5 лет). Подготовленные секции мышцы были использованы для оценки гистопатологии и оценки дистрофина спасения через Вестерн - блоттинга и иммуногистохимии 48.

Важно обеспечить, чтобы объем раствора ОУП правильно перед инъекциями; неспособность сделать это будет иметь значительное влияние на результаты. Во время внутримышечных инъекций, достаточное давление необходимо ввести мышечные волокна. Мониторинг здоровья собаки и осмотра места операции имеют важное значение для устранения неполадок. Для мониторинга состояния здоровья животных, еженедельные анализы крови и взвешивание должно быть выполнено. После того, как euthanization животного и подготовки проб мышц, важным шагом для обеспечения чувствительности в обнаружении белка дистрофина заключается в использовании как гель Трис-ацетат и полусухим методом блоттингаво время процедуры Вестерн-блоттинга.

Как показано в репрезентативных результатов, миобласты обрабатывали Ex6A, Ex6B, Ex8A и коктейль (содержащий Ex6A, Ex6B, Ex8A и Ex8B) , полученного в каркасных изделий МДД. Так как Ex8B не дали экзон-пропускаются продукты, она не была использована в последующем в экспериментах естественных условиях. кДНК последовательности показал, что экзоны 6 - 9 прыгая произошло и иммуноцитохимия с DYS-2 окрашивания показали восстановили экспрессию дистрофина в обработанных образцах. AON лечение собак показали значительное увеличение дистрофин-положительных волокон. Это указывает на то, что экзоны 6 - 8 были пропуску и укороченный белок был получен. Количество дистрофина-положительных волокон увеличивается, когда использовали коктейль из AONs и была пропорциональна дозе AON. Иммуноблоты показали повышенную экспрессию дистрофина в системных морфолино лечение собак. Скелетных мышц имели различные уровни дистрофина волокон; Тем не менее, морфолино обработанных тканей сердца показали малоулучшение экспрессии дистрофина. Так как дистрофина имеет высокую молекулярную массу (427 кДа), обнаружение малых количеств дистрофина может быть затруднено. Для достижения наилучших результатов, использовали гель Трис-ацетат и полусухой способ передачи. Его окрашивание показало улучшение гистопатологии в морфолино лечение собак. Централизованно-зародившиеся волокна (УНВ) являются признаком нездорового мышцы и представляют собой циклы дегенерация мышц и регенерации. Морфолино лечение собак CXMD показали снижение доли УНВ по сравнению с необработанными собак CXMD. Клиническая классификация показали улучшение симптомов, таких как увеличение ходьбе и беге способности, в морфолино обработанных животных. Твердость мышц , как полагают, отражает мышечную атрофию, таким образом, он был включен в схему классификации 59. Твердость бедренной кости (задних конечностей) мышц оценивали; Тем не менее, мы исключили черепных мышц Сарториус, потому что они имеют тенденцию к гипертрофии, а не атрофию в CXMD. Обработанные собаки показываютэд более низкие оценки классификации и имели более быстрое время на ходовых испытаниях на 15 м. Улучшенное время на испытания 15 м свидетельствуют о повышенной мышечной функции 40. Более высокие общие оценки классификации указывают на плохое состояние здоровья и повышенную атрофию мышц.

Хотя эти результаты являются многообещающими, мульти-пропуск экзонов до сих пор представляет много проблем, которые необходимо будет преодолеть до того, как метод имеет клиническую применимость. Сердечная ткань до сих пор показывает уменьшенное поглощение AONs, вероятно, из-за разницы в клеточной торговли между сердечной и скелетной ткани. Никаких отравлений не наблюдалось у животных при текущих режимах дозировки; Тем не менее, больше работы должно быть сделано для оценки долгосрочной токсичности, прежде чем использование AON коктейлей может перейти к клиническим испытаниям. Трудно получить одобрение для AON коктейль лекарств, потому что регулирующие органы определяют каждую последовательность AON в качестве уникального лекарственного средства. Это означает, что каждая последовательность в коктейле необходимо будет индивидуально проверены на беу, требует больше времени и больше денег. Другим препятствием к использованию многоосных пропуска экзона в клинических условиях является большое количество промежуточных белковых продуктов, произведенных с неизвестными функциями. Эти белки могут потенциально привести к непредсказуемым побочным эффектам, в зависимости от индивидуальной мутации 22. Кроме того, модели мутации, имеющиеся в рамках текущих дистрофических моделей собак ограничены. Есть несколько природные мутации, и не все мутации полезны для изучения мульти-пропуск экзонов. Модель дистрофические свинья обещает быть хорошей альтернативой для будущих DMD пропуска экзонов исследования 33, 34.

Модели DMD собак имеют некоторые преимущества по сравнению с другими моделями МДД. Будучи более крупная модель животных, клинические классификации и МРТ возможны, что позволяет для более детального анализа. Так как собаки крупных животных, они также больше подходят для токсикологических исследований и более точно представляют собой заболевание человека, по сравнению с мышиной модели. Собака мodels также последовательности генов DMD, которые более похожи на людей 23, 34, 45.

Хотя технически сложным, перепрыгивания подход с участием многих экзон может в конечном счете выиграют> 90% пациентов с МДД 24. Это делает его намного лучшей альтернативой одного пропуска экзона, так как одного пропуск экзона применим только к небольшой группе пациентов. Кроме того, мульти-пропуск экзонов позволит нам выбрать шаблоны удаления, которые оптимизируют функциональность дистрофина укороченных белков. Например, удаление DMD экзоны 45 - 55 связан с исключительно слабыми симптомами или бессимптомных лиц 14,19,60-63. Мульти-пропуск экзонов экзонов 45 - 55 уже была продемонстрирована в мышиной модели ДМД с экзон 52 удаления (mdx52) с использованием системных инъекций vPMOs 22,26. Использование коктейль vPMOs также была продемонстрирована в других формах мышечной дистрофии, такойв качестве Фукуяма врожденной мышечной дистрофии (FCMD). FCMD вызывается экзона отлова, в котором аберрантных сплайсинга мРНК вызывается введением ретротранспозона. vPMOs было показано , чтобы спасти образец сплайсинга как в качестве FCMD модели мыши и в клеточных линиях человека 64. Следующее поколение AON биохимический, проявляющие высокую эффективность и низкую токсичность будет способствовать эффективному переводу скачущей подхода с участием многих экзона в клиническом применении. Кроме того, мульти-пропуск экзонов потенциально могут быть применены к другим генетических расстройств, таких , как dysferlinopathies 24, 65.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
Multi-пропуск экзонов Использование Коктейль антисмысловые олигонуклеотиды в собачьих Х-хромосомой мышечной дистрофии
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter