Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

تطوير doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وتشارك التليف في التسبب في أمراض مختلفة التقدمية المزمنة، مثل مرض الرئة الخلالي، تليف القلب، وتليف الكبد والفشل الكلوي المحطة، التصلب الجهازي، وأمراض المناعة الذاتية 1. بين أمراض الرئة الخلالي، والتليف الرئوي مجهول السبب (IPF) هو مرض التدريجي المزمن ويظهر سوء أحوال الطقس. السمة المميزة المرضية للفريق الحكومي الدولي هو تطوير بؤر أرومي ليفي التي تتكون من الخلايا الليفية وmyofibroblasts تنشيط التي ترتبط مع التكهن. واقترح أصول هذه الخلايا الليفية الرئوية التي يمكن جنيها من عدة خلايا اللحمة المتوسطة، بما في ذلك الخلايا الليفية الرئوية المقيمين أصلا وتعميم الخلايا الليفية من نخاع العظام. في الآونة الأخيرة، وقد اقترح الانتقالية الظهارية الوسيطة (EMT) لتترافق مع تشكيل خلايا اللحمة المتوسطة والمساهمة في التسبب في اضطرابات متليفة.

ويعتقد أن EMتي يلعب دورا هاما في عملية نمو الجنين، التئام الجروح، وتطور السرطان، بما في ذلك غزو الورم والانبثاث 3. بعد عملية EMT، الخلايا الظهارية الحصول على قدرة خلايا اللحمة المتوسطة التي كتبها ضياع معالم الظهارية، مثل E-كادهيرين، والتعبير عن علامات الوسيطة، مثل فيمنتين، وα العضلات الملساء الأكتين (SMA) 4،5. وأظهرت دراسات سابقة الدليل على أن عملية EMT ارتبط تطور التليف الأنسجة في الكلى 6 و 7 الرئة. بالإضافة إلى ذلك، والتهاب مزمن يعزز المرض متليف علاوة على ذلك، فإن هذه السيتوكينات الالتهابية مثل عامل نخر الورم أعضاء الفصيلة 14 (TNFSF14؛ ضوء)، عامل نخر الورم (TNF) -α، وانترلوكين 1β، وقد ثبت لتعزيز EMT 9-12.

جل الكولاجين فحص الانكماش، انكماش الخلايا الفحص المعتمدة على الكولاجين التي هي جزء لا يتجزأ الليفية في النوع الأولالكولاجين جل ثلاثة الأبعاد، هو المثل الأعلى في نموذج المختبر لتقييم انقباض. انقباض هي واحدة من وظائف مميزة من الخلايا الليفية، وتسهم في ترميم الجروح العادية وتليف 13. في هذا الاختبار، ويعتقد أن المرفق من الخلايا الليفية إلى النوع الأول الكولاجين من خلال الآليات التي تعتمد على إنتغرين من المفترض أن تنتج التوتر الميكانيكي تحت بعض الظروف، وبالتالي يؤدي إلى تقلص الأنسجة.

هنا، يتم الإبلاغ عن تطوير فحص هلام انكماش يمكن تكييفها لتقييم الاستحواذ على وظيفة مقلص في الخلايا التي خضع EMT. يوضح هذا التقرير أن هذا الاختبار تعديل هو مناسبة لتقييم انقباض في خلايا اللحمة المتوسطة التي خضعت EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. الاستعدادات والثقافة من خلايا الرئة طلائي

  1. ثقافة A549 الخلايا الظهارية الرئة البشرية (خط خلية ملتصقة) في Dulbecco لتعديل النسر متوسطة (DMEM) تستكمل مع 10٪ مصل بقري جنيني (FBS)، و 100 وحدة دولية / مل البنسلين، و 100 ميكروغرام / مل الستربتومايسين.
  2. إزالة والتخلص من وسائل الإعلام ثقافة خلية من صحن الثقافة، ويغسل مرة واحدة مع 5-10 مل من الفوسفات مخزنة المالحة (PBS). بعد الغسيل، ونضح على الفور برنامج تلفزيوني.
  3. إضافة 2 مل التربسين حامض / ethylenediaminetetraacetic (EDTA) (0.05٪)، واحتضان عند 37 درجة مئوية و 5٪ CO 2 لمدة 3 دقائق.
  4. جمع خلايا منفصلة في أنابيب الطرد المركزي التي تحتوي على خلية ثقافة المتوسط، أنابيب الطرد المركزي في RT لمدة 4 دقائق في 150 × ز.
  5. resuspend الخلايا بيليه في 2 مل من مستنبت الخلية وإزالة عينة لعد الخلايا. حساب عدد الخلايا باستخدام عدادة الكريات مع التريبان وصمة عار الزرقاء للتحقق بقاء الخلية.
  6. خلايا البذور A549 على10 لوحات سم البوليسترين في مناطق ذات كثافة من 0،5-1،0 × 10 6 خلية / طبق مع 10 مل من المتوسط ​​لفحص هلام الانكماش. البذور الخلايا على 6 لوحات البوليسترين بشكل جيد في مناطق ذات كثافة من 0،5-1،0 × 10 5 خلية / جيدا مع 2 مل من المتوسط ​​للتأكيد EMT. احتضان الخلايا عند 37 درجة مئوية و 5٪ CO 2 لمدة 24 ساعة.

إجراء 2. EMT

  1. إضافة 10 ميكرولتر من TGF-β1 (5 ميكروغرام / مل) و 10 ميكرولتر من TNF-α (10 ميكروغرام / مل) لوحة لفحص هلام انكماش المصنف في الخطوة 1.6. إضافة 2 ميكرولتر من TGF-β1 (5 ميكروغرام / مل) و 2 ميكرولتر من TNF-α (10 ميكروغرام / مل) لوحة للتأكيد EMT المصنف في الخطوة 1.6. احتضان عند 37 درجة مئوية و 5٪ CO 2 لمدة 48 ساعة.

3. تأكيد الإجراءات EMT بواسطة PCR والغربية التنشيف

  1. تأكيد التغيير في التشكل (من حجر مثل كوبلي إلى المغزل شكل) من الخلايا المعالجة باستخدام المجهر النقيض من المرحلة.
    ملاحظة: نورمخلايا A549 آل لها كوبلي الحجر تشبه والثلاثي ظهور شكل الذي هو سمة من الخلايا الظهارية، ولكن بعد التحفيز مع TGF-β1 وTNF-α، الخلايا تظهر طويلة والمغزل على شكل مشابه للخلايا اللحمة المتوسطة 14،15.
  2. تقييم تعبير عن علامة الظهارية، مثل E-كادهيرين، وعلامات الوسيطة مثل N-كادهيرين، فيمنتين، وα السلس الأكتين العضلات باستخدام PCR أو النشاف الغربي.
    1. استخراج الحمض النووي الريبي مجموع من الخلايا باستخدام استخراج الحمض النووي الريبي مجموعة 16 وتوليف [كدنا باستخدام الناسخ العكسي 17 وفقا لبروتوكول الشركة المصنعة.
    2. قياس التعبير عن مستويات مرنا في الوقت الحقيقي باستخدام نظام PCR 18 و أحادى cyanine الصبغة عدة PCR وفقا لتعليمات الشركة الصانعة. وترد. (E-كادهيرين كادهيرين-1)، وفيم (فيمنتين) في الجدول 1 الاشعال محددة لGAPDH (غليسيرألدهيد 3-فوسفات نازعة)، ACTA2 (ألفا الأكتين-2)، CDH1
    3. ليز الخلايا باستخدام العازلة تحلل (الجدول 2) محلول يحتوي على 1٪ مثبط البروتياز كوكتيل. قياس تركيزات البروتين كل عينة باستخدام مجموعة البروتين مقايسة 19،20، وتطبيق نفس كميات من البروتين لهلام بولي أكريلاميد.
      1. أداء SDS هلام الكهربائي ونقل شبه الجافة من البروتينات لPVDF غشاء 21. احتضان الغشاء مع الأجسام المضادة الأولية في عرقلة العازلة 1 - 2 ساعة. بعد الحضانة، ويغسل مرتين الغشاء مع غسل العازلة واحتضان ساعة غشاء 1 مع الأجسام المضادة الثانية.
        ملاحظة: انظر الجدول المواد / المعدات عن الأجسام المضادة والتخفيفات المستخدمة في هذه الدراسات. انظر الجدول 2 لمكونات عازلة تمنع.
      2. يغسل الغشاء مع العازلة غسل مرتين. التقاط صور للغشاء مع الغرب النشاف عدة الكشف عن 22 باستخدام كاميرا CCD 11،23 الباردة.

4. جل تقلص الفحص لتقييم EMT

  1. نضح في وسائل الإعلام مكيفة من السفينة زراعة الخلايا، ويغسل جيدا مع 5-10 مل من برنامج تلفزيوني لإزالة الخلايا الميتة. بعد الغسيل، ونضح على الفور برنامج تلفزيوني.
  2. إضافة 2 مل من 0.05٪ التربسين / EDTA واحتضان عند 37 درجة مئوية و 5٪ CO 2 لمدة 3 دقائق.
  3. جمع خلايا منفصلة في أنابيب الطرد المركزي التي تحتوي على DMEM تستكمل مع مثبط التربسين (1 ملغ / مل)، أنابيب الطرد المركزي في RT لمدة 4 دقائق في 150 × ز.
  4. مزيج نوع هلام 1 الكولاجين بالماء المقطر، و 4 × تتركز DMEM لضبط الكميات لتحقيق تركيز الكولاجين من 1.75 ملغ / مل، و 1 × تركيز DMEM. تأكد للحفاظ على المديين المتوسط ​​هلام على الجليد خلال هذه الخطوة.
    ملاحظة: لجعل 6 مل من المتوسط ​​هلام، وتخلط جيدا 3.5 مل من نوع 1 الكولاجين هلام (3 ملغ / مل)، و 1.5 مل من 4 × تتركز DMEM، و1ml من الماء المقطر.
  5. Resuspend وبيليه الخلية في 500 ميكرولتر من برنامج تلفزيوني وأخذ عينة لعد الخلايا. عدعدد الخلايا باستخدام عدادة الكريات مع وصمة عار الأزرق التريبان للتحقق من سلامة الخلية.
  6. إضافة المتوسطة هلام لضبط الكميات لتحقيق كثافة خلية من 3.0 × 5 10 خلايا / جيد (6.0 × 10 5 خلية / مل)، وبلطف ولكن سرعان ما مزجها قبل pipetting دون دبق.
  7. الاستغناء عن 0.5 مل من الخليط في كل بئر من 24-جيدا لوحة غير المعالجة بسرعة وبدقة لجعل شكل أسطواني أنيق. يجب الحرص على عدم السماح لأي فقاعات الهواء لتلوث المواد الهلامية (الشكل 1A).
    ملاحظة: متوسطة الجل الذي يحتوي على خلايا لزجا، ويمكن أن جل بسهولة وشكل شكل هلال في البئر.
  8. احتضان لوحة لمدة 15 دقيقة في حاضنة الخلية عند 37 درجة مئوية، و 5٪ CO 2 و 95٪ الرطوبة إلى هلام تماما.
  9. فصل المواد الهلامية من لوحة من دون كسر عن طريق تحريك ملعقة تعقيم بطريقة لرسم محيط في اتجاه واحد. باستخدام ملعقة، ونقل بلطف المواد الهلامية على أطباق زراعة الأنسجة 60 ممتحتوي على 5 مل من DMEM / 1٪ FBS مع أو بدون TGF-β1 (5 نانوغرام / مل)، وTNF-α (10 نانوغرام / مل).
  10. هز بلطف أطباق لضمان المواد الهلامية تطفو على المدى المتوسط. احتضان في حاضنة الخلية عند 37 درجة مئوية، و 5٪ CO 2 و 95٪ الرطوبة.

5. قياس جل الحجم

  1. قياس حجم هلام الكولاجين بعد 0، 24، 48، و 72 ساعة باستخدام نظام تحليل الصور.
    1. تشغيل نظام التوثيق هلام (الشكل 2A)، ووضع أطباق في مجلس الوزراء ضوء التدريع. ثم خلع غطاء من الأطباق في مجلس الوزراء.
    2. فتح البرنامج هلام تحليل ذات الصلة. انقر على زر "الحصول على الصور" في القائمة شريط لإظهار صورة من المواد الهلامية في مجلس الوزراء. ثم انقر على "اكتساب" في شريط القوائم لالتقاط الصور من المواد الهلامية (الشكل 2B).
    3. انقر على زر "كشف" في شريط القوائم (الشكل 2C) وضبط المنطقة القياس (الأصفر ط دائرةن الشكل 2C) عن طريق سحب الماوس. ثم انقر على زر "لصناعة السيارات في كشف" في شريط القوائم (انظر زر في الشكل 2D). البرنامج تلقائيا بالكشف عن المواد الهلامية تظهر خريطة التمثيل اللوني (الشكل 2D).
    4. انقر على زر "موافق" لاستخراج مخطط من المواد الهلامية التي كتبها معالجة الصور ولحساب مناطق محاطة مخطط (الشكل 2E). بعد احتساب المنطقة، يتم عرض منطقة محسوب في نافذة منبثقة منفصل.
      ملاحظة: إذا كانت المواد الهلامية متداخلة مع بعضها البعض أثناء التصوير، ونقل المواد الهلامية بلطف باستخدام طرف ماصة معقمة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

خلال EMT، الخلايا الظهارية تفقد علامات الظهارية، مثل E-كادهيرين، واكتساب التعبير عن علامات الوسيطة، مثل فيمنتين وα العضلات الملساء الأكتين 4،5. حضانة الخلايا الظهارية A549 الإنسان الرئة مع TGF-β1 وTNF-α تحرض EMT. ظهور خلايا A549 العادية بمثابة حجر كوبلي مثل شكل وشكل المثلث الذي هو سمة من الخلايا الظهارية (الشكل 3A)، ولكن بعد حفز مع TGF-β1 وTNF-α، تغير مظهرها شكل مغزل الطويلة التي تشبه الوسيطة الخلايا (الشكل 3B).

تم تقييم التعبير عن الظهارية والوسيطة علامات للتأكد من أن الخلايا خضعت EMT. تم احتساب التعبير مرنا نسبيا مع طريقة ΔΔCt. تم تطبيع البيانات الفردية ضد نازعة غليسيرألدهيد-3-فوسفات (GAPDH) أن التجهيزات المنزلية زإيني. قد خلايا A549 تعامل مع TGF-β1 وTNF-α لمدة 48 ساعة انخفاض كبير تعبيرا عن CDH1 وزادت بشكل ملحوظ تعبيرا عن VIM وACTA2 الشكل (4A). وتظهر تسلسل الاشعال تستخدم لف-PCR في TABLE1. كما هو مبين في الشكل 4B، التحفيز مع TGF-β1 وTNF-α التعبير المخفف كادهيرين E، في حين أن التعبير عن فيمنتين، N-كادهيرين، وα السلس الأكتين العضلات وكان المستحث.

تم إجراء فحص هلام انكماش لتقييم انقباض الخلايا التي خضع EMT. بعد حمل EMT مع TGF-β1 وTNF-α، ويلقي الخلايا في هلام الكولاجين والمحتضنة لمدة 72 ساعة في وسائل الإعلام التي تحتوي على عامل النمو التحويلي β1 وTNF-α، أو برنامج تلفزيوني. كما هو مبين في الشكل 5A، وكانت المواد الهلامية التي تحتوي على الخلايا المعالجة مع TGF-β1 وTNF-α أصغر من المواد الهلامية تحكم تحتوي على خلايا تعامل مع برنامج تلفزيوني. لرابعا علىntify التغييرات في حجم هلام، وقد تم تحليل المواد الهلامية باستخدام محلل هلام 0، 24، 48، و 72 ساعة بعد تلقي العلاج. بعد 72 ساعة، وبشكل ملحوظ خفضت مقارنة أحجام من المواد الهلامية التي تحتوي على الخلايا المعالجة مع TGF-β1 وTNF-α الى المواد الهلامية التحكم (الشكل 5B). أكدنا أيضا أن المواد الهلامية التي تحتوي على الخلايا المعالجة مع TGF-β1 كان وحده أصغر من المواد الهلامية السيطرة ولكن لم تكن أصغر من المواد الهلامية تعامل مع TGF-β1 وTNF-α (لا تظهر البيانات).

شكل 1
الشكل 1. الشكل التكميلي لجعل هلام. هذه الصور تظهر المواد الهلامية يلقى في الآبار. متوسطة الجل الذي يحتوي على خلايا لزجا ويمكن هلام بسهولة وشكل شكل هلال في البئر. (A) تظهر الصورة اليسرى التي يتم محمل المواد الهلامية بشكل صحيح، ويوضح الصورة الصحيحة مخطط "شكل أسطواني أنيق". (B </ قوي>) الصورة اليسرى تبين أن المواد الهلامية تشوه، ويوضح الصورة الصحيحة أن فقاعات الهواء تلوث المواد الهلامية. (C) والمواد الهلامية هي لينة، ألحقت أضرارا بهذه السهولة، وعادة ما تشوه مثل "باك مان". يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. خطوات لقياس جل الحجم. (A) ويتكون نظام توثيق جل من جهاز كمبيوتر ونظام هلام التصوير. (ب) "صورة زر الاستحواذ"، وصورة من المواد الهلامية. (ج) "زر الكشف"، ونافذة لضبط المنطقة القياس (دائرة صفراء). (D) على زر "الكشف التلقائي"، والبرنامج يجعل خريطة التمثيل اللوني من المواد الهلامية من صورة لدي TECT الخطوط العريضة للالهلام. (E) البرنامج مقتطفات الخطوط العريضة للالمواد الهلامية التي كتبها معالجة الصور، ويحسب المناطق التي تحيط بها المخطط. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. الأشكال التضاريسية من الخلايا التي يسببها EMT. كانت مطلية A549 ظهائر رئة الإنسان في مناطق ذات كثافة من 1.0 × 5 10 خلايا / جيد في لوحة 6 جيدا وحضنت مع أو بدون 5 نانوغرام / مل TGF-β1 و 10 نانوغرام / مل TNF-α لمدة 48 ساعة، تليها مرحلة النقيض من التصوير المجهري. (أ) و (ب) عبارة عن صور تم الحصول عليها تحت × 200. القضبان على نطاق وفي الفقرة (أ) و (ب)، و 100 ميكرون. ر = "_ فارغة"> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (4)
الشكل 4. EMT تحفيز مع TGF-β1 وTNF-α. (أ) تحليل QRT-PCR من EMT علامة التعبير (CDH1، فيم، وACTA2). (ب) لطخة غربية تظهر التعبير عن E-كادهيرين، N-كادهيرين، فيمنتين، وألفا العضلات الملساء الأكتين البروتينات في الخلايا A549 حفز مع أو بدون TGF-β1 وTNF-α. α تويولين كانت تستخدم الرقابة الداخلية. كانت خلايا A549 مثقف كما في الشكل 1. N = 3 تجارب مستقلة. ** ف <0.01. أشرطة الخطأ تمثل SEM. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

ديزيل / ftp_upload / 53974 / 53974fig5.jpg "/>
الرقم 5. الخلايا التي تمر EMT المكتسبة انقباض. كانت مطلية خلايا A549 في مناطق ذات كثافة من 1.0 × 10 6 خلية / طبق في 10 سم أطباق وحضنت مع أو بدون 5 نانوغرام / مل TGF-β1 و 10 نانوغرام / مل TNF-α لمدة 48 ساعة. وبعد ذلك يلقي الخلايا في 500 ميكرولتر من المتوسط ​​تحتوي على 1.75 ملغ / هلام الكولاجين مل في مناطق ذات كثافة من 3.0 × 5 10 خلايا / جيد في 24 لوحة جيدا. بعد تشكيل هلام، تم إضافتها إلى متوسطة مع أو بدون 5 نانوغرام / مل TGF-β1 و 10 نانوغرام / مل TNF-α في أطباق 60 ملم والمحتضنة لمدة 72 ساعة تليها التصوير (A). تم قياس أحجام هلام بعد 0، 24، 48، و 72 ساعة باستخدام نظام تحليل الصور. N = 9 تجارب مستقلة (B). ** ف <0.01. أشرطة الخطأ تمثل SEM. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الآثار البيئية-together.within الصفحات = "1" FO: المحافظة على مع next.within صفحة = "دائما">
اسم الجين إلى الأمام 5 '→ 3' عكس 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
همة GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

جدول تسلسل 1. التمهيدي. متواليات التمهيدي تستخدم لQRT-PCR. وقد استخدم GAPDH كما الرقابة الداخلية.

together.within الصفحات = "1" FO: المحافظة على مع next.within صفحة = "دائما">
تحلل العازلة: المعهد الملكي العازلة
20 ملي تريس، حمض الهيدروكلوريك 7.5 درجة الحموضة
150 مم كلوريد الصوديوم
1 ملم EDTA
1٪ البولي أوكسي إتيلين (9) الأثير octyiphenyl
0.1٪ نا deoxycholate
0.1٪ SDS
حجب العازلة
1٪ كاشف الحظر في غسل العازلة
غسل المخزن المؤقت: العازلة TBST
كلوريد الصوديوم 45 ز
1 م تريس 7.4 درجة الحموضة 50 مل
البولي أوكسي إتيلين (20) سوربيتان monolaurate 2.5 مل
تقطير المياه إضافة إلى 5 L
5 L

الجدول 2. مكونات المخازن المستخدمة. مكونات تحلل العازلة الحجب وغسل العازلة.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ويضم البروتوكول وضعت في هذه الدراسة خطوتين. يتم تنفيذ الخطوة الأولى للحث على EMT، في حين أن الخطوة الثانية هي فحص هلام الانكماش. وبما أنه من المهم للتأكد من أن الخلايا خضعت EMT الخطوة 2 توفر عنصرا مكملا ممتازا للتغيرات التعبير المورفولوجية والجينات. وأظهرت دراسات سابقة أن EMT خلايا A549 والناجمة عن TGF-β1 فقط (24)؛ ومع ذلك، ونحن قد ذكرت في وقت سابق 10، المعاملة تنف ألفا يعزز EMT والحصول على علامات الخلية الوسيطة. ويعتقد أن آليات EMT بوساطة TGF-β-هو 25 التي تعتمد على smad. TNFα يعزز EMT TGF-β1 التي يسببها الذي يؤدي إلى تعزيز الانكماش هلام. وقد أفيد أن آليات TNFα لتعزيز EMT يسببها TGF-β1-ليست الفسفرة الوحيدة من منطقة رابط smad2، ولكن أيضا MAPK يشير تنظيم 26. ولذلك، فإن بروتوكول المتقدمة في هذه الدراسة شملت الامفيتامينأوجه كل من TGF-β1 وTNF-α.

التضمين من الخلايا التي خضعت EMT في النوع الأول الكولاجين هلام، وتطفو على المتوسط، هي الجوانب الرئيسية من هذا الاختبار (الخطوة 4). لأن المواد الهلامية هي لينة وتلف بسهولة، ولها أبعاد مختلفة على كل جانب، لا بد من الحذر الشديد عند تطبيق المواد الهلامية على المدى المتوسط ​​وقياس أحجامها. إذا كان من الصعب للقيام بهذه الخطوة، هناك طريقة بديلة لقياس أحجام جل في البئر دون تحريك المواد الهلامية في صحن 60 ملم 27،28. هناك العديد من المشاكل المشتركة، المشكلة الأولى هي أن المواد الهلامية الكولاجين يهلم بسهولة في RT، لذلك كثيرا ما تشوه المواد الهلامية كما ذكر في الخطوة 4.7. ولذلك، يجب أن تهتز لوحة بلطف بعد صب المواد الهلامية في الآبار للتأكد من أنها تأخذ على شكل أسطواني أنيق. والمشكلة الثانية هي أنه إذا تدخل أي فقاعات الهواء والمواد الهلامية خلال دبق، ثم حجم المواد الهلامية سيكون متفاوتا. يجب الحرص على عدم السماح لأي bubbl الهواءوفاق لتلوث المواد الهلامية. هناك نوعان من الاختلافات الرئيسية بين طريقة الأصلي وهذا الأسلوب. الاختلافات الأولى هي أن تركيز النهائي من المواد الهلامية الكولاجين طريقة الأصلي هو 0.75 ملغ / مل إلا أن هذا الأسلوب هو 1.75 ملغ / مل من أجل السماح المواد الهلامية للتعاقد أكثر مما تفعل مع أسلوب الأصلي. الاختلافات الثانية هي أن أسلوب الأصلي يستخدم المتوسطة مجانا المصل لهلام العائمة المتوسطة ولكن يستخدم هذا الأسلوب 1٪ FBS في المتوسط ​​عائم هلام من اجل الحفاظ على سلامة الخلية والحفاظ على انقباض الخلايا.

انكماش فحص هلام وضعت أصلا لالليفية هو المثل الأعلى في نموذج المختبر لتقييم انقباض الخلايا التي تساهم في عملية التئام الجروح وتليف 13. ومن المفترض المرفق من الخلايا الليفية الكولاجين من صنف 1 لإنتاج التوترات الميكانيكية الذي يؤدي بالتالي إلى انخفاض في حجم المواد الهلامية الكولاجين. بالإضافة إلى ذلك، تم مؤخرا استخدام هذا الاختبارلتكون نموذجا في المختبر لدراسة انكماش خلايا الشعب الهوائية في الأمراض الالتهابية، بما في ذلك الربو القصبي ومرض الانسداد الرئوي المزمن 29-31.

مقايسة هلام الانكماش مشابه لفحوصات أخرى، مثل فحوصات الهجرة الخلية، لأنه لا يحتاج إلى أجهزة معينة ويسلك استنساخ الكمي عالية. ومع ذلك، هناك بعض التقارير تطبيق هلام انكماش فحص لتقييم EMT 32. في هذه الدراسة، والمواد الهلامية التي تحتوي على الخلايا التي خضع EMT انخفضت بشكل ملحوظ في حجم 24-72 ساعة بعد دبق، مشيرا إلى انكماش الخلية. ولكن هناك قيود على هذا الأسلوب. الأول هو أن في هذا الاختبار، وتغيير حجم المواد الهلامية تظهر مجموع انقباض جميع الخلايا في المواد الهلامية. ومع ذلك، فإنه من الصعب تقييم انقباض خلية واحدة في المواد الهلامية باستخدام هذا الاختبار. والثاني هو أن الخلايا A549 هو خط الخلايا السرطانية، وليس العادية الخلايا الظهارية الإنسان. ولذلك، فإنه من الصعب استقراء ساور النتائج مباشرة إلى التسبب في التليف الرئوي. ومع ذلك، يتم استخدام خلايا A549 على نطاق واسع لدراسة وظائف الخلايا الظهارية مجرى الهواء، وأسفرت عن العديد من الدراسات دليلا على EMT باستخدام خلايا A549 كنموذج من التليف الرئوي 33،34.

وباختصار، فإن النوع الأول الكولاجين والمواد الهلامية التي تحتوي على خلايا اللحمة المتوسطة التي خضعت خفضت EMT في حجم، مشيرا إلى انكماش تلك الخلايا. وبالتالي، ينبغي النظر في انكماش فحص هلام باعتبارها الموسعة في الفحص المختبري لتقييم الاستحواذ على وظيفة مقلص في الخلايا من خلال عملية EMT.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم تضارب المصالح في الكشف عنها.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
تطوير<em&gt; في المختبر</em&gt; الفحص لتقييم مقلص وظيفة الخلايا الجذعية الوسيطة التي خضعت طلائي-الوسيطة الانتقالية
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter