Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Udvikling af et doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fibrose er involveret i patogenesen af forskellige kroniske progressive sygdomme, såsom interstitiel lungesygdom, kardiel fibrose, levercirrhose, terminal nyresvigt, systemisk sklerose og autoimmun sygdom 1. Blandt interstitielle lungesygdomme, idiopatisk lungefibrose (IPF) er en kronisk fremadskridende sygdom og viser dårlig prognose. Patologisk kendetegnende for IPF er udviklingen af ​​fibroblastisk foci bestående af aktiverede fibroblaster og myofibroblaster der er forbundet med prognosen. Oprindelsen af ​​sådanne pulmonale fibroblaster foreslås at være afledt af flere mesenkymale celler, herunder oprindeligt hjemmehørende pulmonale fibroblaster og cirkulerende fibrocytter fra knoglemarv. For nylig er der blevet foreslået epithelial-mesenchymal overgang (EMT) at være forbundet med dannelsen af mesenkymale celler 2, og bidrage til patogenesen af fibrotiske sygdomme.

Det menes, at EMT spiller vigtige roller i processen med fosterudvikling, sårheling og progression af cancer, herunder tumor invasion og metastase 3. Efter processen med EMT, epitelceller opnå evne mesenkymale celler ved tab af epitel markører, såsom E-cadherin, og ved ekspression af mesenchymale markører, såsom vimentin, og α-glatmuskelactin (SMA) 4,5. Tidligere undersøgelser viste bevis for, at EMT-processen er blevet forbundet med udviklingen af vævsfibrose i nyrerne 6 og lunge 7. Derudover kronisk inflammation fremmer fibrotisk sygdom 8; Endvidere har sådanne inflammatoriske cytokiner såsom tumornekrosefaktor superfamilie medlem 14 (TNFSF14, LIGHT), tumornekrosefaktor (TNF) -α og interleukin-1β, er blevet vist at forbedre EMT 9-12.

Kollagengel sammentrækning assay en kollagenbaseret celle sammentrækning assay, hvori fibroblaster er indlejret i type Ikollagengel tredimensionalt, er et ideelt in vitro model til vurdering af kontraktilitet. Kontraktilitet er en af de karakteristiske funktioner af fibroblaster og bidrager til normal sårheling og fibrose 13. I dette assay menes det, at fastgørelsen af ​​fibroblaster til type I-kollagen gennem integrin-afhængige mekanismer formodes at producere mekanisk spænding under visse betingelser, og dermed føre til væv kontraktion.

Her er rapporteret udvikling af gelen sammentrækning assayet skal tilpasses for at evaluere erhvervelse af kontraktile funktion i de celler, der undergik EMT. Denne rapport viser, at denne ændrede assay er egnet til at vurdere kontraktilitet i mesenkymale celler, der undergik EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Præparater og Kultur lungeepitelceller

  1. Kultur A549 human lunge epiteliale celler (adhærente cellelinie) i Dulbeccos modificerede Eagle-medium (DMEM) suppleret med 10% føtalt bovint serum (FBS), 100 IU / ml penicillin og 100 ug / ml streptomycin.
  2. Fjern og kassér cellekulturmediet fra dyrkningsskålen, og vask en gang med 5 - 10 ml phosphatbufret saltvand (PBS). Efter vask, straks aspirere PBS.
  3. Tilsæt 2 ml trypsin / ethylendiamintetraeddikesyre (EDTA) (0,05%) og inkuberes ved 37 ° C og 5% CO2 i 3 min.
  4. Saml de løsnede celler i centrifugerør indeholdende cellekulturmedium, centrifugeres rørene ved stuetemperatur i 4 minutter ved 150 x g.
  5. Resuspender cellerne pellet i 2 ml celledyrkningsmedium og fjerne en prøve til celletælling. Tæl antallet af cellerne under anvendelse af et hæmocytometer med trypan blå plet til at kontrollere cellernes levedygtighed.
  6. Seed A549 celler på10 cm polystyrenplader med en tæthed på 0,5 - 1,0 x 10 6 celler / skål med 10 ml medium til gelkontraktion assay. Frø cellerne på 6 brønd polystyrenplader med en densitet på 0,5 - 1,0 x 10 5 celler / brønd med 2 ml medium til EMT bekræftelse. Inkuber cellerne ved 37 ° C og 5% CO2 i 24 timer.

2. EMT Procedure

  1. Tilsæt 10 pi TGF-β1 (5 ug / ml) og 10 pi TNF-α (10 ug / ml) til pladen for gelkontraktion assay podet i trin 1.6. Tilsæt 2 pi TGF-β1 (5 ug / ml) og 2 pi TNF-α (10 ug / ml) til pladen for EMT bekræftelse podet i trin 1.6. Der inkuberes ved 37 ° C og 5% CO2 i 48 timer.

3. Bekræftelse af EMT Procedure ved PCR og Western Blotting

  1. Bekræft ændring i morfologi (fra brostensbelagte-lignende til spindel form) af behandlede celler ved hjælp af fasekontrast mikroskopi.
    Bemærk: Normal A549-celler har brostensbelagte-lignende og trekantformede udseende, der er karakteristisk for epitelceller, men efter stimulering med TGF-β1 og TNF-α, synes længe cellerne og spindel formet, der ligner mesenchymal-celler 14,15.
  2. Evaluere ekspressionen af ​​en epitelial markering, såsom E-cadherin, og mesenchymale markører, såsom N-cadherin, vimentin, og α-glatmuskelactin anvendelse af PCR eller Western blotting.
    1. Uddrag totalt RNA fra cellerne under anvendelse RNA-ekstraktion kit 16 og syntetisere cDNA under anvendelse af revers transkriptase 17 ifølge fabrikantens protokol.
    2. Måle ekspression af mRNA niveauer ved hjælp af real time PCR-system 18 og monomere cyanin-farvestof PCR kit ifølge producentens anvisninger. De specifikke primere for GAPDH (glyceraldehyd-3-phosphatdehydrogenase), ACTA2 (a-actin-2), CDH1 (cadherin-1; E-cadherin), og VIM (vimentin) er vist i tabel 1
    3. Lysere cellerne under anvendelse af en lysisbuffer (tabel 2) indeholdende 1% protease inhibitor cocktail. Mål alle prøve proteinkoncentrationer bruger et protein assay kit 19,20, og anvende de samme mængder af protein til en polyacrylamid gel.
      1. Udfør SDS-gel-elektroforese og halvtørre overførsel af proteinerne til PVDF-membran 21. Inkuber membranen med primære antistoffer i blokerende buffer til 1 - 2 timer. Efter inkubation vaskes to gange membranen med vaskebuffer og inkuber membranen 1 time med sekundære antistoffer.
        Bemærk: Se Materialer / udstyr Tabel for antistoffer og fortyndinger anvendes i disse studier. Se tabel 2 for komponenterne i blokerende buffer.
      2. Vask membranen med vaskebuffer to gange. Tag billeder af membranen med Western blotting afsløring kit 22 ved hjælp af en kold CCD-kamera 11,23.

4. Gelkontraktion Assay til evaluering EMT

  1. Aspirer konditionerede medier fra cellekulturen fartøj, og vask grundigt med 5 - 10 ml PBS for at fjerne døde celler. Efter vask, straks aspirere PBS.
  2. Tilsæt 2 ml 0,05% trypsin / EDTA og inkuberes ved 37 ° C og 5% CO2 i 3 min.
  3. Saml de løsnede celler i centrifugerør indeholdende DMEM suppleret med trypsininhibitor (1 mg / ml), centrifugeres rørene ved stuetemperatur i 4 minutter ved 150 x g.
  4. Bland type 1 collagen gel med destilleret vand, og 4 × koncentreret DMEM at justere volumener til opnåelse af en collagen koncentration på 1,75 mg / ml, og 1 × DMEM koncentration. Sørg for at holde gelen medium på is under dette trin.
    Bemærk: For at gøre 6 ml gel medium, bland godt 3,5 ml type 1 collagen gel (3 mg / ml), 1,5 ml 4 x koncentreret DMEM, og 1 ml destilleret vand.
  5. Resuspender cellepelleten i 500 pi PBS og fjerne en prøve til celletælling. Tælleantallet af cellerne under anvendelse af et hæmocytometer med trypan blå plet til at kontrollere cellernes levedygtighed.
  6. Tilføj gelmediet at justere volumener til opnåelse af en celledensitet på 3,0 x 10 5 celler / brønd (6,0 x 10 5 celler / ml) og forsigtigt, men hurtigt blandes ved pipettering uden gelering.
  7. Dispensere 0,5 ml af blandingen i hver brønd i en 24-brønds ikke-behandlede plade hurtigt og omhyggeligt for at pæne cylindrisk facon. Pas på ikke at lade eventuelle luftbobler til at forurene de geler (figur 1A).
    Bemærk: Gelen medium indeholdende cellerne er tyktflydende og kan let gelere og formen halvmåneform i brønden.
  8. Inkubér pladen i 15 minutter i en celle inkubator ved 37 ° C, 5% CO2 og 95% fugtighed gel fuldstændigt.
  9. Frigør geler fra pladen uden at bryde ved at bevæge en steriliseret spatel på en måde til at trække en omkreds i én retning. Ved hjælp af en spatel, forsigtigt overføre gelerne til 60 mm vævskulturskåleindeholdende 5 ml DMEM / 1% FBS med eller uden TGF-β1 (5 ng / ml) og TNF-α (10 ng / ml).
  10. Forsigtigt ryste retter at sikre geler er flydende på mediet. Inkuber i en celle inkubator ved 37 ° C, 5% CO2 og 95% fugtighed.

5. Måling af Gel Størrelse

  1. Mål kollagengelen størrelse efter 0, 24, 48 og 72 timer under anvendelse af et billedanalysesystem.
    1. Tænd geldokumentation (figur 2A), og sætte tallerkener i lyset afskærmning kabinet. Så tage låget af retter i kabinettet.
    2. Åbne den relaterede gel analyse software. Klik på "erhvervelse billedet knappen" i menuen-bar for at vise billedet af geler i kabinettet. Klik derefter på "anskaffelse« i menulinjen for at tage billeder af geler (figur 2B).
    3. Klik på "afsløring knappen" i menulinjen (Figur 2C) og juster måleområdet (gul cirkel in Figur 2C) ved at trække musen. Klik derefter på "auto-detektere knappen" i menulinjen (se knappen i figur 2D). Softwaren registrerer automatisk de geler, der viser en Heatmap (figur 2D).
    4. Klik på "OK" for at udtrække omridset af geler med billedbehandling og til at beregne områder omgivet af omridset (Figur 2E). Efter området er beregnet, er det beregnede område vises i separate pop-up vindue.
      Bemærk: Hvis gelerne overlapper hinanden under billeddannelse, flytte geler forsigtigt under anvendelse af en steril pipettespids.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Under EMT, epitelceller mister epitelceller markører, såsom E-cadherin, og få ekspressionen af mesenchymale markører, såsom vimentin og α-glatmuskelactin 4,5. Inkubation af A549 humane lunge epitelceller med TGF-β1 og TNF-α inducerer EMT. Udseendet af normale A549 celler er brostensbelagte lignende form og trekant form, der er karakteristisk for epitelceller (figur 3A), men efter stimuleret med TGF-β1 og TNF-α, udseende ændret til lang spindel form, der ligner mesenkymale celler (figur 3B).

Ekspressionen af ​​epitel- og mesenchymale markører blev evalueret for at bekræfte, at celler undergik EMT. Relativ mRNA-ekspression blev beregnet med ΔΔCt metode. Individuelle data blev normaliseret mod glyceraldehyd-3-phosphat-dehydrogenase (GAPDH), der er en housekeeping gen. A549-celler behandlet med TGF-β1 og TNF-α i 48 timer havde signifikant reduceret ekspression af CDH1 og signifikant forøget ekspression af VIM og ACTA2 (figur 4A). Primerne sekvenser anvendt for q-PCR er vist i Tabel 1. Som vist i figur 4B, stimulation med TGF-β1 og TNF-α svækket E-cadherin ekspression, hvorimod ekspressionen af vimentin, N-cadherin, og α-glatmuskelactin blev induceret.

Gelen sammentrækning assay blev udført for at vurdere kontraktilitet af celler, der undergik EMT. Efter induktion EMT med TGF-β1 og TNF-α blev celler kastet i kollagengelen og inkuberet i 72 timer i medier indeholdende TGF-β1 og TNF-α eller PBS. Som vist i figur 5A, gelerne indeholdende celler behandlet med TGF-β1 og TNF-α var mindre end kontrol- geler indeholdende celler behandlet med PBS. at quantify ændringerne i gel størrelse, blev gelerne analyseret under anvendelse af en gel analysator 0, 24, 48, og 72 timer efter behandling. Efter 72 timer blev størrelserne af geler indeholdende celler behandlet med TGF-β1 og TNF-α væsentligt reduceret i forhold til kontrol- geler (figur 5B). Vi bekræftede også, at geler indeholdende celler behandlet med TGF-β1 alene var mindre end kontrol- geler men var ikke mindre end gelerne behandlet med TGF-β1 og TNF-α (data ikke vist).

figur 1
Figur 1. Supplerende Figur for at foretage Gels. Disse billeder viser de geler kastet i brønde. Gelen medium indeholdende cellerne er tyktflydende og kan let gelere og formen halvmåneform i brønden. (A) Det venstre billede viser, at geler støbt korrekt, og det højre billede viser skemaet for "pæn cylindrisk form". (B </ Strong>) Det venstre billede viser, at geler deformeres, og det højre billede viser, at luftbobler kontaminere geler. (C) De geler er bløde, så let beskadiget og normalt deformeres som "Pac-Man". Klik her for at se en større version af dette tal.

Figur 2
Figur 2. trin til Måling af Gel Size. (A) Gelen dokumentation består af en PC og en gel imaging system. (B) Den "image erhvervelse knappen", og et billede af geler. (C) Den "påvisning knappen", og vinduet til justering af måleområdet (gul cirkel). (D) Den "auto-detektion knappen", og softwaren gør en Heatmap af geler fra et billede til at de tect omridset af geler. (E) Softwaren udtrækker omridset af geler med billedbehandling, og beregner områder omgivet af omridset. Klik her for at se en større version af dette tal.

Figur 3
Figur 3. morfologier af EMT-inducerede celler. A549 humane lunge epitel blev udpladet med en tæthed på 1,0 x 10 5 celler / brønd i en 6-brønds plade og inkuberet med eller uden 5 ng / ml TGF-β1 og 10 ng / ml TNF-α i 48 timer, efterfulgt af fasekontrast mikroskopisk billeddannelse. (A) og (B) er billeder opnået under × 200. Skalaen barer i (A) og (B), 100 um. t = "_ blank"> Klik her for at se en større version af dette tal.

Figur 4
Figur 4. EMT Stimulering med TGF-β1 og TNF-α. (A) QRT-PCR-analyse af EMT markør ekspression (CDH1, VIM, og ACTA2). (B) Western blot, der viser ekspressionen af E-cadherin, N-cadherin, vimentin, og a glatmuskelactin proteiner i A549 celler stimuleret med eller uden TGF-β1 og TNF-α. α-tubulin blev anvendt som den interne kontrol. A549-celler blev dyrket som i figur 1. N = 3 uafhængige eksperimenter. ** P <0,01; fejl søjler repræsenterer SEM. Klik her for at se en større version af dette tal.

Iles / ftp_upload / 53.974 / 53974fig5.jpg "/>
Figur 5. celler, som undergår EMT Acquired kontraktilitet. A549-celler blev udpladet med en tæthed på 1,0 x 10 6 celler / skål i 10 cm skåle og inkuberet med eller uden 5 ng / ml TGF-β1 og 10 ng / ml TNF-α i 48 timer. Celler blev derefter støbt i 500 pi medium indeholdende 1,75 mg / ml collagen gel ved en tæthed på 3,0 x 10 5 celler / brønd i en 24-brønds plade. Efter geldannelse, blev de sat til medium med eller uden 5 ng / ml TGF-β1 og 10 ng / ml TNF-α i 60 mm skåle og inkuberes i 72 timer efterfulgt af billeddannelse (A). Gel størrelser blev målt efter 0, 24, 48 og 72 timer under anvendelse af et billedanalysesystem. N = 9 uafhængige forsøg (B). ** P <0,01; fejl søjler repræsenterer SEM. Klik her for at se en større version af dette tal.

Gene Navn Frem 5 '→ 3' Reverse 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
VIM GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tabel 1. primersekvenser. Primersekvenser, der anvendes til QRT-PCR. GAPDH blev anvendt som intern kontrol.

Lysis Buffer: RIPA puffer
20 mM Tris-HCI pH 7,5
150 mM NaCl
1 mM EDTA
1% polyoxyethylen (9) octyiphenyl ether
0,1% Na-deoxycholat
0,1% SDS
blokeringspuffer
1% blokeringsreagens i vaskepuffer
Vaskebuffer: TBST-buffer
NaCl 45 g
1 M Tris pH 7,4 50 ml
Polyoxyethylen (20) Sorbitanmonolaurat 2,5 ml
Distill Vand tilføj til 5 L
5 L

Tabel 2. Komponenter af anvendte puffere. Komponenterne i lysis, blokerende puffer og vaskepufferen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Protokollen udviklet i denne undersøgelse omfatter to trin. Det første skridt er udført for at fremkalde EMT, mens det andet trin er gelkontraktion analysen. Eftersom det er vigtigt at bekræfte, at celler undergik EMT, trin 2 giver en fremragende supplement til de morfologiske og genekspression ændringer. Tidligere undersøgelser har vist, at EMT af A549-celler blev induceret ved kun 24 TGF-β1; Men som vi har rapporteret tidligere 10, TNF-α behandling forbedrer EMT og erhvervelse af mesenkymale cellemarkører. Det menes, at mekanismerne for TGF-β-medieret EMT er SMAD-afhængig 25. TNFa øger TGF-β1-inducerede EMT, der fører til forøgelse af gelkontraktion. Det er blevet rapporteret, at mekanismerne i TNFa til forøgelse af TGF-β1-inducerede EMT er ikke kun phosphorylering af Smad2 linker region, men også MAPK signalering regulering 26. Derfor protokol udviklet i denne undersøgelse omfattede stimulation af både TGF-β1 og TNF-α.

Indbygning af celler, der undergik EMT i type I collagen gel og flydende på mediet, er centrale aspekter af dette assay (trin 4). Fordi geler er bløde og let beskadiget, og har forskellige dimensioner på hver side, er ekstrem forsigtighed påkrævet ved anvendelsen af ​​geler til mediet og måle deres størrelser. Hvis det er vanskeligt at udføre dette trin, er der en alternativ metode til at måle gel størrelser i brønden uden at flytte gelerne i 60 mm skål 27,28. Der er flere fælles problemer, det første problem er, at kollagengeler let gelere ved stuetemperatur, så gelerne ofte deformeres som nævnt i trin 4.7. Derfor skal pladen forsigtigt rystet efter støbning af geler i brønde for at sikre de tager på en pæn cylindrisk formular. Det andet problem er, at hvis eventuelle luftbobler indtaste gelerne under gelering, så størrelsen af ​​gelerne vil blive ujævn. Pas på ikke at tillade nogen luft bubbles forurener gelerne. Der er to væsentlige forskelle mellem oprindelige metode og denne metode. De første forskelle er, at slutkoncentrationen af ​​kollagen geler af oprindelige metode er 0,75 mg / ml, men at ved denne fremgangsmåde er 1,75 mg / ml, således at gelerne til at optage mere end de gør med den oprindelige metode. Den anden forskel er, at den oprindelige metode bruger serumfrit medium til gel flydende medium, men denne metode bruger 1% FBS i gelen flydende medium for at holde cellelevedygtighed og vedligeholde cellesammentrækningsevne.

Gelen sammentrækning assay oprindeligt udviklet til fibroblaster er et ideelt in vitro model til vurdering af kontraktilitet af celler, der bidrager til processen med sårheling og fibrose 13. Fastgørelsen af ​​fibroblaster til type 1 collagen formodes at frembringe mekaniske spændinger, der følgelig fører til en reduktion i størrelsen af ​​kollagengeler. Derudover har dette assay for nylig blevet anvendtsom en in vitro model til undersøgelse sammentrækning af luftvejs-celler i inflammatoriske sygdomme, herunder bronkial astma og KOL 29-31.

Gelen sammentrækning assayet er sammenlignelig med andre assays, såsom cellemigration assays, idet den ikke kræver specifikke indretninger og udviser høj kvantitativ reproducerbarhed. Men der er få rapporter, der anvender gel sammentrækning assay til evaluering EMT 32. I denne undersøgelse geler indeholdende celler der undergik EMT faldt betydeligt i størrelse fra 24 til 72 timer efter gelering, hvilket indikerer celle sammentrækning. Der er imidlertid begrænsninger for denne metode. Den første er, at i dette assay, størrelsen ændring af gelerne viser summen af ​​kontraktilitet af alle celler i gelerne. Imidlertid er det vanskeligt at vurdere enkelt celle kontraktilitet i gelerne ved hjælp af dette assay. Den anden er, at A549-celler er en cancercellelinie, ikke normale humane epitelceller. Derfor er det vanskeligt at ekstrapolere our resultaterne direkte til patogenesen af ​​lungefibrose. Imidlertid er A549-celler almindeligt anvendt til at undersøge funktionerne af luftvejs-epitelceller, og flere undersøgelser gav bevis for EMT ved hjælp A549-celler som en model for lungefibrose 33,34.

Sammenfattende type I collagen geler indeholdende mesenkymceller der undergik EMT blev reduceret i størrelse, hvilket indikerer sammentrækning af disse celler. Således bør gelen sammentrækning assayet betragtes som en udvidet in vitro-assay til at evaluere erhvervelse af kontraktil funktion i cellerne gennem EMT-processen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingen interessekonflikter at afsløre.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Udvikling af et<em&gt; In vitro</em&gt; Assay til Evaluer kontraktionsfunktion af mesenchvmal-celler der undergik Epithelial-Mesenchymal Overgangseffekter
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter