Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Ontwikkeling van een doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fibrose is betrokken bij de pathogenese van verschillende chronische progressieve ziekten zoals interstitiële longziekte, cardiale fibrose, levercirrose, terminale nierinsufficiëntie, systemische sclerose en auto-immuunziekte 1. Onder interstitiële longziekten, idiopathische longfibrose (IPF) is een chronische progressieve ziekte en geeft een slechte prognose. Pathologische kenmerk van IPF is de ontwikkeling van fibroblastische foci bestaande uit geactiveerde fibroblasten en myofibroblasten die worden geassocieerd met de prognose. De oorsprong van deze pulmonaire fibroblasten voorgesteld kunnen worden uit verschillende mesenchymale cellen, zoals oorspronkelijk resident pulmonaire fibroblasten en circuleert fibrocytes uit beenmerg. Recentelijk heeft epitheliale-mesenchymale transitie (EMT) voorgesteld worden geassocieerd met de vorming van mesenchymale cellen 2, en bijdragen aan de pathogenese van fibrotische aandoeningen.

Er wordt gedacht dat EMT speelt een belangrijke rol in het proces van foetale ontwikkeling, wondgenezing en progressie van kanker, waaronder tumorinvasie en metastase 3. Na het proces van EMT, epitheelcellen verkrijgen het vermogen van mesenchymale cellen door verlies van epitheliale merkers, zoals E-cadherine, en expressie van mesenchymale merkers zoals vimentine en α-gladde spier actine (SMA) 4,5. Eerdere studies toonden het bewijs dat EMT proces is geassocieerd met de ontwikkeling van weefsel fibrose in de nier en de longen 6 7. Bovendien, chronische ontsteking bevordert fibrotische ziekte 8; Bovendien, zoals inflammatoire cytokinen zoals tumornecrosefactor superfamilieelement 14 (TNFSF14, LIGHT), tumornecrosefactor (TNF) -α, en interleukine-1β, is aangetoond EMT 9-12 verbeteren.

Collageengel contractie assay, een collageen gebaseerde celcontractie assay waarin fibroblasten zijn ingebed in type Icollageengel driedimensionaal, ideaal in vitro model voor de evaluatie van de contractiliteit. Contractiliteit is een van de karakteristieke functies van fibroblasten en draagt ​​bij normale wondgenezing en fibrose 13. Bij deze test wordt aangenomen dat de hechting van fibroblasten aan type I collageen door middel van integrine-afhankelijke mechanismen zou moeten mechanische spanning produceren onder bepaalde omstandigheden, en derhalve leiden tot weefselsamentrekking.

Hier wordt de ontwikkeling van de gel contractie assay gemeld worden aangepast aan de verwerving van contractiele functie uitwerkt in de cellen die EMT ondergingen. Dit rapport toont aan dat dit gewijzigde test is geschikt voor het evalueren van de contractiliteit in mesenchymale cellen die EMT ondergingen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Voorbereiding en Cultuur van longepitheelcellen

  1. Cultuur A549 humane long epitheelcellen (hechtende cellijn) in Dulbecco's Gemodificeerd Eagle Medium (DMEM) aangevuld met 10% foetaal runderserum (FBS), 100 IE / ml penicilline en 100 ug / ml streptomycine.
  2. Verwijder de celkweekmedia van kweekschaal en was eenmaal met 5-10 ml fosfaat gebufferde zoutoplossing (PBS). Na wassen onmiddellijk zuig het PBS.
  3. Voeg 2 ml trypsine / ethyleendiaminetetra-azijnzuur (EDTA) (0,05%) en incubeer bij 37 ° C en 5% CO2 gedurende 3 minuten.
  4. Verzamelen van de losgemaakte cellen in centrifugebuizen met celcultuurmedium Centrifugeer de buizen bij kamertemperatuur gedurende 4 min bij 150 xg.
  5. Resuspendeer pellet de cellen in 2 ml celkweekmedium en verwijderen van een monster voor celtelling. Tel het aantal cellen met een hemocytometer met trypan blauwe vlek cellevensvatbaarheid controleren.
  6. Zaad A549 cellen op10 cm polystyreen platen bij een dichtheid van 0,5-1,0 x 10 6 cellen / schaal met 10 ml medium voor contractie gel assay. Zaad de cellen op platen met 6 putjes van polystyreen met een dichtheid van 0,5-1,0 x 10 5 cellen / putje met 2 ml medium voor EMT bevestiging. Incubeer de cellen bij 37 ° C en 5% CO2 gedurende 24 uur.

2. EMT Procedure

  1. Voeg 10 ul van TGF-β1 (5 ug / ml) en 10 pl TNF-α (10 ug / ml) aan het dienblad gel krimp test gezaaid in stap 1,6. Voeg 2 ul van TGF-β1 (5 ug / ml) en 2 pl TNF-α (10 ug / ml) aan het dienblad EMT bevestiging gezaaid in stap 1,6. Incubeer bij 37 ° C en 5% CO2 gedurende 48 uur.

3. Bevestiging van EMT Procedure met behulp van PCR en Western Blotting

  1. Bevestig verandering in morfologie (van geplaveide-achtige vorm te spindel) van de behandelde cellen met behulp van fase-contrast microscopie.
    Opmerking: Normal A549 cellen geplaveide-achtige en driehoekig uiterlijk dat karakteristiek is voor epitheelcellen, maar na stimulatie met TGF-β1 en TNF-α, de cellen lijken lange spoelvormige die vergelijkbaar is met mesenchymale cellen 14,15.
  2. Evalueer de expressie van epitheliale merker, zoals E-cadherine en mesenchymale markers zoals N-cadherine, vimentine en α-gladde spier actine middels PCR of Western blotting.
    1. Extract totaal RNA uit de cellen gebruikmakend van RNA extractiekit 16 en het synthetiseren van cDNA met behulp van reverse transcriptase 17 volgens het protocol van de fabrikant.
    2. Meet expressie van mRNA niveaus met behulp van real time PCR systeem 18 en monomere cyanine kleurstof PCR kit volgens instructies van de fabrikant. De specifieke primers voor GAPDH (glyceraldehyde 3-fosfaat dehydrogenase), ACTA2 (alfa-actine-2), CDH1 (cadherine-1, E-cadherine) en VIM (vimentine) getoond in Tabel 1
    3. Lyseren van de cellen met een lysis buffer (tabel 2) oplossing met 1% proteaseremmer cocktail. Meet de monstereiwit door gebruikmaking van een proteïne testkit 19,20 en dezelfde hoeveelheden eiwit toepassen op een polyacrylamidegel.
      1. Uitvoeren SDS gel-elektroforese en semi-droge overdracht van de eiwitten op PVDF-membraan 21. Incubeer het membraan met primaire antilichamen in blokkeerbuffer gedurende 1 - 2 uur. Na incubatie, was twee keer het membraan met wasbuffer en incubeer het membraan 1 uur met tweede antilichamen.
        Opmerking: zie de materialen / Apparatuur Tafel voor antilichamen en verdunningen gebruikt in deze studies. Zie tabel 2 voor de componenten van blokkerende buffer.
      2. Was het membraan met wasbuffer tweemaal. Neem foto's van het membraan met de Western blotting detectie kit 22 met behulp van een koude CCD-camera 11,23.

4. Gel Contractie Assay voor het evalueren van EMT

  1. Zuig het geconditioneerde media uit de celkweek vat, en goed wassen met 5-10 ml PBS om de dode cellen te verwijderen. Na wassen onmiddellijk zuig het PBS.
  2. Voeg 2 ml van 0,05% trypsine / EDTA en incubeer bij 37 ° C en 5% CO2 gedurende 3 minuten.
  3. Verzamelen van de losgemaakte cellen in centrifugebuizen met DMEM aangevuld met trypsineremmer (1 mg / ml) Centrifugeer de buizen bij kamertemperatuur gedurende 4 min bij 150 xg.
  4. Meng Type 1 collageengel met gedestilleerd water, en 4 × geconcentreerd DMEM de volumes passen aan een collageen concentratie van 1,75 mg / ml te bereiken, en 1 x DMEM concentratie. Zorg ervoor dat de gel medium op ijs tijdens deze stap te houden.
    Opmerking: Uit 6 ml gel medium maken, meng goed 3,5 ml van type 1 collageen gel (3 mg / ml), 1,5 ml van 4 x geconcentreerde DMEM en 1 ml gedestilleerd water.
  5. Resuspendeer de celpellet in 500 pl PBS en verwijderen van een monster voor celtelling. tellenhet aantal cellen met een hemocytometer met trypan blauwe vlek cellevensvatbaarheid controleren.
  6. Voeg de gel medium aan de hoeveelheid aan te passen tot een celdichtheid van 3,0 x 10 5 cellen / putje (6,0 x 10 5 cellen / ml) en voorzichtig bereiken maar snel mengen door pipetteren zonder gelering.
  7. Verdeel 0,5 ml van het mengsel in elk putje van een 24-well niet-behandelde plaat snel en nauwkeurig nette cilindervorm maken. Wees voorzichtig niet toe te staan ​​eventuele luchtbellen naar de gels (Figuur 1A) besmetten.
    Opmerking: De gel medium dat de cellen viskeus en kan gemakkelijk geleren en vorm toenemende vorm in de put.
  8. Incubeer de plaat gedurende 15 min in een cel incubator bij 37 ° C, 5% CO2 en 95% vochtigheid volledig geleren.
  9. Gels los van de plaat zonder dat door verplaatsing van het gesteriliseerde spatel op een wijze die een omtrek trekken in een richting. Met een spatel voorzichtig de gels 60 mm weefselkweekschalen overdragenbevattende 5 ml van DMEM / 1% FBS met of zonder TGF-β1 (5 ng / ml) en TNF-α (10 ng / ml).
  10. Schud de gerechten om ervoor te zorgen gels drijven op het medium. Incubeer in een cel incubator bij 37 ° C, 5% CO2 en 95% vochtigheid.

5. Meting van Gel Grootte

  1. Meet de collageengel grootte na 0, 24, 48 en 72 uur met een beeldanalysesysteem.
    1. Schakel de gel documentatiesysteem (Figuur 2A), en zet gerechten in het licht afschermende kast. Vervolgens neemt u het deksel van de gerechten in de kast.
    2. Open de bijbehorende gel analysesoftware. Klik op de "image overname knop" in de menu-balk om het imago van de gels in de kast te laten zien. Klik vervolgens op "verkrijgen" in de menubalk om foto's van de gels (Figuur 2B) te nemen.
    3. Klik op de "opsporing knop" in de menubalk (figuur 2C) en stel het meetgebied (gele cirkel in figuur 2C) door de muis te slepen. Klik vervolgens op de "auto-detect knop" in de menubalk (zie de knop in figuur 2D). De software detecteert automatisch de gels met een heatmap (figuur 2D).
    4. Klik op "OK" om de omtrek van de gels door beeldverwerking te halen en naar gebieden, omringd door de omtrek (Figuur 2E) te berekenen. Nadat het gebied wordt berekend, wordt het berekende gebied weergegeven in een aparte pop-up venster.
      Let op: Als de gelen elkaar overlappen tijdens de beeldvorming, bewegen gels voorzichtig met behulp van een steriele pipet tip.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tijdens EMT, epitheelcellen verliezen epitheliale merkers, zoals E-cadherine, en krijgen de expressie van mesenchymale markers, zoals vimentine en α-gladde spier actine 4,5. Incubatie van A549 humane long epitheelcellen met TGF-β1 en TNF-α induceert EMT. Het uiterlijk van normale A549 cellen zijn geplaveide achtige vorm en driehoekig dat karakteristiek is voor epitheliale cellen (Figuur 3A), maar na gestimuleerd met TGF-β1 en TNF-α, het uiterlijk veranderde voor lange spindel vorm die vergelijkbaar is met mesenchymale cellen (Figuur 3B).

De expressie van epitheliale en mesenchymale markers werd onderzocht om te bevestigen dat cellen ondergingen EMT. Relatieve mRNA expressie werd berekend ΔΔCt methode. Individuele gegevens werden genormaliseerd tegen glyceraldehyde-3-fosfaatdehydrogenase (GAPDH) dat een housekeeping gONO. A549 cellen behandeld met TGF-β1 en TNF-α gedurende 48 uur was significant verlaagde expressie van CDH1 en aanzienlijk verhoogde expressie van VIM en ACTA2 (Figuur 4A). De primers die worden gebruikt voor Q-PCR zijn in Tabel 1. Zoals getoond in figuur 4B, stimulatie met TGF-β1 en TNF-α verzwakte E-cadherine, dat de expressie van vimentine, N-cadherine, en α-gladde spier actine werd geïnduceerd.

De gel krimp assay werd uitgevoerd om de contractiliteit van cellen die EMT ondergingen evalueren. Na inductie EMT met TGF-β1 en TNF-α werden cellen geworpen in de collageengel en gedurende 72 uur in medium dat TGF-β1 en TNF-α of PBS. Zoals getoond in figuur 5A, de gels die cellen behandeld met TGF-β1 en TNF-α kleiner dan controle gels die cellen behandeld met PBS. om toe quantify de veranderingen in omvang gel werden gels geanalyseerd met een gel analysator 0, 24, 48 en 72 uur na behandeling. Na 72 uur werden de afmetingen van gels die cellen behandeld met TGF-β1 en TNF-α significant verminderd in vergelijking met de controle gels (Figuur 5B). We bevestigden dat de gels die cellen behandeld met TGF-β1 alleen kleiner dan controle gels waren maar niet kleiner dan de gels behandeld met TGF-β1 en TNF-α (gegevens niet getoond).

Figuur 1
Figuur 1. Aanvullende cijfer voor het instellen van Gels. Deze beelden tonen de uitgebrachte in putten gels. De gel medium dat de cellen viskeus en kan gemakkelijk geleren en vorm toenemende vorm in de put. (A) De linker afbeelding toont aan dat de gels correct worden gegoten, en het juiste beeld toont het schema van de "nette cilindrische vorm". (B </ Strong>) Het beeld links toont aan dat de gels vervormen, en het juiste beeld toont aan dat luchtbellen vervuilen de gels. (C) De gels zijn zacht, zo gemakkelijk beschadigd en meestal vervormen als "Pac-Man". Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2. De stappen voor het meten van de grootte van Gel. (A) De gel documentatiesysteem bestaat uit een PC en een gel beeldvormingssysteem. (B) De "image overname button", en een foto van de gels. (C) De "detectie knop", en het venster voor het aanpassen van het meetgebied (gele cirkel). (D) De "automatische detectie knop", en de software maakt een heatmap van de gels van een beeld te de tect de omtrek van de gels. (E) De software haalt de omtrek van de gels door beeldverwerking, en berekent gebieden omringd door de omtrek. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3. De morfologieën van EMT-geïnduceerde cellen. A549 humane long epitheel werden uitgeplaat bij een dichtheid van 1,0 x 10 5 cellen / putje in een 6-wells plaat en geïncubeerd met of zonder 5 ng / ml TGF-β1 en 10 ng / ml TNF-α gedurende 48 uur, gevolgd door fasecontrast microscopische beeldvorming. (A) en (B) zijn verkregen beelden onder × 200. De schaalbalken in (A) en (B), 100 um. t = "_ blank"> Klik hier om een ​​grotere versie van deze figuur te bekijken.

figuur 4
Figuur 4. EMT Stimulatie met TGF-β1 en TNF-α. (A) qRT-PCR-analyse van EMT marker expressie (CDH1, VIM, en ACTA2). (B) Western blot die de expressie van E-cadherine, N-cadherine, vimentine en a gladde spier actine eiwitten in A549-cellen gestimuleerd met of zonder TGF-β1 en TNF-α. α-tubuline werd gebruikt als interne controle. A549-cellen werden gekweekt zoals in figuur 1. N = 3 onafhankelijke experimenten. ** P <0,01; foutbalken vertegenwoordigen SEM. Klik hier om een grotere versie van deze figuur te bekijken.

iles / ftp_upload / 53974 / 53974fig5.jpg "/>
Figuur 5. Cellen ondergaan EMT Acquired contractiliteit. A549-cellen werden uitgeplaat bij een dichtheid van 1,0 x 10 6 cellen / schaal in 10 cm schalen en geïncubeerd met of zonder 5 ng / ml TGF-β1 en 10 ng / ml TNF-α voor 48 uur. De cellen werden daarna gegoten in 500 pl medium dat 1,75 mg / ml collageen gel bij een dichtheid van 3,0 x 10 5 cellen / putje in een 24-wells plaat. Na gelvorming, werden ze toegevoegd aan medium met of zonder 5 ng / ml TGF-β1 en 10 ng / ml TNF-α in 60 mm schalen en gedurende 72 uur gevolgd door beeldvorming (A). Gel groottes werden gemeten na 0, 24, 48 en 72 uur met een beeldanalysesysteem. N = 9 onafhankelijke experimenten (B). ** P <0,01; foutbalken vertegenwoordigen SEM. Klik hier om een grotere versie van deze figuur te bekijken.

Gene Naam Forward 5 '→ 3' Reverse 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
VIM GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tabel 1. primersequenties. Primersequenties voor qRT-PCR. GAPDH werd gebruikt als interne controle.

Lysis Buffer: RIPA Buffer
20 mM Tris-HCl pH 7,5
150 mM NaCl
1 mM EDTA
1% polyoxyethyleen (9) octyiphenyl ether
0,1% Na-deoxycholaat
0,1% SDS
Blocking Buffer
1% blokkeren van reagens in wasbuffer
Wash buffer: TBST buffer
NaCl 45 g
1 M Tris pH 7,4 50 ml
Polyoxyethyleen (20) sorbitanmonolauraat 2,5 ml
Distill Water toevoegen aan 5 L
5 L

Tabel 2. De componenten van de gebruikte buffers. De componenten van lysis, het blokkeren van buffer en wasbuffer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De in deze onderzoeksprotocol omvat twee stappen. De eerste stap wordt uitgevoerd om EMT induceren, terwijl de tweede stap is de gel samentrekking assay. Aangezien het belangrijk te bevestigen dat cellen ondergingen EMT, stap 2 een uitstekende aanvulling op de morfologische veranderingen en gen expressie. Eerdere studies toonden aan dat EMT van A549-cellen werd geïnduceerd met slechts 24 TGF-β1; echter, zoals we eerder hebben gemeld 10, TNF-α behandeling verbetert EMT en de overname van mesenchymale cel markers. Er wordt gedacht dat de mechanismen van TGF-β-gemedieerde EMT is Smad-afhankelijke 25. TNFa verhoogt TGF-β1-geïnduceerde EMT die leidt tot verhoging van gel contractie. Vermeld is dat de mechanismen van TNFa aan een verhoogd TGF-β1-geïnduceerde EMT niet alleen fosforylering van Smad2 linkergebied, maar ook MAPK signalering regulering 26. Derhalve is de in dit onderzoek ontwikkelde protocol opgenomen stimulatie zowel TGF-β1 en TNF-α.

Het inbedden van cellen die EMT ondergingen in de type I collageen gel, en drijven op het medium, centraal aspecten van deze test (stap 4). Omdat de gels zijn zacht en gemakkelijk beschadigd, en hebben verschillende afmetingen aan beide zijden, is uiterste voorzichtigheid vereist bij het aanbrengen van de gel aan het medium en het meten van hun grootte. Als het moeilijk is deze stap uit te voeren, is er een alternatieve methode om de gel maten in de put te meten zonder de gels in 60 mm schaal 27,28. Er zijn een aantal gemeenschappelijke problemen, het eerste probleem is dat de collageen gels gemakkelijk geleren bij kamertemperatuur, zodat de gels vaak vervormen zoals vermeld in stap 4,7. Daarom moet de plaat voorzichtig worden geschud na het gieten van de gels in putten om ervoor te zorgen dat ze mee op een nette cilindrische vorm. Het tweede probleem is dat als luchtbellen Voer de gels tijdens gelering dan de grootte van de gels ongelijk. Zorg ervoor dat u alle lucht bubbl toestaanes de gels verontreinigen. Er zijn twee belangrijke verschillen tussen de oorspronkelijke methode en deze methode. Het eerste verschil is dat de eindconcentratie van collageen gels oorspronkelijke methode is 0,75 mg / ml, maar dat deze methode is 1,75 mg / ml, zodat de gels meer dan met de oorspronkelijke methode samentrekken. Het tweede verschil is dat de oorspronkelijke methode gebruikt serumvrij medium voor gel drijvende medium maar gebruikt deze methode 1% FBS in de gel drijvende medium om cellevensvatbaarheid en bewaart cel contractiliteit.

De gel krimp assay oorspronkelijk voor fibroblasten ideaal in vitro model voor de evaluatie van de contractiliteit van cellen die bijdragen aan het proces van wondgenezing en fibrose 13. De hechting van fibroblasten aan collageen type 1 zou moeten mechanische spanningen leidt bijgevolg tot een vermindering van de omvang van de collageen gels. Daarnaast heeft deze test onlangs gebruiktals een in vitro model voor het bestuderen van de contractie van de luchtwegen cellen bij ontstekingsziekten, zoals astma en COPD 29-31.

De gel contractie test is vergelijkbaar met andere assays, zoals celmigratie assays, doordat zij geen specifieke inrichtingen nodig en vertoont hoge kwantitatieve reproduceerbaarheid. Er zijn echter enkele gevallen de gel krimp assay voor het evalueren EMT 32. In deze studie, gels die cellen die EMT ondergingen significant verkleind 24-72 uur na gelering, wat aangeeft celcontractie. Er zijn echter beperkingen aan deze methode. De eerste is dat in deze test de afmetingsverandering van de gels tonen de som van contractiliteit van alle cellen in de gelen. Het is echter moeilijk om enkele cel contractiliteit van de gels met behulp van deze test geëvalueerd. De tweede is dat A549 cellen een kankercellijn, niet normale menselijke epitheelcellen. Daarom is het moeilijk te extrapoleren our resultaten rechtstreeks aan de pathogenese van longfibrose. Echter, A549 cellen wijd gebruikt om de functies van epitheelcellen bestuderen, en verschillende studies leverden bewijs EMT door A549-cellen als van pulmonaire fibrose 33,34.

Samengevat, het type I collageen gels die mesenchymale cellen die EMT ondergingen werden verkleind, wat aangeeft samentrekking van deze cellen. Daarom moet de gel krimp assay worden beschouwd als een uitgebreide in vitro assay voor het verkrijgen van contractiele functie uitwerkt in de cellen door EMT proces.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben geen belangenconflicten te onthullen.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Ontwikkeling van een<em&gt; In Vitro</em&gt; Assay om contractiele functie van mesenchymale Cellen die Onderging-mesenchymale transitie Evalueer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter