Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Développement d'un doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La fibrose est impliquée dans la pathogenèse de diverses maladies chroniques évolutives telles que la maladie pulmonaire interstitielle, la fibrose cardiaque, la cirrhose du foie, une insuffisance rénale terminale, la sclérose systémique, la maladie auto - immune et 1. Parmi les maladies pulmonaires interstitielles, fibrose pulmonaire idiopathique (IPF) est une maladie chronique progressive et montre un mauvais pronostic. caractéristique pathologique du IPF est le développement de foyers fibroblastique constitué par les fibroblastes et les myofibroblastes activés qui sont associées au pronostic. Les origines de ces fibroblastes pulmonaires sont proposés pour être dérivé de plusieurs cellules mésenchymateuses, y compris les fibroblastes pulmonaires résidents à l'origine et en circulation fibrocytes depuis la moelle osseuse. Récemment, la transition épithéliale-mésenchymateuse (TEM) a été proposé d'associer à la formation de cellules mésenchymateuses 2, et de contribuer à la pathogenèse des troubles fibrotiques.

On pense que la surveillance électroniqueT joue un rôle important dans le processus de développement du foetus, la cicatrisation des plaies et la progression du cancer, y compris l' invasion tumorale et les métastases 3. En suivant le procédé de l' EMT, les cellules épithéliales obtenir la capacité des cellules mésenchymateuses par la perte de marqueurs épithéliaux, tels que la E-cadhérine, et par l' expression de marqueurs de mésenchymateuses, comme la vimentine, et α-actine du muscle lisse (SMA) 4,5. Des études antérieures ont montré des preuves de ce processus EMT a été associé au développement de la fibrose tissulaire au niveau du rein et du poumon 6 7. En outre, l' inflammation chronique favorise les maladies fibrotiques 8; En outre, de telles cytokines pro - inflammatoires comme le facteur de nécrose tumorale membre de la superfamille 14 (TNFSF14, la lumière), le facteur de nécrose tumorale (TNF) -α, l' interleukine-1β et, il a été démontré pour améliorer EMT 12/09.

test de la contraction du gel de collagène, une contraction de la cellule test à base de collagène dans lequel les fibroblastes sont noyés dans le type Igel de collagène dans les trois dimensions, est un idéal modèle in vitro pour l'évaluation de la contractilité. Contractilité est l' une des fonctions caractéristiques des fibroblastes et contribue à la réparation de plaies et de la fibrose 13 normale. Dans cet essai, on pense que la fixation des fibroblastes du collagène de type I par des mécanismes de intégrine-dépendant est censé produire une tension mécanique dans certaines conditions, et par conséquent, conduire à une contraction des tissus.

Ici, la mise au point du test de contraction du gel est signalé à être adapté pour évaluer l'acquisition de la fonction contractile dans les cellules qui ont subi EMT. Ce rapport démontre que cet essai modifié est adapté pour évaluer la contractilité dans les cellules mésenchymateuses qui ont subi EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Préparations et culture de cellules épithéliales du poumon

  1. les cellules épithéliales de poumon humain de la culture A549 (lignée de cellules adhérentes) dans du milieu Eagle modifié par Dulbecco (DMEM) supplémenté avec 10% de sérum de fœtus bovin (FBS), 100 UI / ml de pénicilline et 100 pg / ml de streptomycine.
  2. Retirer et jeter les milieux de culture cellulaire à partir de la boîte de culture, et laver une fois avec 5 - 10 ml de tampon phosphate salin (PBS). Après le lavage, aspirer immédiatement le PBS.
  3. Ajouter 2 ml de Trypsine / acide éthylènediaminetétraacétique (EDTA) (0,05%) et on incube à 37 ° C et 5% de CO 2 pendant 3 minutes.
  4. Recueillir les cellules isolées dans des tubes à centrifuger contenant du milieu de culture cellulaire, centrifuger les tubes à température ambiante pendant 4 min à 150 x g.
  5. Remettre en suspension le culot de cellules dans 2 ml de milieu de culture cellulaire et de prélever un échantillon pour le comptage des cellules. Comptez le nombre de cellules à l'aide d'un hémocytomètre avec Trypan bleuissement pour vérifier la viabilité des cellules.
  6. cellules Seed A549 sur10 cm de plaques de polystyrène à une densité de 0,5 - 1,0 x 10 6 cellules / boîte de 10 ml de milieu pour le dosage de gel de contraction. Ensemencer les cellules sur 6 plaques et polystyrène à une densité de 0,5 - 1,0 x 10 5 cellules / puits avec 2 ml de milieu pour la confirmation EMT. Incuber les cellules à 37 ° C et 5% de CO2 pendant 24 heures.

2. EMT Procédure

  1. Ajouter 10 pi de TGF-β1 (5 pg / ml) et 10 ul de TNF-α (10 pg / ml) à la plaque pour essai de contraction du gel ensemencé à l'étape 1.6. Ajouter 2 ul de TGF-β1 (5 pg / ml) et 2 ul de TNF-α (10 pg / ml) à la plaque de confirmation EMT tête de série à l'étape 1.6. Incuber à 37 ° C et 5% de CO2 pendant 48 heures.

3. Confirmation de procédure EMT par PCR et Western blot

  1. Confirmer changement de morphologie (de galets en pierre ressemblant à la broche de forme) des cellules traitées à l'aide de la microscopie à contraste de phase.
    Note: NormDes cellules A549 al ont une apparence en forme analogue à la pierre et de galets triangulaire qui est une caractéristique des cellules epitheliales, mais après stimulation par TGF-β1 et le TNF-α, les cellules apparaissent en forme de broche long et qui est similaire à des cellules mésenchymateuses 14,15.
  2. Évaluer l'expression d'un marqueur épithélial, comme E-cadhérine, et des marqueurs mésenchymateuses tels que la N-cadhérine, vimentine, et α-actine musculaire lisse par PCR ou Western blot.
    1. Extraire l' ARN total à partir des cellules en utilisant le kit d'extraction d'ARN 16 et à synthétiser l' ADNc en utilisant la transcriptase inverse 17 selon le protocole du fabricant.
    2. Mesurer l' expression de niveaux d' ARNm en utilisant le système PCR en temps réel 18 et le kit de monomère colorant cyanine PCR selon les instructions du fabricant. Les amorces spécifiques de la GAPDH (de glycéraldéhyde-3-phosphate déshydrogénase), ACTA2 (alpha-actine-2), CDH1 (Cadherine 1, E-cadhérine) et VIM (vimentine) sont présentés dans le tableau 1
    3. Lyser les cellules en utilisant un tampon de lyse (tableau 2) Solution contenant un inhibiteur de protease à 1% cocktail. Mesurer toutes les concentrations en protéines de l' échantillon en utilisant un kit de dosage de protéine 19,20 et appliquer les mêmes quantités de protéine à un gel de polyacrylamide.
      1. Effectuer SDS électrophorèse sur gel et le transfert semi-sec des protéines de membrane de PVDF 21. Incuber la membrane avec des anticorps primaires dans un tampon de blocage pour 1 - 2 h. Après incubation, laver deux fois la membrane avec du tampon de lavage et on incube la membrane 1 heure avec les anticorps secondaires.
        Note: Voir le tableau Matériaux / Équipement pour les anticorps et les dilutions utilisées dans ces études. Voir le tableau 2 pour les composants du tampon de blocage.
      2. Laver deux fois la membrane avec un tampon de lavage. Prenez des photos de la membrane avec le kit de détection Western blot 22 en utilisant une caméra CCD 11,23 froid.

4. Gel Contraction Assay pour EMT Évaluation

  1. Aspirer le milieu conditionné à partir du récipient de culture cellulaire, et lavez bien avec 5 - 10 ml de PBS pour éliminer les cellules mortes. Après le lavage, aspirer immédiatement le PBS.
  2. Ajouter 2 ml de trypsine à 0,05% / EDTA et on incube à 37 ° C et 5% de CO 2 pendant 3 minutes.
  3. Recueillir les cellules isolées dans des tubes de centrifugation contenant du DMEM supplémenté avec un inhibiteur de la trypsine (1 mg / ml), on centrifuge les tubes à température ambiante pendant 4 min à 150 x g.
  4. Mélanger un gel de type 1 de collagène avec de l'eau distillée, et 4 x DMEM concentré pour ajuster le volume pour obtenir une concentration en collagène de 1,75 mg / ml et 1 × concentration DMEM. Assurez-vous de maintenir le milieu de gel sur la glace lors de cette étape.
    Remarque: Pour faire 6 ml de milieu de gel, bien mélanger 3,5 ml de type 1 gel de collagène (3 mg / ml), 1,5 ml de 4 × DMEM concentré et 1 ml d'eau distillée.
  5. Remettre en suspension le culot cellulaire dans 500 pi de PBS et prélever un échantillon pour le comptage des cellules. Compterle nombre des cellules en utilisant un hémocytomètre avec coloration au bleu Trypan pour vérifier la viabilité des cellules.
  6. Ajouter le support de gel pour ajuster les volumes pour atteindre une densité cellulaire de 3,0 x 10 5 cellules / puits (6,0 x 10 5 cellules / ml) et doucement mais rapidement le mélanger par pipetage sans gélification.
  7. Distribuer 0,5 ml du mélange dans chaque puits d'une plaque non-traitée 24 puits rapidement et soigneusement faire sous forme cylindrique soignée. Faites attention à ne pas laisser les bulles d'air de contaminer les gels (figure 1A).
    Remarque: Le milieu de gel contenant les cellules est visqueux et peut facilement se gélifier et la forme sous forme de croissant dans le puits.
  8. Incuber la plaque pendant 15 min dans un incubateur de cellules à 37 ° C, 5% de CO 2 et 95% d' humidité à gélifier complètement.
  9. Détachez gels de la plaque sans casser en déplaçant une spatule stérilisée de manière à dessiner une circonférence dans une direction. À l'aide d'une spatule, le transfert en douceur des gels à 60 mm des boîtes de culture tissulairecontenant 5 ml de DMEM / FBS à 1%, avec ou sans TGF-β1 (5 ng / ml) et de TNF-α (10 ng / ml).
  10. Secouer doucement les plats pour assurer gels sont flottantes sur le support. Incuber dans un incubateur de cellules à 37 ° C, 5% de CO2 et 95% d' humidité.

5. Mesure de Gel Taille

  1. Mesurer la taille d'un gel de collagène après 0, 24, 48 et 72 heures en utilisant un système d'analyse d'image.
    1. Allumez le système de documentation de gel (figure 2A), et de mettre la vaisselle dans l'armoire de protection contre la lumière. Ensuite, enlever le couvercle de la vaisselle dans l'armoire.
    2. Ouvrir le logiciel d'analyse d'un gel associé. Cliquez sur le bouton "d'acquisition d'image" dans la barre de menu pour afficher l'image des gels dans l'armoire. Ensuite, cliquez sur «acquérir» dans la barre de menu pour prendre des photos des gels (figure 2B).
    3. Cliquez sur le bouton "de détection" dans la barre de menu (figure 2C) et ajuster la zone de mesure (jaune cercle in La figure 2C) en faisant glisser la souris. Ensuite, cliquez sur le bouton "auto-détection" dans la barre de menu (voir bouton dans la figure 2D). Le logiciel détecte automatiquement les gels montrant une heatmap (figure 2D).
    4. Cliquez sur "OK" pour extraire le contour des gels de traitement d'image et de calculer des zones entourées par le contour (figure 2E). Après la zone est calculée, la surface calculée est affichée dans la fenêtre pop-up séparée.
      Remarque: Si les gels se chevauchent les uns les autres lors de l'imagerie, déplacer des gels doucement à l'aide d'une pipette stérile.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Au cours de l' EMT, les cellules épithéliales perdent marqueurs épithéliaux, tels que la E-cadhérine et le gain de l'expression des marqueurs de mésenchymateuses, comme la vimentine et α-actine du muscle lisse 4,5. L'incubation des cellules épithéliales du poumon A549 humain avec du TGF-β1 et de TNF-α induit EMT. L'apparition de cellules A549 normales sont en pierre de galets comme la forme et la forme de triangle qui est une caractéristique des cellules épithéliales (Figure 3A), mais après stimulation avec TGF-β1 et le TNF-α, l'aspect changé en forme de broche longue qui est similaire à mésenchymateuses les cellules (figure 3B).

L'expression des marqueurs épithéliaux et mésenchymateuses a été évaluée pour confirmer que les cellules ont subi EMT. expression de l'ARNm relatif a été calculé avec la méthode ΔΔCt. Les données individuelles ont été normalisées contre la glycéraldéhyde-3-phosphate déshydrogénase (GAPDH) qui est un ménage gène. Les cellules A549 traitées avec du TGF-β1 et le TNF-α , pendant 48 heures ont réduit de manière significative l' expression de CDH1 et une augmentation significative de l' expression VIM et ACTA2 (figure 4A). Les amorces des séquences utilisées pour q-PCR sont présentés dans le tableau 1. Comme cela est représenté sur la figure 4B, la stimulation avec du TGF-β1 et TNF-α atténué E-cadhérine expression, alors que l'expression de la vimentine, la N-cadhérine, et α-actine du muscle lisse a été induite.

L'essai de contraction du gel a été réalisée pour évaluer la contractilité des cellules qui ont subi EMT. Après l'induction de l'EMT avec le TGF-β1 et le TNF-α, les cellules ont été coulés dans le gel de collagène et incubées pendant 72 heures dans un milieu contenant du TGF-β1 et le TNF-α, ou du PBS. Comme cela est représenté sur la figure 5A, les gels contenant les cellules traitées avec du TGF-β1 et du TNF-α ont été plus faibles que les gels témoins contenant des cellules traitées avec du PBS. Pour quantifier les variations de la taille du gel, les gels ont été analysés en utilisant un analyseur de gel de 0, 24, 48 et 72 heures après le traitement. Au bout de 72 h, les dimensions des gels contenant des cellules traitées avec du TGF-β1 et du TNF-α ont été considérablement réduits par rapport aux gels témoins (figure 5B). Nous avons également confirmé que les gels contenant les cellules traitées avec du TGF-β1 seul étaient plus petits que les gels de contrôle, mais ne sont pas plus petites que les gels traités par le TGF-β1 et du TNF-α (données non présentées).

Figure 1
Figure 1. Figure complémentaire pour Making Gels. Ces images montrent les gels exprimés dans des puits. Le milieu de gel contenant les cellules est visqueux et peut facilement se gélifier et la forme sous forme de croissant dans le puits. (A) L'image de gauche montre que les gels sont coulés correctement, et l'image de droite montre le schéma de la «forme cylindrique propre". (B </ Strong>) L'image de gauche montre que les gels se déforment, et l'image de droite montre que les bulles d'air contaminent les gels. (C) Les gels sont doux, si facilement endommagés et se déforment généralement comme "Pac-Man". S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. Les étapes de mesure de la Gel Taille. (A) Le système de documentation de gel se compose d'un système d'imagerie de gel PC et. Le "bouton d'acquisition d'image" (B), et une image des gels. (C) Le "bouton de détection", et la fenêtre de réglage de la zone de mesure (cercle jaune). (D) Le bouton "auto-détection", et le logiciel fait une heatmap des gels d'une image pour dé téger le contour des gels. (E) Le logiciel extrait le contour des gels de traitement d'image, et calcule des zones entourées par le contour. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
La figure 3. Les morphologies de cellules EMT-induite. A549 épithéliums de poumon humain ont été étalées à une densité de 1,0 x 10 5 cellules / puits dans une plaque à 6 puits et incubées avec ou sans 5 ng / ml de TGF-β1 et 10 ng / ml TNF-α, pendant 48 heures, suivie par l'imagerie à contraste de phase microscopique. (A) et (B) sont des images obtenues sous × 200. Les barres d'échelle (A) et (B), 100 um. t = "_ blank"> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4 EMT stimulation par TGF-β1 et TNF-α. (A) d'analyse qRT-PCR de EMT marqueur expression (CDH1, VIM, et ACTA2). (B) Western Blot montrant l'expression de la E-cadhérine, la N-cadhérine, la vimentine, et l' alpha actine du muscle lisse des protéines dans les cellules A549 stimulées avec ou sans TGF-β1 et TNF-α. α-tubuline a été utilisé comme contrôle interne. Des cellules A549 ont été cultivées comme dans la figure 1. n = 3 expériences indépendantes. ** P <0,01; barres d'erreur représentent SEM. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

iles / ftp_upload / 53974 / 53974fig5.jpg "/>
Figure 5. Cellules Subissant EMT acquises contractilité. Des cellules A549 ont été étalées à une densité de 1,0 x 10 6 cellules / boîte en boîtes de 10 cm et mises en incubation avec ou sans 5 ng / ml de TGF-β1 et 10 ml de TNF-α ng / 48 h. Les cellules sont ensuite jetés dans 500 ul de milieu contenant 1,75 mg de gel / ml de collagène à une densité de 3,0 x 10 5 cellules / puits dans une plaque à 24 puits. Après la formation du gel, ils ont été ajoutés au milieu , avec ou sans 5 ng / ml de TGF-β1 et 10 ml de TNF-α ng / dans des boîtes de 60 mm et incubées pendant 72 heures suivie d'imagerie (A). les tailles de gel ont été mesurées au bout de 0, 24, 48 et 72 heures en utilisant un système d'analyse d'image. N = 9 expériences indépendantes (B). ** P <0,01; barres d'erreur représentent SEM. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Nom du gène Forward 5 '→ 3' Inverser 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
VIM GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tableau 1. Séquences d' amorces. __gVirt_NP_NNS_NNPS<__ Séquences d' amorces utilisées pour qRT-PCR. GAPDH a été utilisé comme contrôle interne.

Lysis Buffer: RIPA Buffer
20 mM Tris-HCl pH 7,5
150 mM de NaCl
1 mM d'EDTA
1% de polyoxyéthylène (9) éther octyiphenyl
0,1% de Na-désoxycholate
SDS à 0,1%
tampon de blocage
1% de réactif de blocage dans un tampon de lavage
Tampon de lavage: tampon TBST
NaCl 45 g
1 M de Tris pH 7,4 50 ml
Polyoxyéthyléné (20) sorbitan monolaurate 2,5 ml
distiller l'eau ajouter à 5 L
5 L

Tableau 2. Les composants de tampons utilisés. Les composants de lyse, tampon de blocage et le tampon de lavage.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le protocole mis au point dans la présente étude comprend deux étapes. La première étape est réalisée pour induire EMT, tandis que la deuxième étape est l'essai de contraction du gel. Comme il est important de confirmer que les cellules ont subi EMT, l'étape 2 fournit un excellent complément aux changements d'expression morphologiques et génétiques. Des études antérieures ont montré que des cellules EMT A549 a été induite par le TGF-β1 seulement 24; Cependant, comme nous l' avons signalé précédemment 10, le traitement par le TNF-α augmente EMT et l'acquisition de marqueurs de cellules mésenchymateuses. On pense que les mécanismes de TGF-β EMT médiation est Smad-dépendante 25. TNFa améliore EMT TGF-β1-induite qui conduit à la mise en valeur du gel contraction. Il a été rapporté que les mécanismes de TNFa pour l' amélioration de TGF-β1 EMT induite ne sont pas seulement la phosphorylation de la région de liaison Smad2, mais aussi la signalisation MAPK 26 régulation. Par conséquent, le protocole mis au point dans la présente étude a porté sur stimultion à la fois par le TGF-β1 et TNF-α.

L'intégration des cellules qui ont subi EMT dans le collagène de type I gel, et flottant sur le milieu, sont des aspects centraux de ce test (étape 4). Parce que les gels sont doux et facilement endommagés, et avoir des dimensions différentes de chaque côté, une extrême prudence est requise lors de l'application des gels au milieu et à mesurer leurs tailles. S'il est difficile de mener à bien cette étape, il existe une méthode alternative pour mesurer les tailles de gel dans le puits sans déplacer les gels en boîte de 60 mm 27,28. Il existe plusieurs problèmes communs, le premier problème est que les gels de collagène facilement gélifier à la température ambiante, de sorte que les gels se déforment souvent comme mentionné à l'étape 4.7. Par conséquent, la plaque doit être agité doucement après la coulée des gels dans des puits pour vous assurer qu'ils prennent une forme cylindrique soignée. Le deuxième problème est que, si les bulles d'air pénètrent dans les gels au cours de gélification, la taille des gels sera inégale. Veillez à ne pas permettre à tout bubbl d'aires contaminer les gels. Il existe deux principales différences entre la méthode originale et cette méthode. Les premières différences est que la concentration finale des gels de collagène de la méthode originale est de 0,75 mg / ml, mais cette méthode est de 1,75 mg / ml, afin de permettre des gels à se contracter plus qu'ils ne le font avec la méthode originale. Les secondes différences est que la méthode originale utilise un milieu sans sérum pour le milieu de gel flottant mais cette méthode utilise 1% de FBS dans le milieu de gel flottant afin de maintenir la viabilité des cellules et à maintenir la contractilité des cellules.

La contraction du gel dosage développé à l' origine pour les fibroblastes est un idéal de modèle in vitro pour évaluer la contractilité des cellules qui contribuent au processus de cicatrisation des plaies et la fibrose 13. L'attachement des fibroblastes du collagène de type 1 est censé produire des tensions mécaniques qui conduit par conséquent à une diminution de la taille des gels de collagène. En outre, cet essai a été utilisée récemmentcomme modèle in vitro pour l' étude de la contraction des cellules des voies respiratoires dans les maladies inflammatoires, y compris l' asthme et la BPCO 29-31.

Le dosage du gel de contraction est comparable à d'autres dosages, tels que des essais de migration cellulaire dans la mesure où il ne nécessite pas de dispositifs spécifiques et présente une reproductibilité élevée quantitative. Cependant, il existe peu de rapports en appliquant le test de la contraction du gel pour l' évaluation de l' EMT 32. Dans cette étude, des gels contenant des cellules qui ont subi EMT sensiblement diminué en taille 24-72 h après la gélification, ce qui indique la contraction des cellules. Il existe toutefois des limites de cette méthode. Le premier est que, dans cet essai, le changement de taille des gels correspond à la somme de la contractilité de toutes les cellules dans les gels. Cependant, il est difficile d'évaluer la contractilité cellulaire unique dans les gels en utilisant cet essai. La seconde est que les cellules A549 est une lignée de cellules cancéreuses, et non des cellules épithéliales humaines normales. Par conséquent, il est difficile d'extrapoler our résulte directement à la pathogenèse de la fibrose pulmonaire. Cependant, les cellules A549 sont largement utilisés pour étudier les fonctions des cellules épithéliales des voies aériennes, et plusieurs études ont donné la preuve de l' EMT en utilisant des cellules A549 comme modèle de fibrose pulmonaire 33,34.

En résumé, le collagène de type I gels contenant des cellules mésenchymateuses qui ont subi EMT a été réduit en taille, indiquant une contraction de ces cellules. Ainsi, le test de la contraction du gel doit être considéré comme une extension essai in vitro pour évaluer l' acquisition de la fonction contractile dans les cellules par le biais de processus EMT.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs ont aucun conflit d'intérêt à divulguer.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Développement d&#39;un<em&gt; In vitro</em&gt; Essai pour évaluer contractile Fonction mésenchymateuses Les cellules de transition épithéliale-mésenchymateuse A subi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter