Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Entwicklung eines doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fibrose ist in der Pathogenese verschiedener chronisch progressive Erkrankungen, wie interstitielle Lungenerkrankung, Herzfibrose, Leberzirrhose, terminalem Nierenversagen, systemischer Sklerose, Autoimmunerkrankung und 1 beteiligt. Unter interstitiellen Lungenerkrankungen, ist idiopathischer pulmonaler Fibrose (IPF) ist eine chronische progressive Krankheit und zeigt eine schlechte Prognose. Pathologisches Merkmal der IPF ist die Entwicklung von fibroblastischen Foci von aktivierten Fibroblasten und Myofibroblasten besteht, die mit der Prognose assoziiert sind. Die Ursprünge solcher Lungenfibroblasten vorgeschlagen von mehreren mesenchymalen Zellen abgeleitet werden, einschließlich ursprünglich resident Lungen Fibroblasten und Fibrozyten aus Knochenmark zirkuliert. Vor kurzem epithelial-mesenchymalen Übergang (EMT) wurde mit der Bildung von mesenchymalen Zellen 2, in Verbindung gebracht werden vorgeschlagen und zur Pathogenese von fibrotischen Erkrankungen beizutragen.

Es wird vermutet, dass EMT spielt eine wichtige Rolle im Prozess der fötalen Entwicklung, Wundheilung, und das Fortschreiten von Krebs, einschließlich der Tumorinvasion und Metastasierung 3. Nach dem Prozess des EMT, erhalten Epithelzellen die Fähigkeit der mesenchymalen Zellen , die durch Verlust von epithelialen Marker, wie E-Cadherin, und durch Expression von mesenchymalen Marker, wie Vimentin und α-smooth muscle actin (SMA) 4,5. Frühere Studien zeigten die Hinweise , dass EMT Verfahren hat sich mit der Entwicklung von Gewebefibrose in der Niere und der Lunge 6 7 verbunden. Darüber hinaus fördert die chronische Entzündung fibrotischen Erkrankung 8; Ferner, wie inflammatorische Zytokine wie Tumor - Nekrose - Faktor -Superfamilienmitglied 14 (TNFSF14; LIGHT), Tumor - Nekrose - Faktor (TNF) -α, und Interleukin-1β wurden EMT 9-12 gezeigt , zu verbessern.

Collagen-Gel Kontraktion Assay, ein Kollagen-basierte Zellkontraktion Test, bei dem Fibroblasten in Typ I eingebettet sindKollagengel dreidimensional, ist ein ideales in vitro - Modell für die Bewertung der Kontraktilität. Kontraktionsfähigkeit ist eines der charakteristischen Funktionen von Fibroblasten und trägt zu einer normalen Wundheilung und Fibrose 13. In diesem Test wird angenommen, dass die Bindung von Fibroblasten Integrin-abhängige Mechanismen Kollagen durch sollen Typ I mechanische Spannung unter bestimmten Bedingungen zu erzeugen, und damit zur Gewebekontraktion führen.

Hierbei wird die Entwicklung der Gelkontraktion Assays berichtet angepasst werden, um die Übernahme der kontraktilen Funktion in den Zellen zu bewerten, die EMT unterzog. Dieser Bericht zeigt, dass sich diese modifizierte Test zur Bewertung der Kontraktilität in mesenchymalen Zellen geeignet ist, die EMT unterzog.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Vorbereitung und Kultur von Lungenepithelzellen

  1. Kultur A549 humanen Lungenepithelzellen (adhärente Zelllinie) in Dulbeccos modifiziertem Eagle-Medium (DMEM) mit 10% fötalem Rinderserum (FBS) ergänzt, 100 IU / ml Penicillin und 100 ug / ml Streptomycin.
  2. Entfernen und entsorgen Sie die Zellkulturmedien von Kulturschale und wäscht einmal mit 5: - 10 ml phosphatgepufferter Salzlösung (PBS). Nach dem Waschen aspirieren sofort die PBS.
  3. 2 ml Trypsin / Ethylendiamintetraessigsäure (EDTA) (0,05%) und inkubiere bei 37 ° C und 5% CO 2 für 3 min.
  4. Sammle die abgelösten Zellen in Zentrifugenröhrchen, enthaltend Zellkulturmedium, zentrifugieren die Röhrchen bei RT für 4 min bei 150 × g.
  5. Resuspendieren der Zellen in 2 ml Zellkulturmedium pelletieren und eine Probe für die Zellzählung entfernen. Zählen Sie die Anzahl der Zellen einer Zählkammer mit Trypanblau-Färbung mit der Lebensfähigkeit der Zellen zu überprüfen.
  6. Seed A549-Zellen auf10 cm Polystyrol - Platten in einer Dichte von 0,5-1,0 x 10 6 Zellen / Schale mit 10 ml Medium für Gelkontraktion Assays. Seed die Zellen auf 6 - Well - Polystyrol - Platten mit einer Dichte von 0,5 bis 1,0 × 10 5 Zellen / Vertiefung mit 2 ml Medium für EMT Bestätigung. Inkubieren der Zellen bei 37 ° C und 5% CO 2 für 24 Std.

2. EMT Verfahren

  1. Zugabe von 10 & mgr; l von TGF-β1 (5 ug / ml) und 10 & mgr; l TNF-α (10 ug / ml) auf die Platte für Gelkontraktion Assay ausgesät in Schritt 1.6. Hinzufügen 2 ul TGF-β1 (5 ug / ml) und 2 & mgr; l TNF-α (10 ug / ml) auf die Platte für EMT Bestätigung ausgesät in Schritt 1.6. Inkubieren bei 37 ° C und 5% CO 2 für 48 Stunden.

3. Bestätigung der EMT Verfahren durch PCR und Western Blot

  1. Bestätigen Änderung in der Morphologie (von Kopfsteinähnliche Form auf die Spindel) der behandelten Zellen unter Verwendung von Phasenkontrastmikroskopie.
    Hinweis: Normal A549 Zellen haben Cobble stone förmig und dreieckig geformte Optik , die ein Merkmal von Epithelzellen, aber nach Stimulation mit TGF-β1 und TNF-α, erscheinen die Zellen lang und spindelförmige daß ähnelt Mesenchymzellen 14,15.
  2. Bewerten Sie die Expression eines epithelialen Marker, wie zum Beispiel E-Cadherin und mesenchymalen Marker, wie zB N-Cadherin, Vimentin und α-Glattmuskelaktin unter Verwendung von PCR oder Western-Blot.
    1. Extrahieren der Gesamt - RNA aus den Zellen unter Verwendung von RNA - Extraktions - Kits 16 und synthetisieren cDNA unter Verwendung von reverser Transkriptase 17 gemäß dem Protokoll des Herstellers.
    2. Messen Sie die Expression von mRNA - Spiegel unter Verwendung von Echtzeit - PCR - System 18 und monomeren Cyaninfarbstoff PCR - Kit nach den Anweisungen des Herstellers. Die spezifischen Primer für GAPDH (Glycerinaldehyd - 3-phosphat - Dehydrogenase), ACTA2 (alpha-Actin-2), CDH1 (Cadherin-1; E-Cadherin) und VIM (Vimentin) sind in Tabelle 1 gezeigt
    3. Lysieren die Zellen eine Lyse - Puffer (Tabelle 2) Lösung , die 1% Protease - Inhibitor - Cocktail verwendet. Messen alle Probenproteinkonzentrationen unter Verwendung eines Protein - Assay - Kit 19,20, und die gleichen Mengen an Protein zu einem Polyacrylamidgel.
      1. Führen SDS - Gel-Elektrophorese und halbtrockenen Transfer der Proteine ​​auf eine PVDF - Membran 21. Inkubieren Sie die Membran mit primären Antikörpern in Blocking-Puffer mit 1 - 2 Stunden. Nach der Inkubation waschen zweimal die Membran mit Waschpuffer und Inkubation der Membran 1 Stunde mit dem zweiten Antikörper.
        Hinweis: Lesen Sie die Materialien / Ausrüstung Tabelle für Antikörper und in diesen Studien verwendeten Verdünnungen. Siehe Tabelle 2 für die Komponenten der Blocking - Puffer.
      2. Waschen Sie die Membran mit Waschpuffer zweimal. Machen Sie Fotos von der Membran mit der Western - Blot - Nachweis - Kit 22 eine kalte CCD - Kamera 11,23 verwenden.

4. Gelkontraktion Assay zur Beurteilung von EMT

  1. Aspirieren den konditionierten Medien aus dem Zellkulturgefäß, und wäscht gut mit von 5 bis 10 ml PBS abgestorbene Zellen zu entfernen. Nach dem Waschen aspirieren sofort die PBS.
  2. 2 ml 0,05% Trypsin / EDTA und Inkubation bei 37 ° C und 5% CO 2 für 3 min.
  3. Sammeln Sie die abgelösten Zellen in Zentrifugenröhrchen, das DMEM mit Trypsin-Inhibitor ergänzt (1 mg / ml), Zentrifuge die Röhrchen bei RT für 4 min bei 150 × g.
  4. Mix Typ-1-Kollagen-Gel mit destilliertem Wasser, und 4 × konzentriert DMEM anpassen, um die Volumina einer Kollagenkonzentration von 1,75 mg zu erreichen / ml und 1 × DMEM Konzentration. Achten Sie darauf, während dieser Schritt das Gel-Medium auf Eis zu halten.
    Hinweis: Um 6 ml Gel-Medium zu machen, gut mischen 3,5 ml Typ-1-Kollagen-Gel (3 mg / ml), 1,5 ml 4 × konzentriert DMEM, und 1 ml destilliertem Wasser.
  5. eine Probe für die Zellzählung Resuspendieren des Zellpellets in 500 & mgr; l PBS und zu entfernen. Grafdie Anzahl der Zellen, die ein Hämozytometer mit Trypanblau-Färbung mit der Lebensfähigkeit der Zellen zu überprüfen.
  6. Füge das Gelmedium das Volumen einzustellen , um eine Zelldichte von 3,0 × 10 5 Zellen zu erreichen / Vertiefung (6,0 × 10 5 Zellen / ml) und sanft , aber es schnell und ohne Gelbildung durch Pipettieren gemischt.
  7. Dispense 0,5 ml des Gemisches in jede Vertiefung einer 24-Well nicht behandelten Platte schnell und sorgfältig gepflegte zylindrische Form zu machen. Achten Sie darauf , keine Luftblasen zu ermöglichen , die Gele (1A) zu verunreinigen.
    Hinweis: Das Gelmedium, die Zellen enthält, viskos ist und kann leicht gelieren und Form sichelförmige Form in dem Bohrloch.
  8. Inkubiere die Platte für 15 min in einem Zellinkubator bei 37 ° C, 5% CO 2 und 95% Feuchtigkeit vollständig zu gelieren.
  9. Lösen sich von der Platte Gelen ohne Brechen durch einen sterilisierten Spatel in einer Weise bewegt einen Umfang in eine Richtung zu ziehen. Mit einem Spatel übertragen sanft die Gele bis 60 mm Gewebekulturschalendie 5 ml DMEM / 1% FBS mit oder ohne TGF-β1 (5 ng / ml) und TNF-α (10 ng / ml).
  10. Sie vorsichtig die Gerichte schütteln Gele auf dem Medium schweben zu gewährleisten. Inkubieren in einem Zellinkubator bei 37 ° C, 5% CO 2 und 95% Luftfeuchtigkeit.

5. Messung der Gel-Größe

  1. Messen der Größe Kollagengel nach 0, 24, 48 und 72 h ein Bildanalysesystem verwendet wird.
    1. Schalten Sie das Geldokumentationssystem (2A), und stellen Geschirr in die Lichtabschirmungs Schrank. Dann nehmen Sie den Deckel von Geschirr im Schrank.
    2. Öffnen Sie die zugehörige Gel Analysesoftware. Klicken Sie auf die "Bildaufnahme-Taste" in der Menüleiste, um das Bild der Gele im Schrank zu zeigen. Klicken Sie dann auf "Acquire" in der Menüleiste Bilder der Gele (2B) zu nehmen.
    3. Klicken Sie auf die "Erkennung Taste" in der Menüleiste (Abbildung 2C) und stellen Sie den Messbereich (gelber Kreis in 2C) durch Ziehen der Maus. Klicken Sie dann auf die "Auto-detect - Taste" in der Menüleiste (siehe Taste in 2D). Die Software erkennt automatisch die Gele zeigt eine Heatmap (2D).
    4. "OK" klicken , zu extrahieren , die Umrisse der Gele durch Bildverarbeitung und auf Gebieten , die von der Gliederung (Abbildung 2E) umgeben berechnen. Nachdem die Fläche berechnet wird, wird die berechnete Fläche in separaten Popup-Fenster angezeigt.
      Hinweis: Wenn die Gele einander während der Bildgebung überlappen, Gele bewegen vorsichtig mit einer sterilen Pipettenspitze.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Während EMT, verlieren Epithelzellen epithelialen Marker, wie E-Cadherin, und gewinnen die Expression von mesenchymalen Marker, wie Vimentin und α-smooth muscle 4,5 Aktin. Inkubation von menschlichen A549 Lungenepithelzellen mit TGF-β1 und TNF-α induziert EMT. Das Erscheinungsbild der normalen A549 - Zellen sind Cobble Stein wie Form und Dreiecksform , die ein Merkmal von Epithelzellen (3A), aber nachdem sie mit TGF-β1 und TNF-α stimuliert, änderte sich das Aussehen zu lange Spindelform, die mesenchymalen ähnlich ist Zellen (3B).

Die Expression von epithelialen und mesenchymalen Marker wurde ausgewertet, um zu bestätigen, dass die Zellen EMT unterzog. Relative mRNA-Expression wurde mit ΔΔCt-Methode berechnet. Einzelne Daten wurden normalisiert gegen Glyceraldehyd-3-Phosphat-Dehydrogenase (GAPDH), dass ein Reinigungs gen. A549 - Zellen , behandelt mit TGF-β1 und TNF-α für 48 Stunden hatten signifikant Expression CDH1 reduziert und signifikant erhöhte Expression von VIM und ACTA2 (4A). Die Primer-Sequenzen für die q-PCR verwendet werden, in Tabelle 1 gezeigt. Wie in 4B, Stimulation mit TGF-β1 und TNF-α attenuierten E-Cadherin - Expression gezeigt, wohingegen die Expression von Vimentin, N-Cadherin und α-Aktin glatter Muskeln induziert.

Das Gel Kontraktionstest wurde ausgeführt, um die Kontraktilität von Zellen zu beurteilen, die EMT unterzog. Nach Induzierung EMT mit TGF-β1 und TNF-α wurden die Zellen in das Kollagengel gegossen und für 72 Stunden in Medium, das TGF-β1 und TNF-α, oder PBS inkubiert. Wie in 5A gezeigt, sind die Gele Zellen , behandelt mit TGF-β1 und TNF-α kleiner waren als die Kontroll Gele enthaltenden Zellen behandelt mit PBS enthält. Um quantify die Veränderungen in Gelgröße wurden, Gelen unter Verwendung eines Gel-Analysator analysiert 0, 24, 48 und 72 Stunden nach der Behandlung. Nach 72 Stunden wurden mit den Kontroll Gele (5B) deutlich reduziert die Größe von Gelen Zellen behandelt mit TGF-β1 und TNF-α enthält , verglichen. Wir bestätigten auch, dass die Gele Zellen, behandelt mit TGF-β1 allein kleiner waren als die Kontroll Gele waren aber nicht kleiner als die Gele, behandelt mit TGF-β1 und TNF-α (Daten nicht gezeigt) enthält.

Abbildung 1
Abbildung 1. Ergänzende Abbildung für die Herstellung der Gele. Diese Bilder zeigen die in die Vertiefungen gegossen Gele. Das Gel Medium, das die Zellen enthält, ist zähflüssig und kann leicht und Form sichelförmige Form in der gut gelieren. (A) Das linke Bild zeigt , dass die Gele richtig gegossen werden, und das rechte Bild zeigt das Schema "neat zylindrische Form". (B </ Strong>) Das linke Bild zeigt, dass die Gele verformen, und das rechte Bild zeigt, dass Luftblasen die Gele verunreinigen. (C) Die Gele sind weich, so leicht beschädigt werden und in der Regel verformen wie "Pac-Man". Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Die Schritte zur Messung der Gel - Größe. (A) Die Gel - Dokumentations - System besteht aus einem PC und einem Gel - Bildgebungssystem. (B) Die "Bildaufnahme - Taste" und ein Bild der Gele. (C) Die "detection", und das Fenster zur Einstellung des Messbereichs (gelber Kreis). (D) Die "auto-detection - Taste" und die Software macht eine Heatmap der Gele aus einem Bild zu de Zum Schutz der Umriss der Gele. (E) Die Software extrahiert die Umrisse der Gele durch Bildverarbeitung und berechnet durch den Umriss umgeben Bereiche. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Morphologien EMT-induzierten Zellen. A549 humanen Lungen Epithelien wurden bei einer Dichte von 1,0 × 10 5 Zellen / Vertiefung in einer Platte mit 6 Vertiefungen plattiert und inkubiert mit oder ohne 5 ng / ml TGF-β1 und 10 ng / ml TNF-α für 48 Stunden, gefolgt von Phasenkontrast eine mikroskopisch visuelle Darstellung. (A) und (B) sind Bilder , die unter × 200 erhalten. Die Maßstabsbalken in (A) und (B), 100 & mgr; m. t = "_ blank"> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4. EMT Stimulation mit TGF-β1 und TNF-α. (A) qRT-PCR - Analyse von EMT - Marker - Expression (CDH1, VIM und ACTA2). (B) Western - Blot , der die Expression von E-Cadherin zeigt, N-Cadherin, Vimentin und glatten Muskelzellen alpha Proteine ​​in A549 - Zellen mit oder ohne TGF-β1 und TNF-α stimulierten Aktin. α-Tubulin wurde als interne Kontrolle verwendet. A549-Zellen wurden wie in 1 N = 3 unabhängigen Experimenten. ** P <0.01; Fehlerbalken stellen SEM. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

iles / ftp_upload / 53974 / 53974fig5.jpg "/>
Abbildung 5. Zellen , die eine EMT Acquired Kontraktilität. A549 - Zellen wurden bei einer Dichte von 1,0 x 10 6 Zellen / Schale in 10 - cm - Schalen ausplattiert und inkubiert mit oder ohne 5 ng / ml TGF-β1 und 10 ng / ml TNF-α für 48 Stunden. Die Zellen wurden dann in 500 ul Medium gegossen 1,75 mg / ml Kollagen - Gel mit einer Dichte von 3,0 × 10 5 Zellen / Vertiefung in einer Platte mit 24 Vertiefungen enthält. Nach der Gelbildung, wurden sie mit oder ohne 5 ng / ml TGF-β1 und 10 ng / ml TNF-α in 60 mm - Schalen zu Medium zugegeben und für 72 h durch Abbilden (A) und anschließend inkubiert. Gel Größen gemessen nach 0, 24, 48 und 72 h ein Bildanalysesystem verwendet wird. N = 9 unabhängigen Experimenten (B). ** P <0.01; Fehlerbalken stellen SEM. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Gene - Name Vorwärts 5 '→ 3' Reverse 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
VIM GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tabelle 1. Primer - Sequenzen. Die Primersequenzen verwendet für qRT-PCR. GAPDH wurde als interne Kontrolle verwendet.

Lysis Buffer: RIPA - Puffer
20 mM Tris-HCl pH 7,5
150 mM NaCl
1 mM EDTA
1% Polyoxyethylen (9) ether octyiphenyl
0,1% Na-Desoxycholat
0,1% SDS
Blockierungspuffer
1% Blockierungsreagenz in Waschpuffer
Waschpuffer: TBST-Puffer
NaCl 45 g
1 M Tris pH 7,4 50 ml
Polyoxyethylen (20) Sorbitan-Monolaurat 2,5 ml
destillieren Wasser in den 5 L
5 L

Tabelle 2. Die Komponenten der Puffer verwendet. Die Komponenten der Lyse, Blockierungspuffer und Waschpuffer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Das Protokoll in dieser Studie entwickelt umfasst zwei Schritte. Der erste Schritt wird durchgeführt, EMT zu induzieren, während der zweite Schritt ist die Gelkontraktion Assays. Da es wichtig ist, um zu bestätigen, dass die Zellen EMT unterzog, Stufe 2 bietet eine hervorragende Ergänzung zu den morphologischen und Veränderungen der Genexpression. Frühere Studien zeigten , dass EMT von A549 - Zellen durch TGF-β1 induzierten wurde nur 24; aber, wie wir vorher 10, TNF-α - Behandlung berichtet wurden verbessert EMT und der Erwerb von mesenchymalen Zellmarker. Es wird angenommen , dass die Mechanismen der TGF-β-vermittelten EMT ist smad abhängige 25. TNF & agr; erhöht TGF-β1 induzierten EMT, die Verstärkung der Gelkontraktion führt. Es wurde berichtet, dass die Mechanismen der TNFa zur Verbesserung der TGF-β1-induzierte EMT sind nicht nur die Phosphorylierung von Smad2 Linkerregion, sondern auch MAPK - Signalregelung 26. Daher enthalten das Protokoll in dieser Studie entwickelt stimulation sowohl von TGF-β1 und TNF-α.

Die Einbettung von Zellen, die EMT in der Art unterzog ich Gel-Kollagen, und schwimmt auf dem Medium sind zentrale Aspekte dieses Tests (Schritt 4). Weil die Gele sind weich und leicht beschädigt werden, und haben unterschiedliche Abmessungen auf jeder Seite, ist äußerste Vorsicht erforderlich ist, wenn die Gele auf das Medium Anwendung und ihre Größen messen. Wenn es schwierig ist , diesen Schritt durchzuführen, gibt es eine alternative Methode , ohne sich zu bewegen , die Gele in 60 - mm - Schale 27,28 die Gelgrößen in das Bohrloch zu messen. Es gibt verschiedene Probleme, ist das erste Problem, dass das Kollagen-Gelen bei RT leicht gelieren, so dass die Gele oft wie in Schritt 4.7 erwähnt verformen. Daher muss die Platte sanft nach dem Gießen der Gele in die Vertiefungen geschüttelt werden, um sicherzustellen, dass sie auf eine saubere zylindrische Form. Das zweite Problem ist, dass, wenn Luftblasen die Gele während der Gelierung eintreten, dann ist die Größe der Gele ungleichmäßig sein wird. Achten Sie darauf, keine Luft bubbl zu ermöglichenes die Gele zu verunreinigen. Es gibt zwei Hauptunterschiede zwischen ursprünglichen Methode und dieses Verfahren. Die ersten Unterschiede ist, dass die Endkonzentration an Kollagen-Gelen von ursprünglichen Methode beträgt 0,75 mg / ml, aber dass dieser Methode ist, 1,75 mg / ml, um die Gele zu ermöglichen, mehr schrumpfen, als sie mit der ursprünglichen Methode tun. Die zweite Unterschiede ist, dass die ursprüngliche Methode Serum freies Medium für Gel Floating-Medium verwendet, aber diese Methode verwendet 1% FBS in dem Gel schwebenden Medium, um die Lebensfähigkeit der Zellen zu halten und Zellkontraktilität halten.

Das Gel Kontraktionsassay ursprünglich für Fibroblasten entwickelt ist ein ideales in vitro - Modell für die Kontraktilität von Zellen , die Auswertung 13 zu dem Prozess der Wundheilung und Fibrose bei. Die Befestigung von Fibroblasten 1 Kollagen Typ soll mechanische Spannungen zu erzeugen, die folglich in der Größe der Kollagengele zu einer Reduktion führt. Darüber hinaus hat dieser Test kürzlich verwendet worden istals ein in vitro - Modell für die Kontraktion von Atemwegszellen in Entzündungskrankheiten studiert, einschließlich Bronchialasthma und COPD 29-31.

Die Gelkontraktion Assay ist vergleichbar mit anderen Assays, wie Zellmigrationsassays, daß es keine besonderen Vorrichtungen erfordert und eine hohe quantitative Reproduzierbarkeit. Allerdings gibt es nur wenige Berichte über die Gelkontraktion Test der Anwendung für die Bewertung EMT 32. In dieser Studie, Gelen Zellen enthält, die 24 bis 72 Stunden nach der Gelbildung unterzogen verringert EMT signifikant in der Größe, was anzeigt, Zellkontraktion. Es gibt jedoch Einschränkungen für diese Methode. Der erste ist, dass in diesem Assay die Größenänderung der Gele die Summe der Kontraktilität aller Zellen in den Gelen zeigen. Unter Verwendung dieses Tests ist es jedoch schwierig, einzelne Zelle Kontraktilität in den Gelen zu beurteilen. Die zweite ist, dass A549-Zellen eine Krebszelllinie, nicht normalen menschlichen Epithelzellen. Daher ist es schwierig, o zu extrapolierenur Ergebnisse direkt an der Pathogenese der Lungenfibrose. Jedoch werden die Zellen A549 weithin zur Untersuchung der Funktionen von Epithelzellen der Atemwege verwendet werden, und mehrere Studien ergaben Hinweise auf EMT von A549 - Zellen als Modell für Lungenfibrose 33,34 verwenden.

Zusammenfassend, Collagen vom Typ I Gelen mesenchymalen Zellen enthält, die EMT unterzog sich in der Größe reduziert wurden, was darauf hinweist Kontraktion dieser Zellen. Somit sollte die Gelkontraktion Assay als verlängerte in - vitro - Test betrachtet werden Erwerb der kontraktilen Funktion in den Zellen durch EMT Verfahren zu bewerten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben keine Interessenkonflikte offen zu legen.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Entwicklung eines<em&gt; In Vitro</em&gt; Assay Kontraktionsfunktion von mesenchymalen Zellen, die Unterzog Epithelial-mesenchymale Transition zur Bewertung
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter