Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

פיתוח של doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פיברוזיס מעורב בפתוגנזה של מחלות פרוגרסיבי שונות כרוניות, כגון מחלת ריאות אינטרסטיציאלית, סיסטיק לב, שחמת כבד, אי ספיקת כליות סופנית, טרשת מערכתית, ומחלות אוטואימוניות מחלה 1. בין מחלות ריאה אינטרסטיציאלית פיברוזיס ריאתי אידיופתי (IPF) הוא מחלה מתקדמת כרונית ומראה פרוגנוזה גרועה. סימן היכר הפתולוגי של IPF הוא הפיתוח של מוקדי fibroblastic המורכבים פיברובלסטים מופעל myofibroblasts המשויכים הפרוגנוזה. מקורותיה של פיברובלסטים ריאתי כאלו מוצעות לנבוע מכמה תאים mesenchymal, כולל fibroblasts ריאות תושב במקור ומדחסים fibrocytes ממח העצם. לאחרונה, מעבר mesenchymal-אפיתל (EMT) הוצע להיות מזוהה עם ההיווצרות של תאי mesenchymal 2, ולתרום בפתוגנזה של פרעות fibrotic.

הוא חשב כי EMT משחק תפקידים חשובים בתהליך של התפתחות עוברת, ריפוי פצעים, והתקדמות של סרטן, כולל חדירת גידול וגרור 3. בעקבות התהליך של EMT, תאי אפיתל להשיג את היכולת של תאי mesenchymal ידי אובדן של סמנים אפיתל, כגון E-cadherin, ועל ידי ביטוי של סמני mesenchymal, כגון vimentin, יקטין שריר α-חלקה (SMA) 4,5. מחקרים קודמים הראו הראיות כי תהליך EMT כבר קשור להתפתחות של סיסטיק רקמות הכליה 6 וריאות 7. בנוסף, דלקת כרונית מקדמת fibrotic מחלת 8; יתר על כן, ציטוקינים דלקתיים כגון חבר superfamily גורם גידול נמק 14 (TNFSF14; LIGHT), tumor necrosis factor (TNF) -α, ו- interleukin-1β, הוכחו לשפר EMT 9-12.

assay התכווצות ג'ל קולגן, assay התכווצות תא מבוסס קולגן, אשר פיברובלסטים מוטבעים מהסוג Iקולגן ג'ל תלת ממדית, הוא אידיאל במודל חוץ גופית לצורך הערכה של התכווצות. התכווצות היא אחת הפונקציה האופיינית של פיברובלסטים ותורמת תיקון פצע נורמלי סיסטיק 13. ב assay זה, הוא חשב כי את הקובץ המצורף של פיברובלסטים Type I קולגן באמצעות מנגנוני integrin תלוי אמור לייצר מתח מכאני בתנאים מסוימים, וכתוצאה מכך להוביל להתכווצות רקמות.

כאן, בפיתוח של assay התכווצות ג'ל מדווח להיות מותאם על מנת להעריך את רכישת פונקצית התכווצות בתאים שעברו EMT. דו"ח זה מדגים כי assay שונה זו מתאימה להערכת contractility בתאי mesenchymal שעברו EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

תכשירי 1. והתרבות של תאי אפיתל הריאות

  1. תאי אפיתל ריאה אנושית A549 תרבות (שורת תאים חסיד) ב בינוני הנשר שונה של Dulbecco (DMEM) בתוספת 10% בסרום שור העובר (FBS), 100 IU / פניצילין מ"ל, 100 מיקרוגרם / מ"ל ​​סטרפטומיצין.
  2. סר וזורק תקשורת תרבית תאים מן מנת התרבות, ולשטוף פעם עם 5 - 10 מיליליטר של בופר פוספט (PBS). לאחר הכביסה, מיד לשאוב PBS.
  3. הוסף 2 מ"ל טריפסין / חומצה ethylenediaminetetraacetic (EDTA) (0.05%) ו לדגור על 37 מעלות צלזיוס, 5% CO 2 דקות 3.
  4. אוסף את התא המנותק צינורות צנטריפוגה המכילים בינוני תרבית תאים, צנטריפוגה הצינורות ב RT במשך 4 דקות ב g 150 ×.
  5. Resuspend התאים גלולה ב 2 מ"ל של מדיום תרבית תאים ולהסיר מדגם עבור ספירת תאים. ספירת התאים באמצעות hemocytometer עם כתם כחול Trypan לבדוק כדאיות התא.
  6. תאי A549 זרע על10 ס"מ קלקר צלחות בצפיפות של 0.5 - 1.0 × 10 6 תאים / תבשיל עם 10 מ"ל של מדיום עבור assay התכווצות ג'ל. זרעים התאים על 6 צלחות קלקר גם בצפיפות של 0.5 - 1.0 × 10 5 תאים / היטב עם 2 מ"ל של מדיום לאישור EMT. דגירת התאים ב 37 מעלות צלזיוס, 5% CO 2 למשך 24 שעות.

נוהל EMT 2.

  1. הוסף 10 μl של-β1 TGF (5 מיקרוגרם / מ"ל) ו -10 μl של-α TNF (10 מיקרוגרם / מ"ל) לצלחת עבור assay התכווצות ג'ל זורעים בשלב 1.6. הוסף 2 μl של-β1 TGF (5 מיקרוגרם / מ"ל) ו -2 μl של-α TNF (10 מיקרוגרם / מ"ל) לצלחת לאישור EMT זורעים בשלב 1.6. לדגור על 37 מעלות צלזיוס, 5% CO 2 למשך 48 שעות.

3. אישור של נוהל EMT ידי PCR ו המערבי סופג

  1. אשר שינוי במורפולוגיה (מאבן דמוי חלוק כדי ציר צורה) של תאים שטופלו באמצעות מיקרוסקופ לעומת שלב.
    הערה: נורםיש תאי A549 אל חלוק אבן דמוית ומראה בצורה משולש היא מאפיין של תאי אפיתל, אך לאחר גירוי עם-β1 TGF ו-α TNF, התאים להופיע ארוכים ציר בצורה דומה תאי mesenchymal 14,15.
  2. חישוב הביטוי של סמן אפיתל, כגון E-cadherin, וסמנים mesenchymal כגון N-cadherin, vimentin, אקטין שריר α-חלקה באמצעות PCR או המערבי סופג.
    1. חלץ RNA הכולל את התאים באמצעות ערכת חילוץ RNA 16 לסנתז cDNA באמצעות transcriptase הפוכה 17 על פי פרוטוקול של היצרן.
    2. למדוד ביטוי של רמות ה- mRNA באמצעות מערכת בזמן אמת PCR 18 וערכת PCR לצבוע cyanine monomeric פי הוראות היצרנים. פריימרים ספציפיים עבור GAPDH (glyceraldehyde dehydrogenase 3-פוספט), ACTA2 (אלפא-אקטין 2), CDH1 (cadherin-1; E-cadherin), ו VIM (vimentin) מוצגים בלוח 1
    3. Lyse את התאים באמצעות חיץ תמוגה (טבלה 2) תמיסה המכילה קוקטייל מעכב 1% פרוטאז. למדוד את כל ריכוזי חלבון מדגם באמצעות ערכת assay חלבון 19,20, ולהחיל אותן כמויות של חלבון ג'ל polyacrylamide.
      1. בצע-ג'ל אלקטרופורזה SDS והעביר חצי יבש של חלבוני קרום PVDF 21. דגירה הממברנה עם נוגדנים ראשוניים בחסימת המאגר עבור 1 - שעות 2. לאחר דגירה, לשטוף פעמים הממברנה עם חיץ לשטוף דגירת hr קרום 1 עם נוגדנים שניים.
        הערה: עיין חומרים / ציוד שולחן עבור נוגדנים דילולים שימוש במחקרים אלה. ראה טבלה 2 עבור רכיבי חסימת חיץ.
      2. לשטוף את הממברנה עם חיץ לשטוף פעמיים. צלם תמונות של הקרום עם ערכת זיהוי המערבית סופגת 22 באמצעות 11,23 מצלמת CCD קר.

4. Assay התכווצות ג'ל EMT הערכה

  1. לשאוב התקשורת מותנה מספינת תרבית תאים, ולשטוף היטב עם 5 - 10 מ"ל של PBS להסיר תאים מתים. לאחר הכביסה, מיד לשאוב PBS.
  2. הוסף 2 מ"ל של 0.05% טריפסין / EDTA ו לדגור על 37 מעלות צלזיוס, 5% CO 2 דקות 3.
  3. אוספים את התאים מנותקת צינורות צנטריפוגה המכיל DMEM בתוספת מעכב טריפסין (1 מ"ג / מ"ל), צנטריפוגה צינורות ב RT במשך 4 דקות ב 150 × גרם.
  4. מערבבים סוג 1 ג'ל קולגן עם מים מזוקקים, ו -4 × מרוכזים DMEM להתאים את הכרכים כדי להשיג ריכוז הקולגן של 1.75 מ"ג / מ"ל, 1 × ריכוז DMEM. הקפד לשמור המדיום ג'ל על הקרח במהלך שלב זה.
    הערה: כדי להפוך 6 מ"ל של מדיום ג'ל, ומערבבים היטב 3.5 מ"ל של ג'ל קולגן מסוג 1 (3 מ"ג / מ"ל), 1.5 מ"ל של 4 × מרוכזים DMEM, ו 1ml של מים מזוקקים.
  5. Resuspend התא גלולה ב 500 μl של PBS ולהסיר מדגם עבור ספירת תאים. לספורמספר התאים באמצעות hemocytometer עם כתם כחול trypan לבדוק כדאיות התא.
  6. הוסף בינוני ג'ל להתאים את הכרכים להשיג צפיפות התאים של 3.0 × 10 5 תאים / טוב (6.0 × 10 5 תאים / מ"ל) בעדינות אך במהירות לערבב אותו על ידי pipetting ללא gelation.
  7. לוותר 0.5 מיליליטר של התערובת לבאר כל צלחת 24 גם שאינם מטופלים במהירות ובזהירות לעשות בצורה גלילית מסודרת. היזהר שלא לאפשר כל בועות אוויר לזהם את הג'לים (איור 1 א).
    הערה: בינוני ג'ל המכיל את התאים הוא צמיג ויכול ג'ל טופס סהר צורה בקלות הבאר.
  8. דגירה את הצלחת במשך 15 דקות בתוך חממת תא ב 37 מעלות צלזיוס, 5% CO 2 ולחות 95% להגליד לחלוטין.
  9. ניתוק ג'לים מהצלחת בלי לשבור על ידי הזזת מרית מעוקרת באופן לצייר היקף בכיוון אחד. בעזרת מרית, להעביר את הג'לים בעדינות תרבות מנות 60 מ"מ רקמההמכיל 5 מ"ל של FBS% DMEM / 1 עם או בלי-β1 TGF (5 ng / ml) ו-α TNF (10 ng / ml).
  10. נער בעדינות את הכלים כדי להבטיח ג'לים צף על המדיום. מדגירים את תא חממה על 37 מעלות צלזיוס, 5% CO 2 ולחות 95%.

מדידת 5. ג'ל גודל

  1. מדוד את גודל ג'ל קולגן לאחר 0, 24, 48, ו -72 שעות באמצעות מערכת ניתוח תמונה.
    1. הפעל את מערכת תיעוד ג'ל (איור 2 א), ולשים מנות לתוך ארון מגן אור. ואז מסירים את המכסה של הצלחות בארון הכלים.
    2. פתח את התוכנה לניתוח ג'ל קשורה. לחץ על "כפתור רכישת תמונה" בבר-התפריט כדי להציג את התמונה של הג'לים בקבינט. לאחר מכן, לחץ "לרכוש" בשורת התפריטים כדי לצלם את ג'לים (איור 2 ב).
    3. לחץ על "כפתור זיהוי" בשורת התפריטים (איור 2 ג) ולהתאים באזור המדידה (i עיגול צהובn איור 2C) על ידי גרירת העכבר. לאחר מכן, לחץ על "איתור אוטומטי כפתור" בשורת התפריטים (ראה כפתור באיור 2D). התוכנה מזהה אוטומטית את הג'לים מראים מפת חום (איור 2 ד).
    4. לחץ "אישור" כדי לחלץ את קווי המתאר של ג'ל על ידי עיבוד תמונה ולחשב אזורים המוקפים המתאר (האיור 2E). אחרי השטח חושב, באזור המחושב מוצג חלון מוקפץ נפרד.
      הערה: אם את הג'לים חופפים זה לזה במהלך ההדמיה, להעביר ג'לים בעדינות בעזרת קצה פיפטה סטרילית.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

במהלך EMT, תאי אפיתל לאבד סמנים אפיתל, כמו E-cadherin, ולהשיג ביטוי של סמנים mesenchymal, כגון vimentin ו α-שריר חלק אקטין 4,5. דגירה של תאי אפיתל ריאה האנושית A549 עם-β1 TGF ו- TNF-α גורמת EMT. הופעתו של תאי A549 נורמלים הם אבן חלוק כמו צורה וצורה משולשת היא מאפיין של תאי אפיתל (איור 3 א), אלא לאחר מגורה עם TGF-β1 ו- TNF-α, את המראה השתנה לצורתו ציר הארוכה דומה mesenchymal תאים (איור 3).

הביטוי של סמנים אפיתל mesenchymal הוערך כדי לאשר התאים עברו EMT. ביטוי mRNA יחסית חושב עם שיטת ΔΔCt. נתונים הפרט היה מנורמל נגד dehydrogenase glyceraldehyde-3-phosphate (GAPDH) כי הוא משק gפנטן. תאים A549 שטופלו-β1 TGF ו-α TNF במשך 48 שעות היה מופחת באופן משמעותי ביטוי CDH1 והגדילה משמעותית הביטוי של VIM ו ACTA2 (איור 4 א). רצפים פריימרים המשמשים Q-PCR מוצגים Table1. כפי שניתן לראות בתרשים 4 ב ', גירוי עם TGF-β1 ו- TNF-α ביטוי E-cadherin המוחלש, ואילו הביטוי של vimentin, N-cadherin, יקטין שריר α-החלקה הושר.

את assay התכווצות ג'ל בוצע על מנת להעריך את ההתכווצות של תאים שעברו EMT. לאחר גרימת EMT עם-β1 TGF ו- TNF-α, תאים נוצקו לתוך ג'ל קולגן וטופחו במשך 72 שעות ב מדיה המכילה TGF-β1 ו- TNF-α, או PBS. כפי שניתן לראות בתרשים 5A, ג'לים המכילים תאים שטופלו TGF-β1 ו- TNF-α היו קטנים יותר מאשר ג'לים מלאה המכיל תאים שטופלו PBS. כדי קואהntify השינויים בגודל ג'ל, ג'ל נותחו באמצעות נתח ג'ל 0, 24, 48, ו -72 שעות לאחר הטיפול. לאחר 72 שעות, בגדלים של ג'ל המכיל תאים שטופלו-β1 TGF ו- TNF-α הופחתו באופן משמעותי לעומת הג'לים הביקורת (איור 5). גם אנחנו אישר כי ג'ל המכיל תאים שטופלו-β1 TGF לבד היו קטנים יותר מאשר ג'ל שליטה אך לא היו קטנים יותר מאשר את הג'לים שטופלו-β1 TGF ו-α TNF (מידע לא מוצג).

איור 1
איור 1. איור משלים להכנת ג'לי. תמונות אלו מראות את הג'לים יצוקים לתוך בארות. מדיום ג'ל המכיל את התאים הוא צמיג ויכול ג'ל בקלות ובצורת סהר טופס הבאר. (א) את התמונה השמאלית מראה כי ג'לים casted כראוי, ואת התמונה הימנית מראה את הסכימה של "בצורת גלילית מסודרת". (B </ Strong>) את התמונה השמאלית מראה כי ג'לים לעוות, והתמונה מימין מראה כי בועות אוויר לזהם את הג'לים. (C) הג'לים רכים, כך נפגע בקלות ובדרך כלל לעוות כמו "פק-מן". אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. שלבים למדידת ג'ל גודל. (א) מערכת תיעוד ג'ל מורכב PC ומערכת הדמיה ג'ל. (ב) "כפתור הרכישה", ותמונה של ג'ל. (ג) "כפתור זיהוי", והחלון להתאמת באזור המדידה (עיגול צהוב). (ד) "כפתור האיתור אוטומטי", והתוכנה עושות מפת חום של הג'לים מתמונה לדה tect את קווי המתאר של ג'ל. (E) התוכנה מחלצת את קווי המתאר של ג'ל על ידי עיבוד תמונה, ומחשב באזורים מוקפים המתווה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3. מורפולוגיות של תאי נגרם EMT. Epithelia הריאה האנושי A549 היה מצופה בצפיפות של 1.0 × 10 5 תאים / גם בצלחת 6 באר וטופח עם או בלי 5 ng / ml TGF-β1 ו -10 ng / ml TNF-α במשך 48 שעות, ואחריו הדמיה מיקרוסקופית לעומת שלב. (א) ו- (ב) הם תמונות שהושגו לפי × 200. ברי המידה (א) ו- (ב), 100 מיקרומטר. t = "_ blank"> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4. גירוי EMT עם-β1 TGF ו-α TNF. (א) qRT-PCR ניתוח של ביטוי סמן EMT (CDH1, VIM, ו ACTA2). (ב) כתם המערבי מראה את הביטוי של-cadherin E, N-cadherin, vimentin, ואת אלפא שריר חלק אקטין חלבונים בתאים A549 מגורה עם או בלי TGF-β1 ו-α TNF. α-טובולין שימש הבקרה הפנימית. תאי A549 היו בתרבית כמו באיור 1. N = 3 ניסויים בלתי תלויים. ** P <0.01; ברי שגיאה מייצגים SEM. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Iles / ftp_upload / 53,974 / 53974fig5.jpg "/>
איור 5. תאים שעברו EMT הנרכשות התכווצות. תאי A549 היו מצופים בצפיפות של 1.0 x 10 6 תאים / תבשיל במנות 10 סנטימטרים וטופחו עם או בלי 5 ng / ml TGF-β1 ו -10 ng / ml TNF-α במשך 48 שעות. תאים נוצקו מכן לתוך 500 μl של מדיום המכיל 1.75 מ"ג / קולגן ג'ל מ"ל בצפיפות של 3.0 × 10 5 תאים / גם בצלחת 24 גם. לאחר היווצרות קריש, הם נוספו בינוני עם או בלי 5 ng / ml TGF-β1 ו -10 TNF-α ng / ml ב 60 מנות מ"מ וטופחו במשך 72 שעות ואחריו הדמיה (א). בגדלי ג'ל נמדדו לאחר 0, 24, 48, ו -72 שעות באמצעות מערכת ניתוח תמונה. N = 9 ניסויים בלתי תלויים (B). ** P <0.01; ברי שגיאה מייצגים SEM. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

יפ-together.within-page = "1" FO: keep-עם-next.within-page = "תמיד">
ג'ין שם קדימה 5 '→ 3' הפוך 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
מֶרֶץ GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

רצפים בטבלה 1. פריימר. רצפים פריימר המשמש qRT-PCR. GAPDH שמש בקרה פנימית.

together.within-page = "1" FO: keep-עם-next.within-page = "תמיד">
הצפת תמוגה: הצפת ריפה
20 mM Tris-HCl pH 7.5
150 מ"מ NaCl
1 mM EDTA
1% Polyoxyethylene (9) אתר octyiphenyl
0.1% Na-deoxycholate
0.1% SDS
חסימת הצפה
1 מגיב חסימת% חיץ לשטוף
חיץ שטפי: חיץ TBST
NaCl 45 גרם
1 M טריס pH 7.4 50 מ"ל
Polyoxyethylene (20) monolaurate Sorbitan 2.5 מ"ל
לזקק מים להוסיף 5 L
5 L

טבלה 2. מרכיבי חוצצים משומשים. מרכיבי התפרקות חיץ חסימת חיץ לשטוף.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הפרוטוקול שפותח במחקר זה כולל שני שלבים. השלב הראשון מתבצע על מנת לגרום EMT, ואילו השלב השני הוא assay התכווצות ג'ל. מאז חשוב לאשר תאים עברו EMT, שלב 2 מספק השלמה מצוינת שינויי ביטוי מורפולוגיים גן. מחקרים קודמים הראו כי EMT של תאי A549 הושר על ידי TGF-β1 רק 24; עם זאת, כפי שכבר דווח בעבר 10, טיפול-α TNF משפרים EMT ורכישת סמני תא mesenchymal. הוא חשב כי מנגנוני EMT TGF-β בתיווך הוא הסמאד תלוי 25. TNFα משפר EMT-induced TGF-β1 שמוביל שיפור של התכווצות ג'ל. זה כבר דווח כי מנגנוני TNFα עבור שיפור של EMT TGF-β1-induced אינם זירחון רק של אזור מקשר smad2, אלא גם MAPK איתות תקנה 26. לפיכך, פרוטוקול שפותח במחקר זה כלל Stimulation ידי שני β1-TGF ו-α TNF.

הטבעה של תאים שעברו EMT לתוך סוג אני קולגן ג'ל, ומרחף על המדיום, הם היבטים מרכזיים של assay זה (שלב 4). מאחר ג'ל רכה נפגעו בקלות, ויש ממדים שונים בכל צד, בזהירות רבה נדרשת בעת יישום ג'לים למדיום ומדידת הגדלים שלהם. אם קשה לבצע את הצעד הזה, יש שיטה חלופית כדי למדוד את גדלי ג'ל הבאר מבלי להזיז את הג'לים לתוך 60 מ"מ צלחת 27,28. ישנן מספר בעיות נפוצות, הבעיה הראשונה היא כי ג'ל קולגן gelate בקלות ב RT, אז הג'לים לעתים קרובות לעוות כאמור בשלב 4.7. לכן, הצלחת חייבת להיות מזועזעת בעדינות אחרי הליהוק הג'לים לתוך בארות כדי לוודא שהם לובשים צורה גלילית מסודרת. הבעיה השנייה היא שאם כל בועות אוויר להיכנס ג'לים במהלך gelation, אז את גודל ג'ל יהיה אחיד. היזהר שלא תאפשר לאויר bubbles לזהם את הג'לים. ישנם שני הבדלים עיקריים בין השיטה המקורית והשיטה. ההבדלים הראשון הוא כי ריכוז סופי של ג'ל קולגן של השיטה המקורית הוא 0.75 מ"ג / מ"ל ​​אבל זה של שיטה זו הוא 1.75 מ"ג / מ"ל ​​על מנת לאפשר את הג'לים להתכווץ יותר ממה שהם עושים עם השיטה המקורית. ההבדלים השניים הוא השיטה המקורית משתמשת במדיום חופשי בסרום בינוני ג'ל צף אך שיטה זו משתמשת 1% FBS במדיום צף ג'ל על מנת לשמור על כדאיויות תא ולשמור התכווצות תא.

את assay התכווצות ג'ל פותח במקור עבור פיברובלסטים הוא אידאל במודל חוץ גופייה על מנת לאמוד את ההתכווצות של תאים שתורמים לתהליך של ריפוי פצע סיסטיק 13. הקובץ המצורף של פיברובלסטים, הקלד 1 קולגן אמור לייצר מתחים מכאניים וכתוצאה מכך מובילה לירידה בגודל של ג'ל קולגן. בנוסף, assay זה לאחרונה נעשה שימושכמודל חוץ גופית לחקר התכווצות של תאים בדרכי הנשימה במחלות דלקתיות, כולל אסטמה ו- COPD 29-31.

את assay התכווצות ג'ל ניתן להשוות מבחנים אחרים, כגון מבחני נדידת תאים, בכך שהיא אינה דורשת מכשירים ספציפיים ותערוכות שחזור וכמותית גבוהה. עם זאת, ישנם כמה דיווחים החלת assay התכווצות ג'ל להערכת EMT 32. במחקר זה, ג'לים המכילים תאים שעברו EMT ירד משמעותית בגודל 24 עד 72 שעות לאחר gelation, המציין התכווצות התא. יש עם זאת מגבלות לשיטה זו. הראשונה היא כי ב assay זה, השינוי בגודל של הג'לים להראות סכום של התכווצות של כל התאים את הג'לים. עם זאת, קשה להעריך התכווצות תא בודד בג'לים באמצעות assay. השני הוא כי תאי A549 הוא קו תאים סרטניים, לא תאי אפיתל אדם נורמלים. לכן, קשה להסיק oתוצאות ur ישירות בפתוגנזה של פיברוזיס ריאתי. עם זאת, תאי A549 נמצאים בשימוש נרחב כדי ללמוד את הפונקציות של תאי אפיתל דרכי נשימה, וכמה מחקרים הניבו ראיות של EMT באמצעות תאי A549 כמודל של פיברוזיס ריאתי 33,34.

לסיכום, את הסוג שאני קולגן ג'ל המכיל תאי mesenchymal שעברו EMT הופחת בגודל, המציין התכווצות של תאים אלה. לפיכך, assay התכווצות הג'ל צריך להיחשב assay מורחבת במבחנה להעריך רכישת פונקצית התכווצות בתאים בתהליך EMT.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

יש המחברים אין ניגודי אינטרסים לחשוף.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
פיתוח של<em&gt; במבחנה</em&gt; Assay לאבחון תפקוד התכווצות של תאי mesenchymal שעבר אפיתל-mesenchymal מעבר
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter