Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

एक का विकास doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

फाइब्रोसिस जैसे कि मध्य फेफड़े के रोग, हृदय फाइब्रोसिस, लीवर सिरोसिस, टर्मिनल गुर्दे की विफलता, प्रणालीगत काठिन्य, और autoimmune रोग 1 के रूप में विभिन्न पुरानी प्रगतिशील रोगों के रोगजनन में शामिल है। मध्य फेफड़ों के रोगों के अलावा, अज्ञातहेतुक पल्मोनरी फाइब्रोसिस (आईपीएफ) एक पुरानी प्रगतिशील बीमारी है और गरीब पूर्वानुमान से पता चलता है। आईपीएफ के रोग बानगी सक्रिय fibroblasts और myofibroblasts है कि रोग का निदान के साथ जुड़े रहे हैं से मिलकर fibroblastic foci का विकास है। इस तरह के फेफड़े fibroblasts के मूल मूल निवासी फेफड़े fibroblasts सहित और अस्थि मज्जा से fibrocytes घूम कई mesenchymal कोशिकाओं से व्युत्पन्न किया जाना प्रस्तावित है। हाल ही में, उपकला-mesenchymal संक्रमण (EMT) mesenchymal कोशिकाओं 2 के गठन के साथ जुड़े होने के लिए प्रस्तावित किया गया है, और fibrotic विकारों के रोगजनन में योगदान के लिए।

यह सोचा है कि ईएमटी भ्रूण के विकास की प्रक्रिया में महत्वपूर्ण भूमिका, घाव भरने, और कैंसर की प्रगति, ट्यूमर आक्रमण और मेटास्टेसिस 3 सहित निभाता है। EMT की प्रक्रिया के बाद, उपकला कोशिकाओं में इस तरह के ई cadherin के रूप में उपकला मार्कर, के नुकसान से mesenchymal कोशिकाओं की क्षमता प्राप्त है, और इस तरह के रूप में vimentin mesenchymal मार्करों, और α चिकनी पेशी actin (SMA) 4,5 की अभिव्यक्ति से। पिछले अध्ययनों से सबूत है कि EMT प्रक्रिया गुर्दे और फेफड़ों 6 7 में ऊतक फाइब्रोसिस के विकास के साथ संबद्ध किया गया है पता चला है। इसके अतिरिक्त, जीर्ण सूजन की बीमारी fibrotic 8 बढ़ावा देता है; इसके अलावा, ट्यूमर परिगलन कारक superfamily सदस्य 14 (TNFSF14, प्रकाश) के रूप में इस तरह के भड़काऊ साइटोकिन्स, ट्यूमर नेक्रोसिस फैक्टर (TNF) -α, और इंटरल्यूकिन 1β, EMT 9-12 बढ़ाने के लिए दिखाया गया है।

कोलेजन जेल संकुचन परख, एक कोलेजन आधारित सेल संकुचन परख जिसमें fibroblasts प्रकार मैं में एम्बेडेड रहे हैंकोलेजन जेल तीन dimensionally, सिकुड़ना के मूल्यांकन के लिए इन विट्रो मॉडल में एक आदर्श है। सिकुड़ना fibroblasts की विशेषता कार्यों में से एक है और सामान्य घाव की मरम्मत और फाइब्रोसिस 13 में योगदान देता है। इस परख में, यह सोचा है fibroblasts की कुर्की टाइप करने के लिए कि मैं इंटीग्रिन निर्भर तंत्र के माध्यम से कोलेजन कुछ शर्तों के तहत यांत्रिक तनाव का निर्माण करने के लिए माना जाता है, और फलस्वरूप ऊतक संकुचन पैदा होती हैं।

इधर, जेल संकुचन परख के विकास कोशिकाओं है कि EMT कराना पड़ा में सिकुड़ा समारोह के अधिग्रहण का मूल्यांकन करने के लिए अनुकूलित होने की सूचना है। इस रिपोर्ट में यह दर्शाता है कि इस संशोधित परख mesenchymal कोशिकाओं है कि EMT कराना पड़ा सिकुड़ना में मूल्यांकन के लिए उपयुक्त है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. तैयारी और फेफड़े उपकला कोशिकाओं की संस्कृति

  1. संस्कृति A549 मानव फेफड़ों उपकला कोशिकाओं (पक्षपाती सेल लाइन) Dulbecco संशोधित ईगल मध्यम (DMEM) में 10% भ्रूण गोजातीय सीरम (FBS), 100 आइयू / एमएल पेनिसिलिन के साथ पूरक है, और 100 माइक्रोग्राम / एमएल स्ट्रेप्टोमाइसिन।
  2. निकालें और संस्कृति पकवान से सेल संस्कृति मीडिया त्यागें, और 5 के साथ एक बार धोने - फॉस्फेट बफर खारा के 10 मिलीलीटर (पीबीएस)। धोने के बाद, तुरंत पीबीएस aspirate।
  3. 3 मिनट के लिए 2 मिलीलीटर trypsin / ethylenediaminetetraacetic एसिड (EDTA) (0.05%) जोड़ें और 37 डिग्री सेल्सियस पर सेते हैं और 5% सीओ 2।
  4. सेंट्रीफ्यूज सेल संस्कृति के माध्यम से, सेंट्रीफ्यूज 150 × छ पर 4 मिनट के लिए आरटी पर नलियों युक्त ट्यूबों में अलग कोशिकाओं लीजिए।
  5. Resuspend कोशिकाओं सेल संस्कृति के माध्यम से 2 मिलीलीटर में गोली और सेल गिनती के लिए एक नमूना हटा दें। सेल व्यवहार्यता की जांच करने के लिए Trypan नीले दाग के साथ एक hemocytometer का उपयोग कोशिकाओं की संख्या की गणना।
  6. पर बीज A549 कोशिकाओं0.5 के घनत्व पर 10 सेमी polystyrene प्लेटें - जेल संकुचन परख के लिए माध्यम के 10 मिलीलीटर के साथ 1.0 × 10 6 कोशिकाओं / पकवान। 0.5 के घनत्व पर 6 अच्छी तरह से polystyrene प्लेटों पर कोशिकाओं बीज - 1.0 × 10 5 कोशिकाओं के साथ अच्छी तरह / EMT पुष्टि करने के लिए मध्यम 2 मिलीलीटर। 24 घंटे के लिए 37 डिग्री सेल्सियस पर कोशिकाओं को सेते हैं और 5% सीओ 2।

2. EMT प्रक्रिया

  1. 1.6 चरण में वरीयता प्राप्त जेल संकुचन परख के लिए थाली करने के लिए TGF-β1 (5 माइक्रोग्राम / एमएल) के 10 μl और TNF-α के 10 μl (10 माइक्रोग्राम / एमएल) जोड़ें। EMT पुष्टि 1.6 चरण में वरीयता प्राप्त के लिए थाली करने के लिए TGF-β1 (5 माइक्रोग्राम / एमएल) के 2 μl और TNF-α के 2 μl (10 माइक्रोग्राम / एमएल) जोड़ें। 48 घंटे के लिए 37 डिग्री सेल्सियस पर सेते हैं और 5% सीओ 2।

पीसीआर और पश्चिमी सोख्ता द्वारा EMT प्रक्रिया 3. पुष्टि

  1. चरण विपरीत माइक्रोस्कोपी का उपयोग इलाज कोशिकाओं के (आकार धुरी के लिए पक्की सड़क पत्थर की तरह से) आकृति विज्ञान में परिवर्तन की पुष्टि करें।
    नोट: नॉर्मअल A549 कोशिकाओं पक्की सड़क पत्थर की तरह है और त्रिकोणीय आकार उपस्थिति उपकला कोशिकाओं की एक विशेषता है कि है, लेकिन TGF-β1 और TNF-α के साथ उत्तेजना के बाद, कोशिकाओं को लंबे समय तक दिखाई देते हैं और धुरी के आकार का है कि mesenchymal कोशिकाओं 14,15 के समान है।
  2. इस तरह के ई cadherin के रूप में एक उपकला मार्कर की अभिव्यक्ति का मूल्यांकन, और पीसीआर या पश्चिमी सोख्ता का उपयोग करते हुए इस तरह के एन cadherin, vimentin, और α चिकनी पेशी actin के रूप में mesenchymal मार्करों।
    1. शाही सेना निकासी किट 16 का उपयोग कोशिकाओं से कुल शाही सेना निकालें और निर्माता प्रोटोकॉल के अनुसार रिवर्स ट्रांसक्रिपटेस 17 का उपयोग सीडीएनए synthesize।
    2. वास्तविक समय पीसीआर प्रणाली 18 और monomeric जाती डाई पीसीआर किट निर्माताओं के निर्देशों के अनुसार का उपयोग कर mRNA स्तर की अभिव्यक्ति को मापने। GAPDH के लिए विशिष्ट प्राइमरों (glyceraldehyde 3-फॉस्फेट डिहाइड्रोजनेज), ACTA2 (अल्फा-actin -2), CDH1 (cadherin -1, ई-cadherin), और विम (vimentin) तालिका 1 में दिखाया जाता है
    3. Lyse कोशिकाओं को एक lysis बफर (तालिका 2) 1% protease अवरोध कॉकटेल युक्त समाधान का उपयोग कर। एक प्रोटीन परख किट 19,20 का उपयोग कर सभी नमूना प्रोटीन सांद्रता उपाय है, और एक polyacrylamide जेल के लिए प्रोटीन का एक ही मात्रा में लागू होते हैं।
      1. एसडीएस जेल वैद्युतकणसंचलन और PVDF झिल्ली से 21 प्रोटीन के अर्द्ध शुष्क हस्तांतरण प्रदर्शन करना। 2 घंटा - 1 के लिए बफर अवरुद्ध में प्राथमिक एंटीबॉडी के साथ झिल्ली सेते हैं। ऊष्मायन के बाद, धोने बफर के साथ दो बार झिल्ली धोने और दूसरी एंटीबॉडी के साथ झिल्ली 1 घंटा सेते हैं।
        नोट: एंटीबॉडी और dilutions इन अध्ययनों में इस्तेमाल के लिए सामग्री / उपकरण तालिका देखें। बफर अवरुद्ध के घटकों के लिए 2 टेबल देखें।
      2. धोने बफर के साथ झिल्ली दो बार धोएं। पश्चिमी सोख्ता का पता लगाने किट 22 एक ठंडा सीसीडी कैमरा 11,23 का उपयोग कर के साथ झिल्ली की तस्वीरें ले लो।

4। मूल्यांकन EMT के लिए जेल संकुचन परख

  1. सेल संस्कृति पोत से वातानुकूलित मीडिया aspirate, और 5 के साथ अच्छी तरह से धो - पीबीएस के 10 मिलीलीटर मृत कोशिकाओं को हटाने के लिए। धोने के बाद, तुरंत पीबीएस aspirate।
  2. 3 मिनट के लिए 0.05% trypsin / EDTA के 2 मिलीलीटर जोड़ें और 37 डिग्री सेल्सियस पर सेते हैं और 5% सीओ 2।
  3. सेंट्रीफ्यूज युक्त DMEM 150 × छ पर 4 मिनट के लिए आरटी पर trypsin अवरोध करनेवाला (1 मिलीग्राम / एमएल), अपकेंद्रित्र ट्यूब के साथ पूरक ट्यूबों में अलग कोशिकाओं लीजिए।
  4. आसुत जल के साथ मिक्स टाइप 1 कोलेजन जेल, और 4 × केंद्रित DMEM 1.75 मिलीग्राम / एमएल के एक कोलेजन एकाग्रता को प्राप्त करने की मात्रा समायोजित करने के लिए, और 1 × DMEM एकाग्रता। इस कदम के दौरान बर्फ पर जेल मध्यम रखना सुनिश्चित करें।
    नोट: जेल माध्यम के 6 मिलीग्राम बनाने के लिए, अच्छी तरह से 3.5 मिलीग्राम के प्रकार 1 कोलेजन जेल (3 मिलीग्राम / एमएल) मिश्रण 4 × केंद्रित DMEM के 1.5 मिलीलीटर, और आसुत जल के 1ml।
  5. पीबीएस के 500 μl में सेल गोली Resuspend और सेल गिनती के लिए एक नमूना हटा दें। गिनतीtrypan नीले दाग के साथ एक hemocytometer का उपयोग कोशिकाओं की संख्या सेल व्यवहार्यता की जांच करने के लिए।
  6. जेल मध्यम 3.0 × 10 5 कोशिकाओं के एक सेल घनत्व / अच्छी तरह से (6.0 × 10 5 कोशिकाओं / एमएल) और धीरे को प्राप्त लेकिन जल्दी जमाना बिना pipetting द्वारा यह मिश्रण करने के लिए की मात्रा समायोजित करने के लिए जोड़ें।
  7. जल्दी से और ध्यान से एक 24 अच्छी तरह से गैर इलाज थाली के प्रत्येक कुएं में मिश्रण के 0.5 मिलीलीटर बांटना साफ बेलनाकार फार्म बनाने के लिए। सावधान किसी भी हवाई बुलबुले जैल (चित्रा 1 ए) को दूषित करने की अनुमति के लिए नहीं हो।
    नोट: जेल कोशिकाओं से युक्त मध्यम चिपचिपा है और आसानी से अच्छी तरह से जेल में है और फार्म वर्धमान आकार कर सकते हैं।
  8. 37 डिग्री सेल्सियस पर एक सेल इनक्यूबेटर में 15 मिनट के लिए थाली सेते हैं, 5% सीओ 2 और 95% नमी पूरी तरह से जेल।
  9. एक तरीके से एक निष्फल रंग चलती एक ही दिशा में एक परिधि आकर्षित करने के लिए से तोड़ने के बिना थाली से जैल को अलग करें। एक रंग का प्रयोग, धीरे 60 मिमी टिशू कल्चर व्यंजन को जैल हस्तांतरणके साथ या बिना TGF-β1 (5 एनजी / एमएल) और TNF-α (10 एनजी / एमएल) DMEM / 1% FBS की 5 मिलीग्राम से युक्त।
  10. धीरे सुनिश्चित करने के लिए जैल माध्यम पर चल रहे हैं व्यंजन हिला। 37 डिग्री सेल्सियस, 5% सीओ 2 और 95% आर्द्रता पर एक सेल इनक्यूबेटर में सेते हैं।

जेल का आकार 5. मापन

  1. एक छवि विश्लेषण प्रणाली का उपयोग 0, 24, 48, और 72 घंटे के बाद कोलेजन जेल आकार को मापने।
    1. जेल प्रलेखन प्रणाली (2A चित्रा) पर बारी, और प्रकाश परिरक्षण कैबिनेट में बर्तन डाल दिया। फिर कैबिनेट में बर्तन का ढक्कन बंद कर ले।
    2. संबंधित जेल विश्लेषण सॉफ्टवेयर खोलें। कैबिनेट में जैल की छवि दिखाने के लिए मेनू पट्टी में "छवि अधिग्रहण बटन" पर क्लिक करें। फिर, मेनू पट्टी में "अधिग्रहण" क्लिक जैल (चित्रा 2 बी) की तस्वीरें लेने के लिए।
    3. "का पता लगाने के लिए बटन" मेनू पट्टी (चित्रा -2) में क्लिक करें और माप क्षेत्र समायोजित (पीले सर्कल मैंn चित्रा -2) माउस खींचकर। फिर, "ऑटो का पता लगाने के लिए बटन" मेनू पट्टी में क्लिक करें (चित्रा 2 डी में बटन देखें)। सॉफ्टवेयर स्वचालित रूप से एक हीटमैप (चित्रा 2 डी) दिखा जैल का पता लगाता है।
    4. "ठीक है" छवि प्रसंस्करण द्वारा जैल की रूपरेखा को निकालने के लिए और रूपरेखा (चित्रा 2 ई) से घिरे क्षेत्रों की गणना के लिए क्लिक करें। बाद क्षेत्र में गणना की है, गणना क्षेत्र अलग पॉप-अप विंडो में प्रदर्शित किया जाता है।
      नोट: जैल इमेजिंग के दौरान एक दूसरे को ओवरलैप करते हैं, तो धीरे से एक बाँझ विंदुक टिप का उपयोग जैल ले जाते हैं।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EMT के दौरान उपकला कोशिकाओं उपकला मार्कर, ई cadherin तरह खो देते हैं, और इस तरह के vimentin और α चिकनी पेशी actin 4,5 के रूप में mesenchymal मार्करों, की अभिव्यक्ति हासिल है। TGF-β1 और TNF-α के साथ A549 मानव फेफड़ों उपकला कोशिकाओं के ऊष्मायन EMT लाती है। सामान्य A549 कोशिकाओं की उपस्थिति आकार और त्रिकोण आकार की तरह पक्की सड़क पत्थर उपकला कोशिकाओं (चित्रा 3 ए) की एक विशेषता है कि कर रहे हैं, लेकिन TGF-β1 और TNF-α के साथ प्रेरित करने के बाद, उपस्थिति लंबे धुरी आकार कि mesenchymal के समान है के लिए बदल दिया कोशिकाओं (चित्रा 3 बी)।

उपकला और mesenchymal मार्करों की अभिव्यक्ति पुष्टि करने के लिए कि कोशिकाओं EMT कराना पड़ा मूल्यांकन किया गया था। सापेक्ष mRNA अभिव्यक्ति ΔΔCt विधि के साथ गणना की गई। व्यक्तिगत डेटा glyceraldehyde-3-फॉस्फेट डिहाइड्रोजनेज (GAPDH) है कि एक हाउसकीपिंग जी के खिलाफ सामान्यीकृत थाएकदा। A549 कोशिकाओं TGF-β1 और 48 घंटे के लिए TNF-α के साथ इलाज काफी CDH1 की अभिव्यक्ति की कटौती की थी और काफी शक्ति और ACTA2 (चित्रा -4 ए) की अभिव्यक्ति में वृद्धि हुई। क्यू पीसीआर के लिए इस्तेमाल किया प्राइमरों दृश्यों Table1 में दिखाया जाता है। जैसा कि चित्र 4 बी, TGF-β1 और TNF-α तनु ई cadherin अभिव्यक्ति के साथ उत्तेजना में दिखाया गया है, vimentin, एन cadherin, और α चिकनी पेशी actin की अभिव्यक्ति जबकि प्रेरित किया गया था।

जेल संकुचन परख कोशिकाओं है कि EMT कराना पड़ा की सिकुड़ना मूल्यांकन करने के लिए प्रदर्शन किया था। TGF-β1 और TNF-α के साथ EMT उत्प्रेरण के बाद, कोशिकाओं कोलेजन जेल में डाल दिया जाता है और मीडिया में 72 घंटा TGF-β1 और TNF-α, या पीबीएस युक्त के लिए incubated रहे थे। जैसा कि चित्र में दिखाया गया है 5 ए, TGF-β1 और TNF-α के साथ इलाज किया कोशिकाओं से युक्त जैल नियंत्रण पीबीएस के साथ इलाज किया कोशिकाओं से युक्त जैल से छोटे थे। योग्यता के रूप में करने के लिएजेल आकार में परिवर्तन ntify, जैल एक जेल विश्लेषक 0, 24, 48, और उपचार के बाद 72 घंटा का उपयोग कर विश्लेषण किया गया। 72 घंटे के बाद, TGF-β1 और TNF-α के साथ इलाज किया कोशिकाओं से युक्त जैल का आकार काफी नियंत्रण जैल (चित्रा 5 ब) की तुलना में कम हो गई थी। हम यह भी पुष्टि की है कि TGF-β1 के साथ इलाज किया कोशिकाओं से युक्त जैल अकेले नियंत्रण जैल से छोटे थे लेकिन जैल TGF-β1 और TNF-α के साथ इलाज की तुलना में छोटे नहीं (नहीं दिखाया डेटा) थे।

आकृति 1
चित्रा 1. जैल बनाने के लिए अनुपूरक चित्रा। इन छवियों को जैल कुओं में डाली दिखा। जेल कोशिकाओं से युक्त मध्यम चिपचिपा है और आसानी से और अच्छी तरह से जेल में फार्म वर्धमान आकार कर सकते हैं। (ए) बाईं छवि से पता चलता है कि जैल सही ढंग से casted कर रहे हैं, और सही छवि "स्वच्छ बेलनाकार फार्म" के स्कीमा से पता चलता है। (बी </ Strong>) बाईं छवि से पता चलता है कि जैल ख़राब है, और सही छवि दिखाता है कि हवा के बुलबुले जैल दूषित। (सी) जैल नरम, इतनी आसानी से क्षतिग्रस्त हो रहे हैं और आमतौर पर "पीएसी मैन" की तरह ख़राब। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2. कदम मापने जेल आकार के लिए। (ए) जेल प्रलेखन प्रणाली एक पीसी और एक जेल इमेजिंग प्रणाली के होते हैं। (ख) "छवि अधिग्रहण बटन", और जैल की एक तस्वीर। (सी) "का पता लगाने के लिए बटन", और माप क्षेत्र (पीला वृत्त) को एडजस्ट करने के लिए खिड़की। (डी) "ऑटो का पता लगाने के लिए बटन", और सॉफ्टवेयर डे के लिए एक तस्वीर से जैल का एक हीटमैप बनाता है जैल की रूपरेखा tect। (ई) सॉफ्टवेयर छवि प्रसंस्करण द्वारा जैल की रूपरेखा निकालता है, और रूपरेखा से घिरे क्षेत्रों की गणना करता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3. EMT प्रेरित प्रकोष्ठों के Morphologies। A549 मानव फेफड़े epithelia 1.0 × 10 5 कोशिकाओं के घनत्व / अच्छी तरह से 6 अच्छी तरह से थाली में पर चढ़ाया और के साथ या बिना 5 एनजी / एमएल TGF-β1 और 10 एनजी / एमएल incubated रहे थे 48 घंटे के लिए TNF-α, चरण विपरीत सूक्ष्म इमेजिंग द्वारा पीछा किया। (ए) और (बी) × 200 के तहत प्राप्त चित्र हैं। (A) पैमाने सलाखों और (बी), 100 माइक्रोन। टी = "_blank"> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4. TGF-β1 और TNF-α के साथ EMT उत्तेजना। (ए) EMT मार्कर अभिव्यक्ति (CDH1, शक्ति, और ACTA2) की QRT- पीसीआर विश्लेषण। (बी) के पश्चिमी धब्बा ई cadherin, एन cadherin, vimentin की अभिव्यक्ति दिखा रहा है, और चिकनी मांसपेशियों के साथ या बिना TGF-β1 और TNF-α प्रेरित A549 कोशिकाओं में प्रोटीन actin अल्फा। α ट्यूबिलिन आंतरिक नियंत्रण के रूप में इस्तेमाल किया गया था। A549 कोशिकाओं चित्रा 1 एन = 3 स्वतंत्र प्रयोगों में के रूप में सुसंस्कृत थे। ** पी <0.01; त्रुटि सलाखों प्रतिनिधित्व SEM। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Iles / ftp_upload / 53974 / 53974fig5.jpg "/>
5. प्रकोष्ठों के दौर से गुजर EMT एक्वायर्ड सिकुड़ना चित्रा। A549 कोशिकाओं 10 सेमी बर्तन में 1.0 x 10 6 कोशिकाओं / पकवान के घनत्व पर चढ़ाया और के साथ या बिना 5 एनजी / एमएल TGF-β1 और 10 एनजी / एमएल 48 घंटे के लिए TNF-α incubated रहे थे। कोशिकाओं तो एक 24 अच्छी तरह से थाली में अच्छी तरह / 3.0 × 10 5 कोशिकाओं के घनत्व पर 1.75 मिलीग्राम / एमएल कोलेजन जेल युक्त मध्यम के 500 μl में डाल दिया जाए। जेल गठन के बाद, वे के साथ या बिना 5 एनजी / एमएल TGF-β1 और 10 एनजी / एमएल 60 मिमी बर्तन में TNF-α माध्यम से जोड़ा और 72 घंटा इमेजिंग (ए) के द्वारा पीछा के लिए incubated रहे थे। जेल आकार एक छवि विश्लेषण प्रणाली का उपयोग 0, 24, 48, और 72 घंटे के बाद मापा गया। एन = 9 स्वतंत्र प्रयोगों (बी)। ** पी <0.01; त्रुटि सलाखों प्रतिनिधित्व SEM। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

जीन नाम आगे 5 '→ 3' रिवर्स 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
विम GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

तालिका 1 प्राइमर दृश्यों। प्राइमर QRT- पीसीआर के लिए इस्तेमाल किया दृश्यों। GAPDH आंतरिक नियंत्रण के रूप में इस्तेमाल किया गया था।

Lysis बफर: RIPA बफर
20 मिमी Tris एचसीएल पीएच 7.5
150 मिमी NaCl
1 मिमी EDTA
1% polyoxyethylene (9) octyiphenyl ईथर
0.1% ना deoxycholate
0.1% एसडीएस
बफर अवरुद्ध
धोने बफर में 1% अवरुद्ध अभिकर्मक
धो बफर: TBST बफर
NaCl 45 ग्राम
1 एम Tris 7.4 पीएच 50 मिलीलीटर
Polyoxyethylene (20) Sorbitan monolaurate 2.5 मिलीलीटर
गढ़ने पानी 5 एल के लिए जोड़
5 एल

तालिका 2। बफ़र के घटकों का इस्तेमाल किया सेल के घटकों, अवरुद्ध बफर और धोने बफर।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

प्रोटोकॉल इस अध्ययन में विकसित दो कदम शामिल हैं। पहला कदम है, जबकि दूसरे चरण के लिए जेल संकुचन परख है, EMT प्रेरित करने के लिए किया जाता है। चूंकि यह पुष्टि करने के लिए कि कोशिकाओं EMT कराना पड़ा महत्वपूर्ण है, चरण 2 रूपात्मक और जीन अभिव्यक्ति में परिवर्तन करने के लिए एक उत्कृष्ट पूरक प्रदान करता है। पिछले अध्ययनों से पता चला है कि A549 कोशिकाओं की EMT TGF-β1 केवल 24 द्वारा प्रेरित किया गया था; लेकिन, जैसा कि हम पहले 10 सूचित किया है, TNF-α इलाज EMT और mesenchymal सेल मार्कर के अधिग्रहण को बढ़ाता है। यह सोचा है कि TGF-β की मध्यस्थता EMT के तंत्र SMAD पर निर्भर 25 है। TNFα TGF-β1 प्रेरित EMT कि जेल संकुचन की वृद्धि की ओर जाता है बढ़ाता है। यह बताया गया है कि TGF-β1 प्रेरित EMT को बढ़ाने के लिए TNFα के तंत्र smad2 लिंकर क्षेत्र के केवल फोस्फोराइलेशन नहीं कर रहे हैं, लेकिन यह भी विनियमन 26 संकेत MAPK। इसलिए, प्रोटोकॉल इस अध्ययन में विकसित stimul शामिलदोनों TGF-β1 और TNF-α से समझना।

कोशिकाओं है कि प्रकार मैं जेल कोलेजन में EMT कराना पड़ा, और मध्यम पर तैर के embedding, इस परख (चरण 4) के केंद्रीय पहलू हैं। क्योंकि जैल मुलायम और आसानी से क्षतिग्रस्त नहीं हैं, और प्रत्येक पक्ष पर अलग अलग आयाम है, अत्यधिक सावधानी जब मध्यम करने के लिए जैल लागू करने और उनके आकार को मापने के लिए आवश्यक है। यदि यह इस कदम के लिए बाहर ले जाने के लिए मुश्किल है, वहाँ 60 मिमी पकवान 27,28 में जैल चलते बिना कुएं में जेल आकार को मापने के लिए एक वैकल्पिक तरीका है। वहाँ कई आम समस्या है, पहली समस्या यह है कि कोलेजन जैल आसानी से आरटी पर gelate इसलिए जैल अक्सर ख़राब रूप में कदम 4.7 में उल्लेख किया है। इसलिए, प्लेट धीरे कुओं में जैल कास्टिंग यकीन है कि वे एक स्वच्छ बेलनाकार फार्म पर ले करने के बाद हिल जाना चाहिए। दूसरी समस्या यह है कि अगर किसी भी हवाई बुलबुले जमाना दौरान जैल दर्ज करें, तो जैल का आकार असमान हो जाएगा। किसी भी हवाई bubbl अनुमति देने के लिए सावधान नहीं किया जातों जैल दूषित करने के लिए। वहाँ मूल विधि और इस विधि के बीच दो मुख्य मतभेद हैं। पहले मतभेद है कि मूल विधि के कोलेजन जैल के अंतिम एकाग्रता 0.75 मिलीग्राम / एमएल है लेकिन इस विधि की कि 1.75 मिलीग्राम / आदेश जैल अधिक से अधिक वे मूल विधि के साथ क्या अनुबंध करने के लिए अनुमति देने के लिए मिलीलीटर है। दूसरी मतभेद है कि मूल विधि जेल चल माध्यम के लिए सीरम मुक्त माध्यम का उपयोग करता है, लेकिन इस विधि क्रम में सेल व्यवहार्यता रखने के लिए और सेल सिकुड़ना बनाए रखने के लिए जेल चल माध्यम में 1% FBS उपयोग करता है।

जेल संकुचन परख मूल fibroblasts के लिए विकसित कोशिकाओं है कि घाव भरने और फाइब्रोसिस 13 की प्रक्रिया में योगदान के सिकुड़ना के मूल्यांकन के लिए इन विट्रो मॉडल में एक आदर्श है। fibroblasts की कुर्की 1 कोलेजन टाइप करने के लिए यांत्रिक तनाव है कि इसके परिणामस्वरूप कोलेजन जैल के आकार में कमी की ओर जाता है का निर्माण करने के लिए माना जाता है। साथ ही, इस परख हाल ही में इस्तेमाल किया गया हैदमा और सीओपीडी 29-31 सहित भड़काऊ रोगों, में airway कोशिकाओं का संकुचन के अध्ययन के लिए इन विट्रो मॉडल के रूप में।

जेल संकुचन परख, इस तरह के सेल प्रवास assays के रूप में अन्य assays, के लिए तुलनीय है कि यह विशेष उपकरणों की आवश्यकता नहीं है और उच्च मात्रात्मक reproducibility दर्शाती है। हालांकि, वहाँ EMT 32 के मूल्यांकन के लिए जेल संकुचन परख लागू करने से कुछ खबरें हैं। इस अध्ययन में, कोशिकाओं है कि EMT कराना पड़ा युक्त जैल में काफी आकार में 24 से 72 घंटा के लिए जमाना के बाद कम, सेल संकुचन का संकेत है। हालांकि इस विधि के लिए सीमाएं हैं। पहला यह है कि इस परख में, जैल का आकार बदलने के जैल में सभी कक्षों का सिकुड़ना का योग दिखाने के लिए है। हालांकि, यह इस परख का उपयोग जैल में एकल कक्ष सिकुड़ना मूल्यांकन करने के लिए मुश्किल है। दूसरा यह है कि A549 कोशिकाओं को एक कैंसर कोशिका लाइन, नहीं सामान्य मानव उपकला कोशिकाओं है। इसलिए, यह अनुमान लगाना कठिन है ओसीधे फेफड़े फाइब्रोसिस के रोगजनन को उर का परिणाम है। हालांकि, A549 कोशिकाओं को व्यापक रूप से एयरवे उपकला कोशिकाओं के कार्यों का अध्ययन करने के लिए इस्तेमाल कर रहे हैं, और कई अध्ययनों से फेफड़े फाइब्रोसिस 33,34 की एक मॉडल के रूप में A549 कोशिकाओं का उपयोग करके EMT के सबूत मिले हैं।

सारांश में, मैं mesenchymal कोशिकाओं है कि कराना पड़ा EMT आकार में कम हो गई थी, उन कोशिकाओं का संकुचन का संकेत युक्त जैल कोलेजन। इस प्रकार, जेल संकुचन परख EMT प्रक्रिया के माध्यम से कोशिकाओं में सिकुड़ा समारोह के अधिग्रहण का मूल्यांकन करने के लिए एक विस्तारित इन विट्रो परख के रूप में माना जाना चाहिए।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास कोई भी हितों के टकराव खुलासा करने के लिए नहीं थे।

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
एक का विकास<em&gt; इन विट्रो</em&gt; परख mesenchymal कोशिकाओं कि कराना पड़ा उपकला-mesenchymal संक्रमण की सिकुड़ा समारोह का मूल्यांकन करने के लिए
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter