Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Sviluppo di un doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La fibrosi è coinvolto nella patogenesi di diverse malattie croniche progressive, come la malattia polmonare interstiziale, fibrosi cardiaca, cirrosi epatica, insufficienza renale terminale, sclerosi sistemica, e malattie autoimmuni 1. Tra le malattie polmonari interstiziali, la fibrosi polmonare idiopatica (IPF) è una malattia cronica progressiva e mostra prognosi infausta. caratteristica patologica della IPF è lo sviluppo di focolai fibroblastici costituito da fibroblasti attivati ​​e miofibroblasti che sono associati con la prognosi. Le origini di tali fibroblasti polmonari sono proposti per essere derivato da varie cellule mesenchimali, tra cui fibroblasti polmonari residenti in origine e fibrociti circolanti dal midollo osseo. Recentemente, transizione epitelio-mesenchimale (EMT) è stata proposta per essere associato con la formazione di cellule mesenchimali 2, e contribuire alla patogenesi di malattie fibrotiche.

Si pensa che EMT svolge un ruolo importante nel processo di sviluppo fetale, la guarigione della ferita, e la progressione del cancro, tra cui l'invasione tumorale e metastasi 3. A seguito del processo di EMT, cellule epiteliali ottenere la capacità delle cellule mesenchimali da perdita di marcatori epiteliali, come la E-caderina, e l'espressione di marcatori mesenchimali, quali vimentina, e α-actina del muscolo liscio (SMA) 4,5. Studi precedenti hanno mostrato l'evidenza che processo EMT è stato associato con lo sviluppo della fibrosi tissutale nel rene e del polmone 6 7. Inoltre, l'infiammazione cronica promuove fibrotica malattia 8; Inoltre, tali citochine infiammatorie come il fattore di necrosi tumorale membro superfamiglia 14 (TNFSF14, la luce), il fattore di necrosi tumorale (TNF) -α, e l'interleuchina-1β, hanno dimostrato di migliorare EMT 9-12.

assay contrazione di gel di collagene, un saggio contrazione delle cellule a base di collagene, in cui fibroblasti sono incorporati nel tipo Icollagene gel tridimensionale, è un ideale modello in vitro per la valutazione della contrattilità. Contrattilità è una delle funzioni caratteristiche di fibroblasti e contribuisce al normale ferita riparazione e fibrosi 13. In questo saggio, si ritiene che l'attaccamento di fibroblasti di collagene di tipo I mediante meccanismi di integrine e dovrebbe produrre tensione meccanica in alcune condizioni, e di conseguenza portare alla contrazione del tessuto.

Qui, lo sviluppo del test gel contrazione è segnalato per essere adattato per valutare l'acquisizione della funzione contrattile nelle cellule che sottoposti EMT. Questo rapporto dimostra che questo saggio modificato è adatto per valutare la contrattilità delle cellule mesenchimali che hanno subito EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparazioni e coltura di cellule epiteliali del polmone

  1. cellule epiteliali del polmone umano A549 Cultura (linea cellulare aderente) a Dulbecco Modified Eagle Medium (DMEM) supplementato con siero fetale bovino al 10% (FBS), 100 UI / ml di penicillina, e 100 mg / ml di streptomicina.
  2. Rimuovere e scartare il terreno di coltura di cellule dal piatto di cultura, e lavare una volta con 5 - 10 ml di tampone fosfato salino (PBS). Dopo il lavaggio, aspirare immediatamente la PBS.
  3. Aggiungere 2 ml Tripsina / acido etilendiamminotetraacetico (EDTA) (0,05%) e incubare a 37 ° C e 5% CO 2 per 3 min.
  4. Raccogliere le cellule staccate in provette da centrifuga contenenti terreno di coltura cellulare, centrifugare le provette a temperatura ambiente per 4 min a 150 × g.
  5. Risospendere le cellule pellet in 2 ml di mezzo di coltura cellulare e rimuovere un campione per il conteggio delle cellule. Contare il numero di cellule utilizzando un emocitometro con Trypan blu macchia di verificare la vitalità delle cellule.
  6. cellule Seed A549 su10 piatti cm polistirolo con una densità di 0,5 - 1,0 × 10 6 cellule / piatto con 10 ml di terreno per test gel contrazione. Seme le celle 6 pozzetti di polistirene ad una densità di 0,5 - 1,0 × 10 5 cellule / pozzetto con 2 ml di mezzo per la conferma EMT. Incubare le cellule a 37 ° C e 5% CO 2 per 24 ore.

2. Procedura EMT

  1. Aggiungere 10 ml di TGF-β1 (5 mg / ml) e 10 ml di TNF-α (10 ug / ml) alla piastra per test gel contrazione seminate in fase 1.6. Aggiungere 2 ml di TGF-β1 (5 mg / ml) e 2 ml di TNF-α (10 ug / ml) alla piastra di conferma EMT seminate in fase 1.6. Incubare a 37 ° C e 5% CO 2 per 48 ore.

3. Conferma di procedura EMT mediante PCR e Western Blotting

  1. Confermare il cambiamento nella morfologia (da ciottoli simile al mandrino forma) di cellule trattate usando la microscopia a contrasto di fase.
    Nota: Normcellule di Al A549 hanno cobble aspetto lapideo e di forma triangolare che è una caratteristica delle cellule epiteliali, ma dopo stimolazione con TGF-β1 e TNF-α, le cellule appaiono lungo e mandrino forma che è simile alle cellule mesenchimali 14,15.
  2. Valutare l'espressione di un marcatore epiteliale, come ad esempio E-caderina, e marcatori mesenchimali quali la N-caderina, vimentina, e α-actina del muscolo liscio utilizzando PCR o Western blotting.
    1. Estratto RNA totale dalle cellule utilizzando kit di estrazione di RNA 16 e sintetizzare cDNA utilizzando trascrittasi inversa 17 secondo il protocollo del produttore.
    2. Misurare l'espressione dei livelli di mRNA utilizzando in tempo reale del sistema PCR 18 e colorante cianinico monomerico kit per la PCR in base alle istruzioni del fabbricante. I primers specifici per GAPDH (gliceraldeide 3-fosfato deidrogenasi), ACTA2 (alpha-actina-2), CDH1 (caderina-1; E-caderina), e VIM (vimentina) sono mostrati in Tabella 1
    3. Lisare le cellule utilizzando un tampone di lisi (Tabella 2) soluzione contenente 1% di cocktail di inibitori delle proteasi. Misurare tutte le concentrazioni di proteine ​​del campione utilizzando un kit di analisi delle proteine ​​19,20, e applicare le stesse quantità di proteine ​​ad un gel di poliacrilammide.
      1. Eseguire SDS gel elettroforesi e trasferimento semi-dry delle proteine ​​di membrana PVDF 21. Incubare la membrana con anticorpi primari in tampone di bloccaggio per 1 - 2 ore. Dopo l'incubazione, lavare due volte la membrana con tampone di lavaggio e incubare la membrana hr 1 secondo anticorpi.
        Nota: vedere la tabella Materiali / Attrezzature per gli anticorpi e le diluizioni utilizzati in questi studi. Vedere la Tabella 2 per i componenti del tampone di bloccaggio.
      2. Lavare la membrana con tampone di lavaggio due volte. Scattare foto della membrana con il kit di rilevamento occidentale blotting 22 con una camera CCD 11,23 freddo.

4. Gel Contrazione Assay per EMT valutazione

  1. Aspirare il supporto condizionata dalla nave coltura cellulare, e lavare bene con 5 - 10 ml di PBS per rimuovere le cellule morte. Dopo il lavaggio, aspirare immediatamente la PBS.
  2. Aggiungere 2 ml di 0,05% tripsina / EDTA e incubare a 37 ° C e 5% CO 2 per 3 min.
  3. Raccogliere le cellule staccate in provette da centrifuga contenenti DMEM integrato con inibitore della tripsina (1 mg / ml), centrifugare le provette a temperatura ambiente per 4 minuti a 150 × g.
  4. Mescolare tipo gel 1 collagene con acqua distillata, e 4 × DMEM concentrati per regolare i volumi per ottenere una concentrazione di collagene di 1,75 mg / ml e 1 x concentrazione DMEM. Essere sicuri di mantenere il supporto gel sul ghiaccio durante questa fase.
    Nota: Per fare 6 ml di mezzo di gel, mescolare bene 3,5 ml di tipo 1 collagene gel (3 mg / ml), 1,5 ml di 4 × DMEM concentrato e 1 ml di acqua distillata.
  5. Risospendere il pellet di cellule in 500 microlitri di PBS e rimuovere un campione per il conteggio delle cellule. Contareil numero delle cellule utilizzando un emocitometro con trypan blue macchia per verificare la vitalità cellulare.
  6. Aggiungere il mezzo gel per regolare i volumi di raggiungere una densità cellulare di 3,0 x 10 5 cellule / pozzetto (6,0 × 10 5 cellule / ml) e delicatamente ma rapidamente mescolare pipettando senza gelificazione.
  7. Versare 0,5 ml della miscela in ciascun pozzetto di una piastra non trattata 24 pozzetti rapidamente e con attenzione per rendere forma cilindrica ordinata. Fare attenzione a non consentire eventuali bolle d'aria per contaminare i gel (Figura 1A).
    Nota: Il mezzo gel contenente le cellule è viscoso e può facilmente gel e la forma forma di mezzaluna nel pozzo.
  8. Incubare la piastra per 15 minuti in un incubatore cellule a 37 ° C, 5% di CO 2 e il 95% di umidità al gel completamente.
  9. Staccare gel dalla piastra senza rompere spostando una spatola sterilizzato in modo per disegnare una circonferenza in una direzione. Utilizzando una spatola, trasferire delicatamente i gel a 60 mm piatti di coltura dei tessuticontenente 5 ml di DMEM / FBS 1% con o senza TGF-β1 (5 ng / ml) e TNF-α (10 ng / ml).
  10. Agitare delicatamente i piatti per garantire gel stanno galleggiando sul supporto. Incubare in un incubatore cellule a 37 ° C, 5% di CO 2 e il 95% di umidità.

5. Misura di Gel Size

  1. Misurare le dimensioni gel di collagene dopo 0, 24, 48, e 72 ore utilizzando un sistema di analisi dell'immagine.
    1. Accendere il sistema di documentazione gel (Figura 2A), e mettere i piatti nel mobile luce di schermatura. Poi togliere il coperchio di piatti nel mobile.
    2. Aprire il relativo software di analisi di gel. Fare clic sul pulsante "acquisizione delle immagini" nella barra dei menu per visualizzare l'immagine del gel nel cabinet. Quindi, fai clic su "acquisire" nella barra dei menu per scattare foto dei gel (Figura 2b).
    3. Fare clic sul pulsante "rilevamento" nella barra dei menu (Figura 2C) e regolare la regione di misura (cerchio giallo in Figura 2C) trascinando il mouse. Quindi, fare clic sul pulsante "auto-detect" nella barra dei menu (vedi pulsante nella Figura 2D). Il software rileva automaticamente i gel che mostra una mappa termica (Figura 2D).
    4. Fai clic su "OK" per estrarre il contorno dei gel di elaborazione delle immagini e per calcolare le aree circondate da contorno (Figura 2E). Dopo che l'area viene calcolata, l'area calcolata viene visualizzata nella finestra pop-up separata.
      Nota: se il gel si sovrappongono l'un l'altro durante l'imaging, spostare i gel delicatamente con un puntale sterile.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Durante EMT, le cellule epiteliali perdono marcatori epiteliali, come E-caderina, e di ottenere l'espressione di marcatori mesenchimali, quali vimentina e α-actina muscolo liscio 4,5. L'incubazione delle cellule epiteliali umane A549 polmone con TGF-β1 e TNF-α induce EMT. L'aspetto delle normali cellule A549 sono pietra ciottolo come forma e la forma triangolare che è una caratteristica delle cellule epiteliali (Figura 3A), ma dopo stimolate con TGF-β1 e TNF-α, l'aspetto cambiato in forma lungo fuso che è simile a mesenchimali cellule (Figura 3B).

L'espressione di marcatori epiteliali e mesenchimali è stata valutata per confermare che le cellule sono stati sottoposti a EMT. espressione di mRNA relativa è stata calcolata con il metodo ΔΔCt. dati individuali è stata normalizzata contro deidrogenasi gliceraldeide-3-fosfato (GAPDH), che è un servizio di pulizia gene. Cellule A549 trattate con TGF-β1 e TNF-α per 48 ore erano significativamente ridotta espressione di CDH1 e significativamente aumentata espressione di VIM e ACTA2 (Figura 4A). Le sequenze primers utilizzati per q-PCR sono mostrati in Tabella 1. Come mostrato in Figura 4B, la stimolazione con TGF-β1 e TNF-α espressione attenuato E-caderina, mentre l'espressione di vimentina, N-caderina, e α-actina del muscolo liscio è stata indotta.

Il test gel contrazione è stato eseguito per valutare la contrattilità di cellule che sottoposti EMT. Dopo indurre EMT con TGF-β1 e TNF-α, le cellule sono state gettati in gel di collagene e incubate per 72 ore in mezzi contenenti TGF-β1 e TNF-α, o PBS. Come mostrato in Figura 5A, i gel contenenti cellule trattate con TGF-β1 e TNF-α erano più piccole di gel di controllo contenenti cellule trattate con PBS. per qUAntify le variazioni di dimensioni gel, gel sono stati analizzati con un analizzatore di gel 0, 24, 48, e 72 ore dopo il trattamento. Dopo 72 ore, le dimensioni dei gel contenenti cellule trattate con TGF-β1 e TNF-α sono stati significativamente ridotti rispetto ai gel di controllo (Figura 5B). Abbiamo anche confermato che i gel contenenti cellule trattate con TGF-β1 solo erano più piccole di gel di controllo, ma non erano più piccoli dei gel trattati con TGF-β1 e TNF-α (dati non riportati).

Figura 1
Figura 1. Figura supplementare per Fare Gel. Queste immagini mostrano i gel espressi nei pozzi. Il mezzo gel contenente le cellule è viscoso e può facilmente gel e la forma forma di mezzaluna nel pozzo. (A) L'immagine a sinistra mostra che i gel sono colate in modo corretto, e l'immagine di destra mostra lo schema di "forma cilindrica pulito". (B </ Strong>) L'immagine a sinistra mostra che il gel deformano, e l'immagine a destra mostra che le bolle d'aria contaminano i gel. (C) I gel sono morbide, in modo da essere facilmente danneggiati e di solito si deformano come "Pac-Man". Clicca qui per vedere una versione più grande di questa figura.

figura 2
Figura 2. I passaggi per misurare il gel formato. (A) Il sistema di documentazione gel è costituito da un PC e un sistema di imaging gel. (B) L'pulsante "Acquisizione di immagini", e una foto del gel. (C) Il "pulsante di rilevamento", e la finestra per regolare la regione di misura (cerchio giallo). Il "pulsante di rilevamento automatico" (D), e il software fa una mappa termica dei gel da un quadro di de teggere il contorno dei gel. (E) Il software estrae il contorno dei gel di elaborazione delle immagini, e calcola le aree circondate da contorno. Clicca qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. morfologie delle cellule EMT-indotta. A549 epiteli polmonari umane sono state piastrate ad una densità di 1,0 x 10 5 cellule / pozzetto in una piastra da 6 pozzetti e incubate con o senza 5 ng / ml di TGF-β1 e 10 ng / ml TNF-α per 48 ore, seguita da contrasto di fase immagini microscopiche. (A) e (B) sono immagini ottenute sotto × 200. Le barre di scala in (A) e (B), 100 micron. t = "_ blank"> Clicca qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4. La stimolazione EMT con TGF-β1 e TNF-α. (A) qRT-PCR di EMT marcatore espressione (CDH1, VIM, e ACTA2). (B) Western blot che mostra l'espressione di E-caderina, N-caderina, vimentina, e alfa actina muscolo liscio proteine ​​nelle cellule A549 stimolate con o senza TGF-β1 e TNF-α. α-tubulina è stato utilizzato come controllo interno. cellule A549 sono state coltivate come in Figura 1. N = 3 esperimenti indipendenti. ** P <0.01; le barre di errore rappresentano SEM. Cliccate qui per vedere una versione più grande di questa figura.

iles / ftp_upload / 53974 / 53974fig5.jpg "/>
Figura 5. cellule in fase di EMT acquisita contrattilità. Cellule A549 sono state piastrate ad una densità di 1,0 x 10 6 cellule / piatto in 10 piatti cm e incubate con o senza 5 ng / ml di TGF-β1 e 10 ng ml TNF-α / per 48 ore. Le cellule sono state poi gettati in 500 ml di terreno contenente 1,75 mg di gel di collagene / ml ad una densità di 3,0 x 10 5 cellule / pozzetto in una piastra da 24 pozzetti. Dopo formazione del gel, sono stati aggiunti al terreno, con o senza 5 ng / ml di TGF-β1 e 10 ng / ml TNF-α in piatti 60 mm e incubate per 72 ore seguita da immagini (A). dimensioni gel sono stati misurati dopo 0, 24, 48, e 72 ore utilizzando un sistema di analisi dell'immagine. N = 9 esperimenti indipendenti (B). ** P <0.01; le barre di errore rappresentano SEM. Cliccate qui per vedere una versione più grande di questa figura.

gene Nome Avanti 5 '→ 3' Reverse 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
VIM GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tabella 1. Primer sequenze. Sequenze dei primer utilizzati per qRT-PCR. GAPDH è stato utilizzato come controllo interno.

Lysis Buffer: RIPA buffer
20 mM Tris-HCl pH 7.5
150 mM NaCl
1 mM EDTA
1% poliossietilene (9) etere octyiphenyl
0,1% Na-desossicolato
0,1% SDS
tampone di bloccaggio
1% di blocco reagente tampone di lavaggio
Tampone di lavaggio: tampone TBST
NaCl 45 g
1 M Tris pH 7,4 50 ml
Poliossietilene (20) sorbitano 2,5 ml
distillare l'acqua aggiungi ai 5 L
5 L

Tabella 2. I componenti di buffer utilizzati. I componenti di lisi, tampone bloccante e tampone di lavaggio.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il protocollo sviluppato in questo studio comprende due fasi. Il primo passo è eseguito per indurre EMT, mentre il secondo passo è il dosaggio gel contrazione. Poiché è importante confermare che le cellule sottoposti EMT, passaggio 2 fornisce un eccellente complemento ai cambiamenti di espressione morfologiche e geniche. Studi precedenti hanno mostrato che EMT delle cellule A549 è stata indotta da solo il 24 TGF-β1; tuttavia, come abbiamo riportato in precedenza 10, TNF-α aumenta EMT e l'acquisizione dei marcatori cellulari mesenchimali. Si ritiene che i meccanismi di EMT TGF-β-mediata è smad-dipendente 25. TNF aumenta EMT TGF-β1-indotta che porta alla valorizzazione del gel di contrazione. E 'stato riportato che i meccanismi di TNFa per l'aumento di EMT TGF-β1-indotto non sono solo la fosforilazione della regione linker Smad2, ma anche MAPK segnalazione regolamento 26. Pertanto, il protocollo sviluppato in questo studio comprendeva stimulzione sia da TGF-β1 e TNF-α.

L'incorporamento di cellule che sottoposti a EMT nel collagene di tipo I gel, e che galleggiano sul mezzo, sono aspetti centrali di questo test (fase 4). Dato che i gel sono morbide e facilmente danneggiati, e hanno dimensioni diverse su ogni lato, estrema cautela è necessaria quando si applica il gel al mezzo e misurando le loro dimensioni. Se è difficile eseguire questo passaggio, vi è un metodo alternativo per misurare le dimensioni di gel nel pozzo senza spostare i gel in 60 millimetri piatto 27,28. Ci sono diversi problemi comuni, il primo problema è che il gel di collagene gelate facilmente a RT, quindi i gel deformano spesso come indicato al punto 4.7. Pertanto, la piastra deve essere agitata delicatamente dopo la fusione i gel nei pozzi per assicurarsi che essi assumono una forma cilindrica pulito. Il secondo problema è che se eventuali bolle d'aria entrano gel durante la gelificazione, quindi la dimensione dei gel sarà irregolare. Fare attenzione a non consentire a qualsiasi bubbl ariaes di contaminare i gel. Esistono due principali differenze tra metodo originale e questo metodo. Le prime differenze è che la concentrazione finale di gel di collagene di metodo originale è di 0,75 mg / ml, ma quella di questo metodo è di 1,75 mg / ml per consentire i gel di contrarsi più di loro con il metodo originale. La seconda differenza è che il metodo originale utilizza mezzo privo di siero per gel flottante medio ma questo metodo utilizza 1% FBS in mezzo galleggiante gel per mantenere la vitalità cellulare e mantenere contrattilità cellulare.

Il saggio contrazione gel originariamente sviluppato per fibroblasti è un ideale modello in vitro per la valutazione della contrattilità di cellule che contribuiscono al processo di guarigione della ferita e fibrosi 13. Il fissaggio dei fibroblasti di tipo 1 collagene dovrebbe produrre tensioni meccaniche che porta di conseguenza ad una riduzione delle dimensioni del gel di collagene. Inoltre, questo test è stato recentemente utilizzatocome un modello in vitro per lo studio della contrazione di cellule delle vie aeree in malattie infiammatorie, tra cui l'asma bronchiale e BPCO 29-31.

Il test gel contrazione è paragonabile ad altri test, come saggi di migrazione cellulare, in quanto non richiede dispositivi specifici e presenta un'elevata riproducibilità quantitativa. Tuttavia, ci sono alcuni rapporti che applicano il test contrazione del gel per la valutazione EMT 32. In questo studio, i gel contenenti cellule che hanno subito EMT significativamente diminuita in dimensioni da 24 a 72 ore dopo la gelificazione, indicando contrazione delle cellule. Esistono tuttavia limitazioni a questo metodo. La prima è che in questo saggio, il cambio di formato dei gel mostra la somma di contrattilità di tutte le celle nel gel. Tuttavia, è difficile valutare singola contrattilità cellulare nelle gel utilizzando questo dosaggio. La seconda è che le cellule A549 è una linea cellulare di cancro, non normali cellule epiteliali umane. Pertanto, è difficile estrapolare our risultati direttamente alla patogenesi della fibrosi polmonare. Tuttavia, le cellule A549 sono ampiamente utilizzati per studiare le funzioni delle cellule epiteliali delle vie aeree, e diversi studi hanno prodotto la prova di EMT utilizzando cellule A549 come modello di fibrosi polmonare 33,34.

In sintesi, il collagene di tipo I gel contenenti cellule mesenchimali sottoposto EMT erano ridotte, indicando la contrazione di tali cellule. Così, il dosaggio contrazione gel deve essere considerato come un prolungato in vitro per valutare l'acquisizione della funzione contrattile nelle cellule attraverso processo EMT.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno conflitti di interesse da dichiarare.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Sviluppo di un<em&gt; In Vitro</em&gt; Test per valutare funzione contrattile del mesenchimali Le cellule che sono stati sottoposti a transizione epitelio-mesenchimali
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter