Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

개발 doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

섬유화 간질 성 폐 질환, 심장 섬유증, 간경변, 단말 신부전, 전신성 경화증,자가 면역 질환 각종 만성 진행성 질환의 발병에 관여된다. 간질 성 폐 질환 중 특발성 폐 섬유증 (IPF)은 만성 진행성 질환이며, 불량한 예후를 보여줍니다. IPF의 병리학 적 특징은 예후와 관련된 활성화 된 섬유 아세포 및 근섬유로 이루어진 섬유 아세포 초점의 개발이다. 이러한 폐 섬유 아 세포의 기원은 원래 주민 폐 섬유 아 세포를 포함하고 골수에서 섬유 세포를 순환 여러 중간 엽 세포에서 파생 할 것을 제안한다. 최근 상피 간엽 전이 (EMT)는 간엽 세포 (2)의 형성과 관련이 제안되었으며, 섬유 성 질환의 발병에 기여.

그것은 생각된다 EMT는 종양의 침윤과 전이 3를 포함하여 태아의 발달 과정에서 중요한 역할을, 상처 치유, 암의 진행을한다. EMT의 방법에 따라, 상피 세포는 E-cadherin의 상피 마커의 손실에 의해 중간 엽 세포의 능력을 획득하고, 그러한 멘틴 같은 중배엽 마커, 및 α-평활근 액틴 (SMA) -4,5- 의해 발현. 이전 연구 EMT 처리가 신장 67에서 폐 섬유증 조직의 발달과 관련되었다는 증거를 나타내었다. 또한, 만성 염증은 섬유 성 질환 (8)을 촉진; 또한, 종양 괴사 인자 상과 부재 (14) (TNFSF14; LIGHT)와 같은 염증성 사이토 카인, 종양 괴사 인자 (TNF) -α 및 인터루킨 1β는 EMT 9-12을 향상시키는 것으로 나타났다.

콜라겐 겔 수축 분석법, 섬유 아세포 타입 I에 포함 된 콜라겐 계 세포 수축 분석법콜라겐 겔 삼차원, 수축의 평가를위한 시험 관내 모델에서 이상적이다. 수축성 섬유 아세포의 특성 함수 중 하나이며 정상 상처 복구 및 섬유증 (13)에 기여한다. 이 분석에서, 섬유 아세포의 부착이 어떤 조건 하에서 기계적 장력을 생성하도록되어 I는 인테그린 의존성 메커니즘을 통해 입력 콜라겐, 결과적으로 조직의 수축을 유도하는 것으로 생각된다.

여기서, 겔 수축 분석법의 개발이 EMT을받은 세포의 수축 기능의 획득을 평가하도록 적응 될 것으로보고있다. 이 보고서는이 변형 분석이 EMT을 시행 한 중간 엽 세포의 수축력을 평가하기에 적합 함을 보여줍니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 준비 및 문화 폐 상피 세포의

  1. 둘 베코 변형 이글 중간 (DMEM)에서 배양 A549 인간 폐 상피 세포 (접착 세포 라인) 100 μg의가 / ㎖ 스트렙토 마이신, 10 % 우 태아 혈청 (FBS), 100 IU / ml의 페니실린, 및.
  2. 분리 한 배양 접시에서 세포 배양 배지를 버리고, 5 회 세척 - 포스페이트 완충 식염수 10 ㎖ (PBS). 세척 후 즉시 PBS를 대기음.
  3. 3 분 동안 CO 2 2ml의 트립신 / 에틸렌 디아민 테트라 아세트산 (EDTA) (0.05 %)를 첨가하고, 37 ℃에서 5 % 부화.
  4. 세포 배양액을 원심 분리를 150 × g에서 4 분 동안 RT에서 튜브를 포함하는 원심 분리 튜브에 세포를 수집한다.
  5. 세포를 세포 배양 배지 2 ㎖에 재현 탁하고 세포 펠렛을 계산하기위한 샘플을 제거한다. 세포 생존을 확인 트리 판 블루 염색과 혈구를 이용하여 세포의 수를 계산.
  6. 종자에 A549 세포0.5의 밀도로 10cm 폴리스티렌 플레이트 - 겔 수축 검정 용 배지 10 ㎖, 1.0 × 106 세포 / 접시. 0.5의 밀도로 6 웰 폴리스티렌 플레이트에 세포를 시드 - 1.0 × 105 세포 / 웰으로 EMT 확인 용 배지 2 ㎖. 24 시간 동안 CO 2, 37 ℃에서 세포를 인큐베이션하고, 5 %.

2. EMT 절차

  1. 단계 1.6에서 시드 젤의 수축 분석에 대한 판에 TGF-β1 (5 μg의 / ㎖)의 10 μL와 TNF-α의 10 μL (10 μg의 / ㎖)를 추가합니다. 단계 1.6에서 시드 EMT 확인에 대한 판에 TGF-β1 (5 μg의 / ㎖)의 2 μL 및 TNF-α의 2 μL (10 μg의 / ㎖)를 추가합니다. 48 시간 동안 CO 2를 37 ° C에서 품어 5 %.

PCR 및 웨스턴 블로 팅에 의한 EMT 절차 3. 확인

  1. 위상차 현미경을 사용하여 처리 된 세포의 (모양을 스핀들에 자갈 돌 등으로부터) 형태의 변화를 확인합니다.
    참고 : 규범을알 A549 세포는 상피 세포의 특징 인 자갈 돌 같은 삼각형 모양의 외관을 가지고 있지만, TGF-β1 및 TNF-α로 자극 한 후, 세포를 길게 나타나 스핀들 즉 중간 엽 세포 14,15과 유사한 형상.
  2. 이러한 E-cadherin의 같은 상피 마커의 발현을 평가하고, PCR 또는 웨스턴 블롯 이용한 N-cadherin의, 멘틴 및 α-평활근 액틴과 같은 중간 엽 마커.
    1. RNA 추출 키트 (16)를 사용하여 세포로부터 전체 RNA를 추출하고 제조 업체의 프로토콜에 따라 역전사 효소 (17)를 사용하여 cDNA를 합성.
    2. 실시간 PCR 시스템 (18) 및 제조자의 지시에 따라 모노머 시아닌 염료 PCR 키트를 사용하여 mRNA 수준의 발현을 측정한다. GAPDH에 대한 특이 적 프라이머 (글리 세르 알데히드 -3- 포스페이트 탈수소 효소), ACTA2 (알파 - 액틴 2) CDH1 (헤린-1, E-cadherin의) 및 VIM (멘틴)는 표 1에 나타내었다
    3. 를 Lyse 용균 완충액 (표 2) 1 % 프로테아제 억제제 칵테일을 함유하는 용액을 사용하여 세포. 단백질 분석 키트 (19, 20)를 사용하여 모든 샘플의 단백질 농도를 측정하고, 폴리 아크릴 아미드 겔에 단백질의 동일한 양이 적용된다.
      1. SDS 겔 전기 영동하고 PVDF 막 (21)에 단백질의 반 건조 전송을 수행합니다. 2 시간 - 1 버퍼를 차단에서 일차 항체와 멤브레인을 품어. 배양 후, 세척 버퍼로 두 번 멤브레인을 씻고 두 번째 항체 막 1 시간을 품어.
        참고 :이 연구에 사용 된 항체 희석을위한 재료 / 장비의 표를 참조하십시오. 버퍼를 차단의 구성 요소에 대한 표 2를 참조하십시오.
      2. 두 번 세척 버퍼 막 씻으십시오. 감기 CCD 카메라 11,23를 사용하여 웨스턴 블로 팅 검출 키트 (22) 멤브레인의 사진을 촬영합니다.

4. 평가 EMT 젤 수축 분석

  1. 세포 배양 용기로부터의 조정 배지를 흡인하고, 5 잘 세척 - 죽은 세포를 제거하기 위해 PBS 10 ㎖. 세척 후 즉시 PBS를 대기음.
  2. 3 분 동안 CO 2를 0.05 % 트립신 / EDTA 2 ㎖를 추가하고 37 ° C에서 품어 5 %.
  3. DMEM 150 × g에서 4 분 동안 RT에서 트립신 억제제 (1 ㎎ / ㎖), 원심 튜브를 보충 함유하는 원심 분리 튜브에 세포를 수집한다.
  4. 증류수로 1 형 콜라겐 겔을 혼합 한 DMEM을 농축하여 4 × 1.75 ㎎ / ㎖의 콜라겐 농도를 달성하기 위해 볼륨을 조절하고, 1 × DMEM 농도. 이 단계 동안 얼음에 젤 매체를 유지해야합니다.
    주 : 겔 배지 6 ㎖의하려면, 잘 3.5 mL의 1 형 콜라겐 겔 (3 ㎎ / ㎖) 1.5 × 4 농축 DMEM ml의 증류수 1ml를 혼합.
  5. PBS 500 μL에있는 세포 펠렛을 resuspend 세포 계수에 대한 샘플을 제거합니다. 카운트트리 판 블루 염색하여 혈구를 이용하여 세포의 수는 세포 생존을 확인한다.
  6. 부드럽게 세포 3.0 × 105 세포 / 웰의 밀도 (6.0 × 105 세포 / ㎖)을 달성하지만, 신속하게 겔화없이 피펫 팅하여 혼합 볼륨을 조정 겔 배지를 추가한다.
  7. 스트레이트 원통 형상을 신속하고 신중 24- 웰 미처리 플레이트의 각 웰에 0.5 ml의 혼합물을 분배. 기포가 젤 (그림 1A)를 오염 할 수 있도록하지 않도록주의하십시오.
    세포를 포함하는 겔 매체는 점성 쉽게 잘에서 젤 및 양식 초승달 모양 할 수 있습니다.
  8. 37 ℃ 세포 배양기에서 15 분 동안 플레이트를 인큐베이션, 5 % CO 2, 95 % 습도 완전히 겔.
  9. 한 방향으로 원주를 그리는 방법으로 멸균 주걱을 움직여서 깨지 않고 접시에서 겔을 분리. 주걱을 사용하여 부드럽게 60mm 조직 배양 접시에 겔을 전송할또는 TGF-β1 (5 NG / mL) 및 TNF-α (10 ng의 / ㎖)이없는 DMEM / 1 % FBS 함유하는 5 ㎖.
  10. 부드럽게 젤이 매체에 떠 보장하기 위해 요리를 흔들어. 37 ° C, 5 % CO 2 및 95 % 습도에서 세포 배양기에서 인큐베이션.

젤 크기의 5. 측정

  1. 영상 분석 시스템을 사용하여 0, 24, 48, 72 시간 후, 콜라겐 겔 크기를 측정한다.
    1. 겔 문서 시스템 (그림 2A)를 켜고 빛을 차단 캐비닛에 요리를 시작했습니다. 그런 다음 캐비닛의 요리의 뚜껑을 벗어.
    2. 관련 겔 분석 소프트웨어를 엽니 다. 캐비닛의 젤의 이미지를 표시하려면 메뉴 바에서 "이미지 수집 버튼"을 클릭합니다. 그 후, 젤 (그림 2B)의 사진을 찍을 메뉴 바에서 "획득"을 클릭합니다.
    3. 측정 영역을 메뉴 표시 줄 (그림 2C)에서 "검색 버튼"을 클릭하고 조정 (노란색 원 전마우스를 드래그하여 n 개의 그림 2C). 그런 다음, 메뉴 바의 "자동 검색 버튼"을 클릭합니다 (그림 2D에서 버튼을 참조). 이 소프트웨어는 자동으로 히트 맵 (그림 2D)를 보여주는 젤을 감지합니다.
    4. 화상 처리에 의한 젤의 윤곽을 추출하고 개요 (그림 2E)에 의해 둘러싸인 영역을 계산하기 위해 "OK"를 클릭합니다. 면적을 산출 한 후, 산출 된 영역이 별도의 팝업 창에 표시된다.
      참고 : 젤 이미징 동안 서로 겹치는 경우, 부드럽게 멸균 피펫 팁을 사용하여 젤을 이동합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EMT 동안, 상피 세포는 E-cadherin의 같은 상피 마커를 잃게 및 멘틴 및 α-평활근은 4,5를하는 걸 같은 중간 엽 마커의 발현을 얻을 수 있습니다. TGF-β1 및 TNF-α와 A549 인간의 폐 상피 세포의 배양은 EMT를 유도한다. 정상 A549 세포의 모양은 상피 세포 (도 3a)의 특성 인 형상 및 삼각형 등 자갈 돌로 있지만, TGF-β1 및 TNF-α로 자극 한 후, 외관 간엽 비슷 긴 스핀들 형상으로 변경 세포 (그림 3B).

상피와 중간 엽 마커의 발현은 세포 EMT을받은 것을 확인 평가 하였다. 상대 mRNA 발현은 ΔΔCt 방법으로 계산 하였다. 개별 데이터가 가사 g 인 글리 세르 알데히드 -3- 포스페이트 데히드로게나 (GAPDH)에 대한 규격화 된엔. TGF-β1 및 48 시간에 대한 TNF-α로 처리 A549 세포는 상당히 CDH1의 발현을 감소 크게 VIMACTA2 (도 4a)의 발현이 증가 하였다. Q-PCR에 사용 된 프라이머 서열은 표 1에 나타낸다. 멘틴, N-cadherin의, 및 α-smooth muscle actin의 발현 반면,도 4b, TGF-β1 및 TNF-α 감쇠 E-cadherin의 발현과 자극에 나타낸 바와 같이 유도 하였다.

겔 수축 분석법 EMT을받은 세포의 수축력을 평가하기 위해 수행 하였다. TGF-β1 및 TNF-α와 EMT를 유도 한 후, 세포는 콜라겐 겔에 캐스팅하고, TGF-β1 및 TNF-α 또는 PBS를 함유하는 배지에서 72 시간 동안 배양 하였다. 도 5a에 도시 된 바와 같이, TGF-β1 및 TNF-α로 처리 된 세포를 함유하는 겔은 PBS로 처리 된 세포를 포함하는 제어 겔보다 작았 다. QUA하려면겔 크기 변경 ntify 겔은 겔 분석기 0, 24, 48, 치료 후 72 시간을 이용하여 분석 하였다. 72 시간 후, TGF-β1 및 TNF-α로 처리 된 세포를 함유하는 겔의 크기는 크게 제어 겔 (도 5b)에 비해 감소 하였다. 또한 TGF-β1으로 처리 된 세포를 함유하는 겔의 단독 제어 겔보다 작았지만 (데이터 미도시) TGF-β1 및 TNF-α로 처리 된 겔 이상인 것이 확인.

그림 1
그림 1. 젤을 만들기위한 보충 그림. 이러한 이미지는 우물에 던져 젤을 보여줍니다. 세포를 포함하는 겔 매체는 점성 쉽게 젤과 잘 양식 초승달 모양 할 수 있습니다. (A) 좌측 이미지 겔 올바르게 캐스트 것을 나타내고, 우측 이미지 "스트레이트 원통 형태"의 스키마를 도시한다. (B </ 강해>)에서 왼쪽 그림은 겔이 변형 것을 나타내고, 우측 이미지는 기포가 겔을 오염 보여준다. (C) 젤, 그래서 쉽게 손상 부드럽고 보통 "팩맨"와 같은 변형. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
젤 크기 측정을위한 그림 2. 단계. (A) 겔 문서 시스템은 PC와 젤 이미징 시스템으로 구성되어 있습니다. (B) "영상 취득 버튼"및 겔의 사진. (C) "검색 버튼"을 측정 영역 (노란색 원)를 조정하는 창입니다. (라) "자동 감지 버튼"소프트웨어는 해제하는 사진에서 젤의 히트 맵을 만든다 겔의 개요 (보호). (E)은이 소프트웨어는 이미지 처리에 의한 젤의 윤곽을 추출하고, 윤곽으로 둘러싸인 영역을 계산한다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3. EMT 유도 된 세포의 형태학. A549 인간의 폐 상피 세포는 / 잘 6 웰 플레이트에 1.0 × 10 5 세포의 밀도로 도금 또는 5 NG / ㎖ TGF-β1 10 NG / ㎖없이 배양 위상차 현미경 촬상 다음 48 시간 동안 TNF-α. (A)(B)는 200 × 하에서 얻어진 화상이다. 스케일 (A)의(B) 100 μm의. t = "_ 빈">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
그림 4. TGF-β1 및 TNF-α와 EMT 자극. (A) EMT 마커의 발현 (CDH1, VIM 및 ACTA2)의 QRT-PCR 분석. (B) E-cadherin의, N-cadherin의, 비 멘틴의 발현을 웨스턴 블롯을 도시하고, 또는 TGF-β1 및 TNF-α 자극없이 A549 세포에서 단백질 악틴 평활근 α. α-tubulin의 내부 대조군으로서 사용 하였다. A549 세포는도 1 N = 3 독립적 인 실험에서와 같이 배양 하였다. ** P <0.01; 오차 막대는 SEM을 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

세틸 / ftp_upload / 53974 / 53974fig5.jpg "/>
5. 셀을받은 EMT 획득 수축성 그림. A549 세포를 10cm 접시에서 1.0 × 106 세포 / 접시의 밀도로 도금 또는 5 NG / ㎖ TGF-β1, 48 시간 동안 10 NG / ml의 TNF-α없이 배양 하였다. 세포를 24 웰 플레이트 / 웰 3.0 × 105 세포의 밀도 1.75 ㎎ / ㎖의 콜라겐 겔을 함유하는 배지 500 μL으로 주조 하였다. 젤 형성 후, 그들은 함께 5 NG / ㎖ TGF-β1 및 60mm 접시에서 10 NG / ml의 TNF-α없이 배지에 첨가하고, 영상 (A) 한 다음 72 시간 동안 배양 하였다. 겔 크기는 이미지 분석 시스템을 사용하여 0, 24, 48, 72 시간 후에 측정 하였다. N = 9 독립적 인 실험 (B). ** P <0.01; 오차 막대는 SEM을 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

유전자 이름 앞으로 5 '→ 3' 5 '→ 3'역
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
정력 GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

표 1. 프라이머 시퀀스. QRT-PCR에 사용되는 프라이머 시퀀스. GAPDH를 내부 컨트롤로서 사용 하였다.

용해 버퍼 : RIPA 버퍼
20 mM 트리스 - 염산 pH를 7.5
150 mM의 NaCl을
1 mM의 EDTA
1 % 폴리 옥시 에틸렌 (9) octyiphenyl 에테르
0.1 % 나 - 데 옥시 콜레이트
0.1 % SDS
버퍼 차단
세척 완충액 중 1 % 차단 시약
세척 버퍼 : TBST 버퍼
염화나트륨 45g
1 M 트리스 산도 7.4 50 ㎖
폴리 옥시 에틸렌 (20) 소르 비탄 모노 라우 레이트 2.5 ml의
증류 물 5 L에 추가
5 L

표 2. 사용 된 버퍼의 구성 요소. 용해의 구성 요소, 차단 버퍼와 세척 버퍼입니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

본 연구에서 개발 된이 프로토콜은 두 단계를 포함한다. 첫 번째 단계에서는 두 번째 단계는 겔 수축 분석법 동안, EMT를 유도하기 위해 실행된다. 이 세포는 EMT을받은 것을 확인하는 것이 중요하기 때문에, 2 단계는 형태 학적 및 유전자 발현의 변화에​​ 훌륭한 보완을 제공합니다. 이전 연구 A549 세포 EMT는 TGF-β1을 24 만에 의한 것으로 나타났다; 우리는 이전에 10보고 그러나, TNF-α 치료는 EMT 및 중간 엽 세포 마커의 인수 향상시킵니다. TGF-β 매개 EMT의 메커니즘 SMAD 의존 (25)이라고 생각된다. TNFα는 젤의 수축의 증대로 연결 TGF-β1에 의한 EMT을 향상시킵니다. 이는 TGF-β1 유도 EMT의 향상을위한 TNFα의 메커니즘 된 Smad2 링커 영역의 인산화가없는 것으로 알려져있다, 또한 규제 26 시그널링 MAPK. 따라서 본 연구에서 개발 된 프로토콜은 STIMUL 포함TGF-β1 및 TNF-α 모두에 의해 ATION.

내가 젤 콜라겐 유형에 EMT 시행하고, 중간에 떠있는 세포의 삽입이 분석 (4 단계)의 중앙 부분입니다. 젤은 부드럽고 쉽게 손상되고 각면에 서로 다른 크기를 가지고 있기 때문에 중간에 젤을 적용하고 그 크기를 측정 할 때, 특히주의가 필요합니다. 이는이 단계를 수행하기 어려운 경우, 60mm 접시 27,28으로 겔을 이동시키지 않고 잘 겔 크기를 측정하는 다른 방법이있다. 일반적인 여러 문제가 첫 번째 문제는 단계 4.7에 언급 된 겔은 종종 변형되도록 콜라겐 겔 쉽게 RT에서 겔화 점이다. 따라서, 판 부드럽게 그들이 깔끔한 원통형 형태에 걸릴 확인하기 위해 우물에 젤을 캐스팅 한 후 흔들어해야합니다. 두 번째 문제는 기포가 겔화 중에 겔을 입력 할 경우, 겔의 크기가 불균일 한 것 때문이다. 어떤 공기 bubbl을 허용하는주의 말라ES는 젤을 오염합니다. 원래 방법 및이 방법 사이의 두 가지 차이가​​ 있습니다. 기존 방법의 콜라겐 겔의 최종 농도는 mL의 0.75 밀리그램 /하지만,이 방법의 1.75 밀리그램 / 겔들은 원래 방법보다 더욱 수축 할 수 있도록하기 위해 ml 인 것을 상기 제 1 차이이다. 두 번째 차이는 원래의 방법은 겔 부유 매체 용 무 혈청 배지를 사용하지만,이 방법은 세포의 수축력을 세포 생존을 유지하고 유지하기 위해 겔 부유 매체에 1 % FBS를 사용한다.

원래 섬유 모세포에 대한 개발 겔 수축 분석은 상처 치유 및 섬유증 (13)의 프로세스에 기여하는 세포의 수축력을 평가하기위한 시험 관내 모델에 적합하다. 한 콜라겐 형에 대한 섬유 아세포의 부착을 따라서 콜라겐 겔의 크기의 감소를 초래 기계적 긴장을 생성하도록되어있다. 또한,이 분석은 최근 사용되고기관지 천식 및 COPD 29-31 비롯한 염증성 질환으로기도 세포의 수축 연구를위한 시험 관내 모델로서.

이 특정 기기를 필요로하고 높은 재현성을 나타내는 정량적하지에서 겔 수축 분석은 이러한 세포 이동 분석과 같은 다른 분석에 대등하다. 그러나, EMT (32)을 평가하기위한 겔 수축 분석법을 적용하는 몇 가지보고가있다. 본 연구에서는, EMT받은 세포를 함유하는 겔은 크게 세포 수축을 나타내는 겔화 후 72 시간부터 24 크기로 감소 하였다. 이 방법의 한계는 그러나이 있습니다. 첫째는이 분석에있어서, 겔의 크기 변화가 겔의 모든 셀의 수축력의 합을 표시한다는 것이다. 그러나,이 분석을 이용하여 겔에서 단일 세포의 수축력을 평가하기 어렵다. 둘째, A549 세포는 암세포가 아닌 정상 인간 상피 세포는 것이다. 따라서, O를 추정하기 어려운직접 폐 섬유증의 발병에 UR의 결과. 그러나, A549 세포는 광범위기도 상피 세포의 기능을 연구하기 위해 사용되며, 몇몇 연구는 폐 섬유증 (33, 34)의 모델로 A549 세포를 사용하여 EMT 증거를 얻었다.

요약하면, 타입 I이 EMT는 이들 세포의 수축을 나타내는, 소형화 된 시행 된 중간 엽 세포를 포함하는 콜라겐 젤. 따라서, 겔 수축 분석법 EMT 과정을 통해 셀의 수축 기능의 획득을 평가하기위한 시험 관내 분석의 확장으로 간주되어야한다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 관심의 충돌이 없습니다.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
개발<em&gt; 체외</em&gt; 분석은 중간 엽 세포를 시행 한 상피 - 중간 엽 전환의 수축 기능을 평가하는
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter