Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Utvikling av en doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fibrose er involvert i patogenesen av forskjellige kroniske progressive sykdommer, slik som interstitiell lungesykdom, hjerte- fibrose, levercirrhose, terminal nyresvikt, systemisk sklerose, autoimmune sykdommer og en. Blant interstitielle lungesykdommer, idiopatisk lungefibrose (IPF) er en kronisk progressiv sykdom, og viser dårlig prognose. Patologisk kjennetegn på IPF er utvikling av fibroblastisk foci som består av aktiverte fibroblaster og myofibroblasts som er knyttet til prognosen. Opprinnelsen til disse pulmonale fibroblaster er foreslått å være avledet fra flere mesenchymale celler, innbefattende opprinnelig hjemmehørende pulmonale fibroblaster og sirkulerer fibrocytt fra benmarg. Nylig har epitelial-mesenkymale overgang (EMT) blitt foreslått å være assosiert med dannelsen av mesenchymale celler 2, og for å bidra til patogenesen av fibrotiske forstyrrelser.

Det er antatt at EMT spiller viktige roller i prosessen med fosterutvikling, sårheling og progresjon av kreft, inkludert tumorinvasjon og metastase tre. Ved å følge fremgangsmåten EMT, epitelceller oppnå muligheten for mesenchymale celler ved tap av epitel-markører, slik som E-cadherin, og ved ekspresjon av mesenchymale markører, slik som vimentin, og α-glattmuskel aktin (SMA) 4,5. Tidligere studier viste bevis på at EMT prosess har blitt assosiert med utvikling av vev fibrose i nyrene 6 og 7 lunge. I tillegg fremmer kronisk betennelse fibrotisk sykdom 8; Videre, slike inflammatoriske cytokiner som tumornekrose-faktor superelementet 14 (TNFSF14; LYS), tumor nekrose faktor (TNF) -α, og interleukin-1β, har vist seg å forbedre EMT 9-12.

Kollagen gel sammentrekning assay, en kollagenbasert celle sammentrekning analyse hvor fibroblaster er innleiret i type Ikollagen gel tredimensjonalt, er et utmerket in vitro modell for evaluering av kontraktilitet. Kontraktilitet er en av de karakteristiske funksjoner av fibroblaster og bidrar til normal sår reparasjon og fibrose 13. I denne analysen, er det tenkt at festingen av fibroblaster til type I kollagen gjennom integrin-avhengige mekanismer er ment for å produsere mekanisk spenning under visse forhold, og følgelig føre til vev sammentrekning.

Her er utviklingen av gelen sammentrekning analysen rapportert å være innrettet til å vurdere anskaffelse av kontraktile funksjon i celler som gjennomgikk EMT. Denne rapporten viser at denne modifiserte analysen er egnet for å vurdere kontraktilitet i mesenkymale celler som gjennomgikk EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Forberedelser og kultur av Lung Epitelceller

  1. Kultur A549 humane lunge epitelceller (adherent cellelinje) i Dulbeccos modifiserte Eagle-medium (DMEM) supplert med 10% føtalt bovint serum (FBS), 100 IU / ml penicillin og 100 ug / ml streptomycin.
  2. Fjern og kast cellekulturmedier fra kulturskål, og vaskes en gang med 5 - 10 ml fosfatbufret saltvann (PBS). Etter vasking, straks suge PBS.
  3. Tilsett 2 ml trypsin / etylendiamintetraeddiksyre (EDTA) (0,05%) og inkuberes ved 37 ° C og 5% CO2 i 3 min.
  4. Samle de frigjorte celler i sentrifugerør som inneholdt cellekulturmedium, sentrifuger rørene ved romtemperatur i 4 min ved 150 x g.
  5. Resuspender cellene pellet i 2 ml cellekulturmedium og fjerne en prøve for celletelling. Tell antall celler ved hjelp av et hemocytometer med Trypan blå flekken for å kontrollere celle-levedyktighet.
  6. Seed A549 celler på10 cm polystyren plater ved en tetthet på 0,5 - 1,0 x 10 6 celler / skål med 10 ml av mediet for gel sammentrekning assay. Seed cellene på 6 vel polystyren plater i en tetthet på 0,5 - 1,0 x 10 5 celler / brønn med 2 ml medium for EMT bekreftelse. Inkuber cellene ved 37 ° C og 5% CO2 i 24 timer.

2. EMT Prosedyre

  1. Tilsett 10 mL av TGF-β1 (5 ug / ml) og 10 ul av TNF-α (10 ug / ml) til platen for gelen sammentrekning analyse sådd i trinn 1,6. Tilsett 2 mL av TGF-β1 (5 ug / ml) og 2 ul av TNF-α (10 ug / ml) til platen for EMT bekreftelse sådd i trinn 1,6. Inkuber ved 37 ° C og 5% CO2 i 48 timer.

3. Bekreftelse av EMT Prosedyre ved PCR og Western blotting

  1. Bekreft endring i morfologi (fra brostensbelagte stein-lignende til spindel form) av behandlede celler ved hjelp av fasekontrastmikroskop.
    Merk: Normal A549 celler har brostensbelagte-lignende og trekantet formet utseende som er karakteristisk for epitelceller, men etter stimulering med TGF-β1 og TNF-α, cellene først merkes og spindel formet som ligner mesenchymale celler 14,15.
  2. Vurdere uttrykk for en epitelial markør, for eksempel E-cadherin og mesenchymale markører som N-cadherin, vimentin, og α-glatt muskulatur aktin ved hjelp av PCR eller Western blotting.
    1. Utdrag total RNA fra cellene ved hjelp av RNA-ekstraksjon sett 16 og syntetisere cDNA ved hjelp av revers transkriptase 17 i henhold til produsentens protokoll.
    2. Mål uttrykk for mRNA nivåer ved hjelp av real time PCR system 18 og monomere cyanine fargestoff PCR kit i henhold til produsentens instruksjoner. De spesifikke primere for GAPDH (glyceraldehyd-3-fosfat-dehydrogenase), ACTA2 (a-actin-2), CDH1 (cadherin-1, E-cadherin), og VIM (vimentin) er vist i tabell 1
    3. Lyse av cellene ved hjelp av en lyseringsbuffer (tabell 2) oppløsning inneholdende 1% protease inhibitor cocktail. Måle alle konsentrasjoner prøve protein ved hjelp av et protein assay kit 19,20, og bruke de samme mengder protein til en polyakrylamid gel.
      1. Utføre SDS-gel-elektroforese og semi-tørr overføring av proteinene til PVDF-membran 21. Inkuber membranen med primære antistoffer i blokkeringsbuffer i 1 - 2 timer. Etter inkubasjon vaskes to ganger membranen med vaskebuffer og inkuber membranen 1 time med andre antistoffer.
        Merk: Se Materialer / utstyr Table for antistoffer og fortynninger som brukes i disse studiene. Se tabell 2 for komponentene i blokkeringsbuffer.
      2. Vask membranen med vaskebuffer to ganger. Ta bilder av membranen med Western blotting deteksjon kit 22 ved hjelp av en kald CCD kamera 11,23.

4. Gel Sammentrekning Analyse for evaluering EMT

  1. Aspirer betinget media fra cellekultur fartøy, og vask godt med 5 - 10 ml PBS for å fjerne døde hudceller. Etter vasking, straks suge PBS.
  2. Tilsett 2 ml av 0,05% trypsin / EDTA og inkuberes ved 37 ° C og 5% CO2 i 3 min.
  3. Samle de frigjorte celler i sentrifugerør som inneholdt DMEM supplert med trypsininhibitor (1 mg / ml), sentrifuger rørene ved RT i 4 minutter ved 150 x g.
  4. Bland type 1 kollagen-gel med destillert vann, og 4 x konsentrert DMEM for å justere volumene for å oppnå en kollagenkonsentrasjon på 1,75 mg / ml, og 1 x DMEM konsentrasjon. Pass på å holde gel medium på is i løpet av dette trinnet.
    Merk: For å gjøre 6 ml gel medium, bland godt 3,5 ml av type 1 kollagen-gel (3 mg / ml), 1,5 ml av 4 x konsentrert DMEM, og 1 ml destillert vann.
  5. Resuspender cellepelleten i 500 ul PBS og fjerne en prøve for celletelling. Telleantallet av celler ved hjelp av et hemocytometer med trypan blå flekken for å kontrollere celle-levedyktighet.
  6. Tilsett gel medium for å justere volumene for å oppnå en celletetthet på 3,0 x 10 5 celler / brønn (6,0 x 10 5 celler / ml) og forsiktig, men raskt blande det med pipettering uten geldannelse.
  7. Utlevere 0,5 ml av blandingen i hver brønn av en 24-brønners ikke-behandlede plate hurtig og nøye for å sikre ren sylinderform. Vær forsiktig med å tillate eventuelle luftbobler å forurense gels (Figur 1a).
    Merk: Gelen medium inneholdende cellene er viskøs og kan lett gel og formen halvmåne form i brønnen.
  8. Inkuber platen i 15 minutter i en celleinkubator ved 37 ° C, 5% CO2 og 95% fuktighet gel helt.
  9. Løsne geler fra platen uten å bryte ved å føre en sterilisert spatel på en måte for å trekke en omkrets i en retning. Ved hjelp av en slikkepott, forsiktig overføre gels til 60 mm vev kultur retterinneholdende 5 ml DMEM / 1% FBS med eller uten TGF-β1 (5 ng / ml) og TNF-α (10 ng / ml).
  10. Rist retter forsiktig for i sikre geler er flytende på mediet. Inkuber i en celleinkubator ved 37 ° C, 5% CO2 og 95% fuktighet.

5. Måling av Gel Size

  1. Mål kollagen gel størrelse etter 0, 24, 48, og 72 timer ved hjelp av et billedanalysesystem.
    1. Slå på gel dokumentasjonssystem (figur 2A), og sette retter inn i lyset skjerming skap. Deretter ta av lokket av retter i kabinettet.
    2. Åpne det tilknyttede gel analyseprogramvare. Klikk på "image oppkjøpet knappen" i menylinjen for å vise bildet av gels i kabinettet. Deretter klikker du på "buy" i menylinjen for å ta bilder av gels (figur 2B).
    3. Klikk på "varslingsknappen" i menylinjen (figur 2C) og justere måleområdet (gul sirkel in Figur 2C) ved å dra musen. Deretter klikker du på "auto-detect knapp" i menylinjen (se knappen i figur 2D). Programvaren oppdager automatisk gels viser en heatmap (figur 2D).
    4. Klikk "OK" for å trekke omrisset av geler ved bildebehandling og å beregne områder omgitt av omrisset (figur 2E). Etter at området er beregnet, er det beregnet areal vises i eget pop-up vindu.
      Merk: Hvis gels overlapper hverandre under bildebehandling, flytte gels forsiktig med en steril pipette tips.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Under EMT, epitelceller miste epiteliale markører, som E-cadherin, og få uttrykk for mesenchymale markører, for eksempel vimentin og α-glatt muskel aktin 4,5. Inkubasjon av A549 humane lunge epitelceller med TGF-β1 og TNF-α induserer EMT. Utseendet av normale A549 celler er brostensbelagte lignende form og trekant form som er karakteristisk for epitelceller (figur 3A), men etter stimulert med TGF-β1 og TNF-α, utseende forandret seg til dyp spindel form som ligner på mesenchymale -celler (figur 3B).

Uttrykket av epitel og mesenchymale markører ble evaluert for å bekrefte at celler gikk EMT. Relative mRNA-ekspresjon ble beregnet med ΔΔCt metode. Individuell data ble normalisert mot glyseraldehyd-3-fosfat dehydrogenase (GAPDH) som er en rengjøring gen. A549-celler ble behandlet med TGF-β1 og TNF-α i 48 timer hadde betydelig redusert ekspresjon av CDH1 og signifikant økt ekspresjon av VIM og ACTA2 (figur 4A). Primerne sekvenser for q-PCR er vist i Tabell 1. Som vist i figur 4B, stimulering med TGF-β1 og TNF-α svekkede E-cadherin uttrykk, mens ekspresjon av vimentin, N-cadherin, og α-glattmuskel aktin ble indusert.

Gelen sammentrekning Analysen ble utført for å evaluere kontraktilitet av celler som gjennomgikk EMT. Etter å indusere EMT med TGF-β1 og TNF-α ble celler støpt inn i kollagen gelen og inkubert i 72 timer i medium som inneholdt TGF-β1 og TNF-α, eller PBS. Som vist i figur 5A, er geler inneholdende celler behandlet med TGF-β1 og TNF-α var mindre enn kontroll-geler inneholdende celler behandlet med PBS. til quantify endringene i gel størrelse, ble geler analysert ved anvendelse av en gel analysator 0, 24, 48 og 72 timer etter behandling. Etter 72 timer, ble størrelsen på geler inneholdende celler behandlet med TGF-β1 og TNF-α reduseres betydelig sammenlignet med kontroll geler (Figur 5B). Vi bekreftet også at de geler inneholdende celler behandlet med TGF-β1 alene, var mindre enn kontroll-geler, men var ikke mindre enn gelene som ble behandlet med TGF-β1 og TNF-α (data ikke vist).

Figur 1
Figur 1. Supplerende Figur for Making Gels. Disse bildene viser de gels kastet i brønner. Gelen medium inneholdende cellene er viskøs og kan lett gel og formen halvmåne form i brønnen. (A) Venstre bilde viser at gelene støpt på riktig måte, og det riktige bildet viser skjemaet for "ryddig sylindrisk form". (B </ Strong>) Venstre bilde viser at gels deformeres, og høyre bilde viser at luftbobler forurense gels. (C) gels er myk, så lett skadet og vanligvis deformeres som "Pac-Man". Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. trinn for å måle Gel størrelse. (A) gel dokumentasjonssystem består av en PC og en gel imaging system. (B) Den "image oppkjøpet knapp", og et bilde av geler. (C) Den "deteksjon knapp", og vinduet for å justere måleområdet (gul sirkel). (D) "auto-deteksjon knapp", og programvaren gjør en heatmap av gels fra et bilde til å de tect omrisset av geler. (E) Programvaren henter omrisset av geler ved bildebehandling, og beregner områder omgitt av disposisjonen. Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. morfologier av EMT-induserte celler. A549 humane lunge-epitel ble sådd ut i en tetthet på 1,0 x 10 5 celler / brønn i en 6-brønns plate og inkubert med eller uten 5 ng / ml TGF-β1 og 10 ng / ml TNF-α i 48 timer, etterfulgt av fasekontrast mikroskopisk avbildning. (A) og (B) er bilder som oppnås under × 200. Skalaen barer i (A) og (B), 100 mikrometer. t = "_ blank"> Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. EMT Stimulering med TGF-β1 og TNF-α. (A) QRT-PCR analyse av EMT markør uttrykk (CDH1, VIM, og ACTA2). (B) Western blot som viser ekspresjon av E-cadherin, N-cadherin, vimentin, a og glatt muskulatur aktin proteiner i A549-celler stimulert med eller uten TGF-β1 og TNF-α. α-tubulin ble benyttet som intern kontroll. A549-celler ble dyrket som i figur 1. N = 3 uavhengige eksperimenter. ** P <0,01; feilfelt representerer SEM. Klikk her for å se en større versjon av dette tallet.

iles / ftp_upload / 53974 / 53974fig5.jpg "/>
Figur 5. Celler gjennomgår EMT ervervet kontraktilitet. A549 celler ble platet ved en tetthet på 1,0 x 10 6 celler / skål i 10 cm skåler og inkubert med eller uten 5 ng / ml TGF-β1 og 10 ng / ml TNF-α i 48 timer. Cellene ble deretter støpt til 500 ul av medium inneholdende 1,75 mg / ml kollagen gel ved en tetthet på 3,0 x 10 5 celler / brønn i en 24-brønns plate. Etter gel-dannelse, ble de tilsatt til mediet med eller uten 5 ng / ml TGF-β1 og 10 ng / ml TNF-α i 60 mm skåler og inkubert i 72 timer etterfulgt av imaging (A). Gel størrelser ble målt etter 0, 24, 48, og 72 timer ved hjelp av et billedanalysesystem. N = 9 uavhengige forsøk (b). ** P <0,01; feilfelt representerer SEM. Klikk her for å se en større versjon av dette tallet.

Gene navn Forward 5 '→ 3' Omvendt 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
VIM GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tabell 1. Primer sekvenser. Primer sekvenser som brukes for QRT-PCR. GAPDH ble benyttet som intern kontroll.

Lysis Buffer: RIPA buffer
20 mM Tris-HCl pH 7.5
150 mM NaCl
1 mM EDTA
1% Polyoksyetylen (9) octyiphenyl eter
0,1% Na-deoxycholate
0,1% SDS
Blokkering Buffer
1% Blokkering reagens i vaskebuffer
Vaskebuffer: TBST buffer
NaCl 45 g
1 M Tris pH 7,4 50 ml
Polyoksyetylen (20) sorbitanmonolaurat 2,5 ml
destillere vann legge til 5 L
5 L

Tabell 2. Komponentene i Buffere anvendt. Komponentene i lyse blokkeringsbuffer og vaskebuffer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Den protokoll som er utviklet i denne studien omfatter to trinn. Det første trinnet utføres for å indusere EMT, mens det andre trinnet er gelen sammentrekning analysen. Siden det er viktig å bekrefte at celler gikk EMT, trinn 2 gir et utmerket supplement til de morfologiske og genuttrykk endringer. Tidligere studier viste at EMT av A549-celler ble indusert ved bare 24 TGF-β1; men som vi har rapportert tidligere 10, forbedrer TNF-α behandling EMT og oppkjøpet av mesenchymale cellemarkører. Det er antatt at mekanismene for TGF-β-mediert EMT er Smad avhengig 25. TNFa forbedrer TGF-β1-indusert EMT som fører til forbedring av gel sammentrekning. Det har blitt rapportert at mekanismene for TNFa for forbedring av TGF-β1-indusert EMT er ikke bare fosforylering av smad2 linkerområde, men også MAPK aliserte regulering 26. Derfor protokoll utviklet i denne studien inkluderte stimulasjon av både TGF-β1 og TNF-α.

Innebygging av celler som gjennomgikk EMT inn i type I kollagen-gel, og som flyter på mediet, står sentralt i denne analysen (trinn 4). Fordi gelene er myke og lett skadet, og har forskjellige dimensjoner på hver side, blir ekstrem forsiktighet kreves ved anvendelse av gelene til mediet og måling av deres størrelser. Dersom det er vanskelig å utføre dette trinnet, er det en alternativ metode for å måle gel størrelser i brønnen uten å flytte gelene inn i 60 mm skål 27,28. Det er flere vanlige problemer, den første problemet er at kollagen geler lett gelate ved romtemperatur, så gelene ofte deformeres som nevnt i trinn 4,7. Derfor må platen være forsiktig rystet etter støping gelen inn i brønnene for å sørge for at de tar på en ryddig sylindrisk form. Det andre problemet er at hvis eventuelle luftbobler inn geler under gelering, da størrelsen av geler vil være ujevn. Pass på å ikke tillate noen luft-boblees å forurense gels. Det er to hovedforskjeller mellom original metode og denne metoden. Den første forskjell er at sluttkonsentrasjonen av kollagen geler av opprinnelige metoden er 0,75 mg / ml, men som i denne metoden er 1,75 mg / ml, slik at gelene til å trekke seg sammen mer enn de gjør med den opprinnelige metoden. Den andre forskjellen er at den opprinnelige metoden bruker serumfritt medium for gel flytende medium, men denne metoden bruker 1% FBS i gelen flytende medium for å opprettholde cellenes levedyktighet og opprettholde celle kontraktilitet.

Gelen sammentrekning assay opprinnelig utviklet for fibroblaster er en ideell in vitro modell for evaluering av den kontraktilitet av celler som bidrar til prosessen med sårtilheling og fibrose 13. Festingen av fibroblaster til type 1 kollagen er ment for å fremstille mekaniske spenninger som følgelig fører til en reduksjon i størrelsen av de kollagen-geler. I tillegg har denne analysen nylig blitt bruktsom en in vitro modell for å studere sammentrekning av luftveiene cellene i inflammatoriske sykdommer, inkludert bronkial astma og KOLS 29-31.

Gelen sammentrekning analysen sammenlignes med andre analyser, så som cellemigrering analyser, ved at den ikke krever bestemte enheter og oppviser høy kvantitativ reproduserbarhet. Men det er få rapporter som gjelder gelen sammentrekning analyse for å vurdere EMT 32. I denne studien, geler inneholdende celler som gjennomgikk EMT betydelig redusert i størrelse 24-72 timer etter gelering, noe som indikerer celle sammentrekning. Det er imidlertid begrensninger for denne metoden. Den første er at i denne analysen, størrelsen endring av gelene viser summen av kontraktilitet av alle celler i gelene. Imidlertid er det vanskelig å vurdere enkeltcelle kontraktilitet i gelene ved hjelp av denne analysen. Det andre er at A549-celler er en kreftcellelinje, ikke normale humane epitelceller. Derfor er det vanskelig å ekstrapolere our resultatene direkte til patogenesen av lungefibrose. Imidlertid er A549 celler mye brukt til å studere funksjoner av luftveis-epitelceller, og flere studier har gitt bevis for EMT ved å bruke A549-celler som en modell for silikose 33,34.

I sammendrag, type I kollagen geler inneholdende mesenchymale celler som gjennomgikk EMT ble redusert i størrelse, noe som indikerer sammentrekning av disse cellene. Således bør gelen sammentrekning assay bli betraktet som en utvidet in vitro-analyse for å vurdere anskaffelse av kontraktile funksjon i cellene gjennom EMT prosess.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingen interessekonflikter å avsløre.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Utvikling av en<em&gt; In Vitro</em&gt; Assay å evaluere kontraktile funksjon av mesenchymalceller som gjennomgikk Epitelial-Mesenchymale Overgangs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter