Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Desenvolvimento de um doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fibrose está envolvida na patogénese de várias doenças progressivas, crónicas, tais como doença intersticial pulmonar, fibrose cardíaca, cirrose hepática, insuficiência renal terminal, esclerose sistémica, doença auto-imune e uma. Entre as doenças pulmonares intersticiais, fibrose pulmonar idiopática (PIF) é uma doença progressiva crónica e mostra mau prognóstico. marco patológico da FPI é o desenvolvimento de focos fibroblásticos consistindo de fibroblastos activados e miofibroblastos que estão associados com o prognóstico. As origens de tais fibroblastos pulmonares são propostos para ser derivadas de várias células mesenquimais, incluindo fibroblastos pulmonares originalmente residentes e fibrócitos que circulam a partir de medula óssea. Recentemente, tem sido proposto transição epitelial-mesenquimal (EMT) para ser associada com a formação de células mesenquimais 2, e para contribuir para a patogénese de doenças fibróticas.

Pensa-se que o EMT desempenha um papel importante no processo de desenvolvimento fetal, a cicatrização de feridas, e progressão do cancro, incluindo a invasão do tumor e metástases 3. Seguindo o processo de EMT, células epiteliais obter a capacidade das células mesenquimais por perda de marcadores epiteliais, tais como E-caderina, e através da expressão de marcadores de mesenquimais, tais como, a vimentina e α-actina de músculo liso (SMA) 4,5. Estudos anteriores demonstraram a evidência de que EMT processo tem sido associada com o desenvolvimento de tecido fibroso no rim e pulmão 6 7. Além disso, a inflamação crónica promove doença fibrótica 8; Além disso, tais citocinas inflamatórias como o factor de necrose tumoral membro da superfamília 14 (TNFSF14; LUZ), -α factor de necrose tumoral (TNF) e interleucina-1β, têm sido mostrados para melhorar EMT 9-12.

ensaio de contracção de gel de colagénio, um ensaio de contracção celular à base de colagénio, em que os fibroblastos são incorporados no tipo Igel de colagénio tridimensional, é um modelo in vitro ideal para a avaliação da contractilidade. Contractilidade é uma das funções características de fibroblastos e contribui para a reparação de feridas normal e fibrose 13. Neste ensaio, pensa-se que a fixação de fibroblastos ao colágeno tipo I através de mecanismos dependentes de integrina é suposto para produzir tensão mecânica sob certas condições, e, consequentemente, levar à contração do tecido.

Aqui, o desenvolvimento do ensaio de contracção de gel é referido como sendo adaptado para avaliar a aquisição da função contráctil nas células que foram submetidos a EMT. Este relatório demonstra que este ensaio modificado é adequado para avaliar a contratilidade em células mesenquimais que foram submetidos a EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparações e cultivo de células epiteliais do pulmão

  1. As células epiteliais do pulmão humano A549 (linha de cultura de células aderentes) em Dulbecco Modified Eagle Médium (DMEM) suplementado com 10% de soro fetal de bovino (FBS), 100 UI / ml de penicilina, e 100 ug / ml de estreptomicina.
  2. Remover e descartar o meio de cultura celular a partir de placa de cultura, e lava-se uma vez com 5 - 10 ml de solução salina tamponada com fosfato (PBS). Após a lavagem, aspirar imediatamente o PBS.
  3. Adicionar 2 ml de ácido Tripsina / etilenodiaminotetra-acético (EDTA) (0,05%) e incuba-se a 37 ° C e 5% de CO 2 durante 3 min.
  4. Recolher as células isoladas em tubos de centrífuga contendo meio de cultura de células, os tubos de centrifugação à TA durante 4 minutos a 150 x g.
  5. Ressuspender as células sedimentar em 2 ml de meio de cultura celular e remover uma amostra para contagem de células. Contar o número de células utilizando um hemocitómetro com Trypan mancha azul para verificar a viabilidade das células.
  6. As células A549 semente sobre10 cm placas de poliestireno com uma densidade de 0,5 - 1,0 x 10 6 células / prato com 10 ml de meio para o ensaio de contracção do gel. Semear as células em placas de 6 cavidades de poliestireno com uma densidade de 0,5 - 1,0 x 10 5 células / poço com 2 ml de meio de confirmação EMT. Incubar as células a 37 ° C e 5% de CO 2 durante 24 horas.

2. EMT Procedimento

  1. Adicionar 10 ul de TGF-β1 (5 ug / ml) e 10 ul de TNF-α (10 ug / ml) para a placa de ensaio de contracção de gel semeada na etapa 1.6. Adicionar 2 mL de TGF-β1 (5 ug / ml) e 2 ul de TNF-α (10 ug / ml) à placa a confirmação EMT semeadas no passo 1.6. Incubar a 37 ° C e 5% de CO 2 durante 48 horas.

3. Confirmação de EMT Procedimento por PCR e Western Blotting

  1. Confirmar alteração na morfologia (a partir de pedra-como remendar a fuso forma) das células tratadas por meio de microscopia de contraste de fase.
    Nota: NormaAs células A549 al têm aparência godo tipo pedra e triangulares, que é uma característica das células epiteliais, mas após estimulação com TGF-β1 e TNF-α, as células aparecem longo e em forma de fuso que é semelhante às células mesenquimais 14,15.
  2. Avaliar a expressão de um marcador epitelial, tal como E-caderina, e marcadores de mesenquimais, tais como N-caderina, vimentina, actina de músculo liso-α usando PCR ou transferência de Western.
    1. Extrair o ARN total a partir das células utilizando o kit de extracção de ARN 16 e sintetizar ADNc, utilizando transcriptase reversa 17 de acordo com o protocolo do fabricante.
    2. Medir a expressão dos níveis de ARNm utilizando PCR em tempo real do sistema 18 e corante de cianina monomérico Kit de PCR de acordo com as instruções dos fabricantes. Os iniciadores específicos para GAPDH (gliceraldeído-3-fosfato desidrogenase), ACTA2 (alfa-actina-2), CDH1 (caderina-1; E-caderina), e VIM (vimentina) são mostrados na Tabela 1
    3. Lisar as células, utilizando um tampão de lise (Tabela 2), contendo 1% de cocktail inibidor de protease. Medir todas as concentrações de proteína de amostra utilizando um kit de ensaio de proteína 19,20, e aplicar as mesmas quantidades de proteína para um gel de poliacrilamida.
      1. Realizar SDS-gel de electroforese e transferência semi-seco das proteínas para uma membrana de PVDF 21. Incubar a membrana com anticorpos primários em tampão de bloqueio durante 1 - 2 h. Após a incubação, lavar duas vezes a membrana com tampão de lavagem e incubar a membrana 1 h com segundos anticorpos.
        Nota: Veja a Tabela de materiais / equipamentos para detecção de anticorpos e diluições utilizadas nestes estudos. Ver Tabela 2 para os componentes do tampão de bloqueio.
      2. Lava-se a membrana com tampão de lavagem por duas vezes. Tire fotos da membrana com o kit de detecção de Western blot 22 usando um CCD frio câmera 11,23.

4. Gel Contração Ensaio de Avaliação EMT

  1. Aspirar o meio condicionado a partir do recipiente de cultura de células, e lava-se bem com 5 - 10 ml de PBS para remover as células mortas. Após a lavagem, aspirar imediatamente o PBS.
  2. Adicionar 2 ml de 0,05% de tripsina / EDTA e incubar a 37 ° C e 5% de CO 2 durante 3 min.
  3. Recolher as células isoladas em tubos de centrífuga contendo DMEM suplementado com inibidor de tripsina (1 mg / ml), centrifugar os tubos à temperatura ambiente durante 4 minutos a 150 x g.
  4. Misture tipo gel de colagénio 1 com água destilada, e 4 × DMEM concentrado para ajustar o volume para se atingir uma concentração de colagénio de 1,75 mg / ml, e 1 x concentração de DMEM. Certifique-se de manter o meio de gel em gelo durante esta etapa.
    Nota: Para efectuar a 6 ml de meio de gel, misturar bem 3,5 ml de gel de colagénio de tipo 1 (3 mg / ml), 1,5 ml de 4 × DMEM concentrada, e 1 ml de água destilada.
  5. Ressuspender o sedimento celular em 500 ul de PBS e remover uma amostra para contagem de células. Contagemo número de células utilizando um hemocitómetro com corante azul de tripano para verificar a viabilidade das células.
  6. Adicionar a forma de gel para ajustar os volumes para atingir uma densidade celular de 3,0 x 10 5 células / poço (6,0 x 10 5 células / ml) e cuidadosamente mas rapidamente misturá-lo por pipetagem sem gelificação.
  7. Pipetar 0,5 mL da mistura em cada cavidade de uma placa de 24 poços não-tratada de forma rápida e cuidadosamente para ter a forma cilíndrica pura. Tenha cuidado para não permitir que as bolhas de ar para contaminar os géis (Figura 1A).
    Nota: O meio de gel que contém as células é viscoso e pode facilmente gel e forma forma crescente no poço.
  8. Incubar a placa durante 15 minutos numa incubadora celular a 37 ° C, 5% de CO 2 e 95% de humidade para gelificar completamente.
  9. Retire a placa de géis sem quebrar, movendo uma espátula esterilizada de forma a tirar uma circunferência numa direcção. Com uma espátula, transferir cuidadosamente os géis para pratos de cultura de tecidos de 60 mmcontendo 5 ml de DMEM / FBS a 1%, com ou sem TGF-β1 (5 ng / ml) e TNF-α (10 ng / ml).
  10. Agite suavemente os pratos para garantir géis estão flutuando no meio. Incubar numa incubadora celular a 37 ° C, 5% de CO 2 e 95% de humidade.

5. Medição de Gel Tamanho

  1. Medir o tamanho do gel de colagénio após 0, 24, 48, e 72 h usando um sistema de análise de imagem.
    1. Ligue o sistema de documentação do gel (Figura 2A), e colocar pratos no armário de blindagem leve. Em seguida, retire a tampa de pratos no armário.
    2. Abra o software de análise de gel relacionado. Clique no botão "aquisição de imagem" no menu do bar para mostrar a imagem dos géis no gabinete. Em seguida, clique em "adquirir" na barra de menu para tirar fotos dos géis (Figura 2B).
    3. Clique no botão "detecção" na barra de menu (Figura 2C) e ajustar a região de medição (círculo i amarelon Figura 2C), arrastando o mouse. Em seguida, clique no botão "auto-detectar" na barra de menu (veja o botão na Figura 2D). O software detecta automaticamente os geles que mostram um mapa térmico (Figura 2D).
    4. Clique em "OK" para extrair o contorno dos géis de processamento de imagem e calcular áreas cercadas pelo contorno (Figura 2E). Depois que a área é calculada, a área calculada é exibida na janela pop-up separada.
      Nota: Se os géis sobrepõem uns aos outros durante a imagem, mova géis suavemente com uma ponta de pipeta estéril.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Durante EMT, células epiteliais perdem marcadores epiteliais, como a E-caderina, e ganhar a expressão de marcadores mesenquimais, como vimentina e músculo α-suave agindo 4,5. A incubação de células epiteliais do pulmão humano A549 com TGF-β1 e TNF-α induz EMT. O aparecimento de células A549 normais são de calçada como forma e forma de triângulo, que é uma característica de células epiteliais (Figura 3A), mas depois estimuladas com TGF-β1 e TNF-α, a aparência alterados para a forma eixo longo que é semelhante ao mesenquimais células (Figura 3B).

A expressão de marcadores epiteliais e mesenquimais foram avaliadas para confirmar que as células foram submetidos a EMT. a expressão de ARNm relativa foi calculada com o método ΔΔCt. Os dados individuais foram normalizados contra a desidrogenase do gliceraldeído-3-fosfato (GAPDH), que é uma arrumação geno. As células A549 tratadas com TGF-β1 e TNF-α durante 48 horas tinham reduzido significativamente a expressão de CDH1 e aumentou significativamente a expressão do VIM e ACTA2 (Figura 4A). As sequências de iniciadores utilizados para Q-PCR estão apresentados na tabela 1. Como mostrado na Figura 4B, a estimulação com TGF-β1 e TNF-α expressão atenuada de E-caderina, enquanto que a expressão de vimentina, N-caderina, e actina de músculo liso-α foi induzida.

O ensaio contração gel foi realizada para avaliar a contratilidade de células que foram submetidos a EMT. Depois de induzir EMT com TGF-β1 e TNF-α, as células foram lançados no gel de colagénio e incubou-se durante 72 horas em meio contendo TGF-β1 e TNF-α, ou PBS. Como mostrado na Figura 5A, os géis contendo células tratadas com TGF-β1 e TNF-α foram menores do que o gel de controlo contendo células tratadas com PBS. para quantify as mudanças no tamanho do gel, os geles foram analisados ​​usando um analisador de gel de 0, 24, 48, e 72 h após o tratamento. Depois de 72 h, os tamanhos de géis contendo células tratadas com TGF-β1 e TNF-α foram significativamente reduzidos em comparação com os geles de controlo (Figura 5B). Nós também confirmou que os géis contendo células tratadas com TGF-β1 sozinho foram menores do que o gel de controlo, mas não foram menores do que os géis tratados com TGF-β1 e TNF-α (dados não mostrados).

figura 1
Figura 1. Figura Suplementar para fazer Gel. Estas imagens mostram os géis expressos em poços. O meio de gel que contém as células é viscoso e pode facilmente gel e forma forma crescente no poço. (A) A imagem da esquerda mostra que os géis são escalado corretamente, ea imagem da direita mostra o esquema de "forma cilíndrica pura". (B </ Strong>) A imagem da esquerda mostra que os géis deformar, e a imagem direita mostra que as bolhas de ar contaminar os géis. (C) Os géis são suaves, por isso, facilmente danificadas e, geralmente deformar como "Pac-Man". Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Os passos para medir o tamanho Gel. (A) O sistema de documentação de gel consiste em um PC e um sistema de imagem gel. (B) A "imagem de botão aquisição", e uma imagem dos géis. (C) O "botão de detecção", ea janela para ajustar a região de medição (círculo amarelo). O "botão de detecção automática" (D), eo software faz um mapa de calor dos géis de uma imagem para de teger o contorno dos géis. (E) O software extrai o contorno dos géis de processamento de imagem, e calcula áreas cercadas pelo contorno. Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. morfologias das células EMT-induzidas. Epitélios do pulmão humano A549 foram plaqueadas a uma densidade de 1,0 x 10 5 células / poço numa placa de 6 poços e incubadas com ou sem 5 ng / ml de TGF-β1 e 10 ng / mL TNF-α durante 48 horas, seguido de contraste de fase de imagem microscópica. (A) e (B) são imagens obtidas sob × 200. As barras de escala em (A) e (B), 100? M. t = "_ blank"> Clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4. Estimulação EMT com TGF-β1 e TNF-α. (A) análise de qRT-PCR de EMT expressão do marcador (CDH1, VIM e ACTA2). (B) Western blot mostrando a expressão de E-caderina, N-caderina, vimentina, e ácido a actina do músculo liso proteínas em células A549 estimuladas com ou sem TGF-β1 e TNF-α. α-tubulina foi utilizada como controlo interno. As células A549 foram cultivadas como na Figura 1. N = 3 experiências independentes. ** P <0,01; barras de erro representam SEM. Por favor clique aqui para ver uma versão maior desta figura.

iles / ftp_upload / 53974 / 53974fig5.jpg "/>
Figura 5. células em EMT Adquirida Contratilidade. As células A549 foram semeadas a uma densidade de 1,0 X 10 6 células / placa em placas de 10 cm e incubadas com ou sem 5 ng / ml de TGF-β1 10 e TNF-α ng / ml durante 48 horas. As células foram então fundido em 500 ul de meio contendo 1,75 mg de gel de colagénio / ml a uma densidade de 3,0 x 10 5 células / poço numa placa de 24 poços. Após a formação do gel, que foram adicionadas ao meio com ou sem 5 ng / ml de TGF-β1 e 10 ml de TNF-α / ng em placas de 60 mm e incubadas durante 72 horas seguido por imagiologia (A). tamanhos de gel foram medidos após 0, 24, 48, e 72 h usando um sistema de análise de imagem. N = 9 experiências independentes (B). ** P <0,01; barras de erro representam SEM. Por favor clique aqui para ver uma versão maior desta figura.

Nome gene Adiante 5 '→ 3' Inverta 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
VIM GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tabela 1. Sequências primer. As sequências dos iniciadores utilizados para qRT-PCR. GAPDH foi utilizada como controlo interno.

Tampão de Lise: tampão RIPA
Tris-HCl pH 7,5 20
150 mM de NaCl
1 mM de EDTA
1% de polioxietileno (9) éter octyiphenyl
0,1% Na-desoxicolato
0,1% de SDS
Tampão de bloqueio
1% reagente de bloqueio em tampão de lavagem
Tampão de lavagem: tampão TBST
NaCl 45 g
1 M de Tris pH 7,4 50 ml
Polioxietileno (20) monolaurato de sorbitano 2,5 ml
destilar água adicionar 5? L
5 L

Tabela 2. Os componentes de tampões utilizados. Os componentes de lise tampão de bloqueio, e o tampão de lavagem.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O protocolo desenvolvido neste estudo compreende duas etapas. O primeiro passo é realizado para induzir EMT, enquanto o segundo passo é o ensaio de contracção do gel. Uma vez que é importante para confirmar que as células foram submetidos a EMT, passo 2 proporciona um excelente complemento para as alterações morfológicas e expressão de genes. Estudos anteriores mostraram que as células de EMT A549 foi induzida por apenas 24 TGF-β1; No entanto, como já relatado anteriormente 10, o tratamento TNF-α aumenta EMT ea aquisição de marcadores de células mesenquimais. Pensa-se que os mecanismos de EMT TGF-β-mediada é 25 dependente de Smad. TNFa melhora EMT-TGF-β1 induzida que conduz à melhoria da contracção do gel. Tem sido relatado que os mecanismos de TNFa para o realce de EMT induzida por TGF-β1 não são apenas fosforilação da região ligante Smad2, mas também MAPK sinalização regulação 26. Portanto, o protocolo desenvolvido neste estudo incluiu stimulção por tanto o TGF-β1 e TNF-α.

A incorporação de células que foram submetidos EMT para o colagénio do tipo I de gel, e que flutuam sobre a forma, são aspectos centrais deste ensaio (passo 4). Uma vez que os geles são macios e facilmente danificadas, e ter dimensões diferentes em cada lado, é necessário cuidado extremo quando se aplica os geles para o meio de medição e os seus tamanhos. Se é difícil de realizar este passo, há um método alternativo para medir os tamanhos de gel no poço sem mover os géis em placa de 60 mm 27,28. Há vários problemas comuns, o primeiro problema é que os géis de colagénio facilmente gelificar à TA, de modo que os géis frequentemente deformar como mencionado no passo 4.7. Portanto, a placa deve ser agitada suavemente depois de lançar os géis em poços para se certificar de que eles assumem uma forma cilíndrica pura. O segundo problema é que, se as bolhas de ar entram no gel durante a gelificação, em seguida, o tamanho dos géis será desigual. Tenha cuidado para não permitir que qualquer bubbl arES contaminar os géis. Existem duas diferenças principais entre método original e este método. As primeiras diferenças é que a concentração final de géis de colagénio do método original de 0,75 mg / mL, mas que este método é de 1,75 mg / ml, a fim de permitir que os géis a contrair-se mais do que com o método original. A segunda diferença é que o método original usa meio isento de soro por meio de gel flutuante mas este método utiliza 1% de FBS em meio flutuante em gel, a fim de manter a viabilidade das células e manter a contractilidade celular.

O ensaio de contracção de gel originalmente desenvolvido para fibroblastos é um modelo in vitro ideal na para avaliar a contractilidade de células que contribuem para o processo de cicatrização de feridas e fibrose 13. A ligação de f ibroblastos a um tipo de colagénio é suposto para produzir tensões mecânicas que, consequentemente, leva a uma redução do tamanho dos géis de colagénio. Além disso, este ensaio tem sido utilizada recentementecomo um modelo in vitro para estudar a contracção de células das vias respiratórias em doenças inflamatórias, incluindo a asma brônquica e DPOC 29-31.

O ensaio de contracção de gel é comparável com outros ensaios, tais como ensaios de migração celular, na medida em que não necessita de dispositivos específicos e exibe uma elevada reprodutibilidade quantitativa. No entanto, existem poucos relatos que aplicam o ensaio de contracção gel para avaliar EMT 32. Neste estudo, os geles que contêm células que foram submetidos EMT significativamente diminuído em tamanho de 24 a 72 horas após a gelificação, indicando contracção celular. No entanto, existem limitações para este método. A primeira é que, neste ensaio, a alteração do tamanho dos géis mostram a soma de contractilidade de todas as células nos géis. No entanto, é difícil de avaliar a contractilidade celular única nos géis utilizando este ensaio. A segunda é que as células A549 é uma linha celular de cancro, não células epiteliais humanas normais. Portanto, é difícil para extrapolar our resultados diretamente para a patogênese da fibrose pulmonar. No entanto, as células A549 são amplamente utilizados para estudar as funções das células epiteliais das vias respiratórias, e vários estudos mostraram evidência de EMT usando células A549 como um modelo de fibrose pulmonar 33,34.

Em resumo, o colagénio do tipo I géis contendo células mesenquimais que foram submetidos a EMT foram reduzidos em tamanho, indicando contracção dessas células. Assim, o ensaio de contracção de gel deve ser considerado como um prolongado ensaio in vitro para avaliar a aquisição da função contráctil nas células por meio de processo de TEM.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm conflitos de interesse para divulgar.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Desenvolvimento de um<em&gt; In Vitro</em&gt; Ensaio para avaliar contrátil Função de células mesenquimais que a transição epitelial-mesenquimal Sofreu
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter