Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Развитие doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Фиброз участвует в патогенезе различных хронических прогрессирующих заболеваний, таких как интерстициальный заболевания легких, сердечный фиброз печени , цирроз печени, терминальной почечной недостаточности, системный склероз, и аутоиммунные заболевания 1. Среди интерстициальных заболеваний легких, идиопатический легочный фиброз (IPF) представляет собой хроническое прогрессирующее заболевание, и показывает плохой прогноз. Патологический признак IPF является развитие фибробластической очагов, состоящий из активированных фибробластов и миофибробластов, которые связаны с прогнозом. Истоки таких легочных фибробластов предлагается быть получены из нескольких мезенхимальных клеток, в том числе легочных фибробластов, первоначально резидентных и циркулирующих фиброциты из костного мозга. В последнее время был предложен переход эпителиально-мезенхимальной (ЕМТ), связаны с образованием клеток мезенхимы 2, и внести свой ​​вклад в патогенез фиброзных заболеваний.

Считается, что чемпионат ЕвропыТ играет важную роль в процессе развития плода, заживление ран, а также прогрессирование рака, в том числе опухолевой инвазии и метастазирования 3. После процесса EMT, эпителиальные клетки получают способность мезенхимальных клеток потерей эпителиальных маркеров, таких как Е-кадгерина, и экспрессии маркеров мезенхимальных, таких как виментину и α-актин гладких мышц (SMA) 4,5. Предыдущие исследования показали , доказательства того, что процесс ЕМТ был связан с развитием фиброза тканей в почках 6 и 7 легких. Кроме того, хроническое воспаление способствует болезни фиброзный 8; Кроме того, такие цитокины , как фактор некроза опухоли надсемейства элемента 14 (TNFSF14, свет), фактор некроза опухолей (ФНО), и интерлейкин-1 & beta ; , было показано , что повышение EMT 9-12.

сокращение анализа коллагеновый гель, коллаген на основе сжатия клеток для анализа, в котором фибробласты встроены в типа Iколлагеновый гель трехмерно, является идеалом в пробирке модель для оценки сократительной способности . Сократимость является одной из характерных функций фибробластов и способствует нормальному заживлении ран и фиброза 13. В этом анализе, полагают, что присоединение фибробластов типа коллагена через интегрин-зависимые механизмы, как предполагается производить механические напряжения при определенных условиях, и, следовательно, приводит к сжатию ткани.

Здесь, развитие анализа гель сжатия, как сообщается, адаптированный для оценки приобретения сократительной функции в клетках, прошедших ЕМТ. Этот отчет показывает, что этот модифицированный тест предназначен для оценки сократительной в мезенхимальных клетках, подвергшихся EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Подготовка и культура легких эпителиальных клеток

  1. Культура A549 эпителиальные клетки легких человека (прилипший линия клеток) в среде Игла в модификации Дульбекко (DMEM) с добавлением 10% фетальной бычьей сыворотки (FBS), 100 МЕ / мл пенициллина и 100 мкг / мл стрептомицина.
  2. Удаляют среды для культивирования клеток от культуральной чашки и мыть один раз с 5 - 10 мл фосфатно-буферного раствора (PBS). После промывания, немедленно аспирация PBS.
  3. Добавить 2 мл трипсин / этилендиаминтетрауксусной кислоты (ЭДТА) (0,05%) и инкубируют при температуре 37 ° С и 5% СО 2 в течение 3 мин.
  4. Собирают обособленные клетки в центрифужные пробирки, содержащие среду для культивирования клеток, центрифугируют пробирки при комнатной температуре в течение 4 мин при 150 × г.
  5. Ресуспендируют клетки осадок в 2 мл культуральной среды клеток и удалить образец для подсчета клеток. Подсчитайте число клеток с помощью гемоцитометра с трипановым синим красителем, чтобы проверить жизнеспособность клеток.
  6. Семенной клетки А549 на10 см полистирола пластины с плотностью 0,5 - 1,0 × 10 6 клеток / блюдо с 10 мл среды для геля сжатия анализа. Семенной клеток на 6 - луночные полистироловые планшеты при плотности 0,5 - 1,0 × 10 5 клеток / лунку с 2 мл среды для EMT подтверждения. Инкубируйте клетки при 37 ° С и 5% СО 2 в течение 24 часов.

Процедура 2. EMT

  1. Добавьте 10 мкл TGF- 1 (5 мкг / мл) и 10 мкл TNF-alpha (10 мкг / мл) к пластине для геля сжатия анализа высевают на этапе 1.6. Добавляют 2 мкл TGF- 1 (5 мкг / мл) и 2 мкл TNF-alpha (10 мкг / мл) к пластине для EMT подтверждения высевают на шаге 1.6. Инкубируют при 37 ° С и 5% СО 2 в течение 48 часов.

3. Подтверждение EMT процедуры с помощью ПЦР и Вестерн-блоттинга

  1. Подтвердите изменение морфологии (от булыжник-как шпинделем форму) обработанных клеток с использованием фазово-контрастной микроскопии.
    Примечание: NormКлетки А549 ал имеют булыжник вид камнеподобное и треугольной формы , которая является характеристикой эпителиальных клеток, но после стимуляции TGF- 1 и TNF-alpha, клетки появляются длинные и шпиндель формы , который похож на мезенхимальные клетки 14,15.
  2. Оценка экспрессии эпителиального маркера, такие как E-кадгерина, и мезенхимальные маркеры, такие как N-кадгерина, виментину и альфа-актин гладких мышц с использованием ПЦР или Вестерн-блоттинга.
    1. Экстракт тотальной РНК из клеток с использованием набора для экстракции РНК 16 и синтеза кДНК с использованием обратной транскриптазы 17 в соответствии с протоколом производителя.
    2. Измерьте экспрессию уровней мРНК с использованием системы в реальном масштабе времени PCR 18 и мономерный цианиновый краситель ПЦР - комплект в соответствии с инструкциями производителя. Специфические праймеры для GAPDH (глицеральдегид - 3-фосфат - дегидрогеназа), ACTA2 (альфа-актин-2), CDH1 (кадгерин-1, E-кадгерина), и ВИМ (Виментин), приведены в таблице 1 ,
    3. Лизировать клетки , используя буфер для лизиса (таблица 2) , содержащий 1% ингибиторов протеаз. Измерить все концентрации образца белка с помощью анализа белка набор 19,20, и применять те же количества белка в полиакриламидном геле.
      1. Выполнить SDS гель-электрофореза и полусухого переноса белков на PVDF мембрану 21. Инкубируйте мембрану с первичными антителами в блокирующем буфере в течение 1 - 2 ч. После инкубации промыть дважды мембрану с промывочным буфером и инкубировать 1 час мембрану со вторыми антителами.
        Примечание: Смотрите таблицу Материалы / Оборудование для антител и разведений, используемых в этих исследованиях. В таблице 2 компонентов блокирующего буфера.
      2. Промойте мембрану с буфером для промывки дважды. Сфотографируйте мембраны с Вестерн - блоттинга комплект обнаружения 22 с использованием холодного CCD камеры 11,23.

4, Гель Сужение анализа для оценки EMT

  1. Аспирируйте кондиционированной среды из сосуда для культивирования клеток, а также стирать с 5 - 10 мл PBS для удаления мертвых клеток. После промывания, немедленно аспирация PBS.
  2. Добавляют 2 мл 0,05% трипсина / EDTA и инкубировать при 37 ° С и 5% СО 2 в течение 3 мин.
  3. Собирают обособленные клетки в центрифужные пробирки, содержащие DMEM, с ингибитором трипсина (1 мг / мл), центрифугу трубках, дополненной при комнатной температуре в течение 4 мин при 150 & bull; g.
  4. Смешайте тип 1 коллаген гель с дистиллированной водой, и 4 × концентрированные DMEM для регулировки громкости для достижения концентрации коллагена в 1,75 мг / мл, и 1 × концентрация DMEM. Не забудьте сохранить гелевой среды на льду во время этого шага.
    Примечание: Для того, чтобы 6 мл гелевой среды, хорошо перемешать 3,5 мл 1 типа коллагена геля (3 мг / мл), 1,5 мл 4 × концентрированного DMEM и 1 мл дистиллированной воды.
  5. Ресуспендируют осадок клеток в 500 мкл PBS и удалить образец для подсчета клеток. подсчитыватьчисло клеток с помощью гемоцитометра с трипановым синим красителем, чтобы проверить жизнеспособность клеток.
  6. Добавьте гелевой среды , чтобы отрегулировать громкость для достижения плотности клеток 3,0 × 10 5 клеток / лунку (6,0 × 10 5 клеток / мл) и осторожно , но быстро смешать его с помощью пипетки без гелеобразования.
  7. Разливают 0,5 мл смеси в каждую лунку 24-луночного необработанной пластиной быстро и аккуратно, чтобы сделать аккуратную цилиндрическую форму. Будьте осторожны , чтобы не допустить любые воздушные пузырьки загрязнять гели (Рис . 1А)
    Примечание: Носитель гель, содержащий клетки является вязким и может легко гель и форма серповидную форму в скважине.
  8. Инкубируйте планшет в течение 15 минут в кювете инкубаторе при температуре 37 ° С, 5% СО 2 и 95% влажности в гель полностью.
  9. Отделить гели из пластинки, не нарушая путем перемещения стерилизованного шпателя таким образом, чтобы нарисовать окружность в одном направлении. С помощью шпателя, аккуратно передать гели до 60 мм чашки для культивирования тканейсодержащий 5 мл DMEM / 1% FBS с добавлением или без TGF- 1 (5 нг / мл) и TNF-alpha (10 нг / мл).
  10. Осторожно потрясите посуду, чтобы обеспечить гели плавающей на носителе. Выдержите в сотовом инкубаторе при температуре 37 ° С в атмосфере 5% СО 2 и 95% влажности.

5. Измерение размера геля

  1. Измерьте размер коллагеновый гель после того, как 0, 24, 48, и 72 ч с использованием системы анализа изображений.
    1. Включите систему гель документации (Рисунок 2A), и поставить посуду в шкаф экранирования света. Затем снять крышку посуды в шкафу.
    2. Откройте соответствующее программное обеспечение гель анализирующее. Нажмите на кнопку "захвата изображений" в меню-бар, чтобы показать образ гелей в шкафу. Затем нажмите кнопку «захватит» в строке меню , чтобы делать снимки гелей (рис 2В).
    3. Нажмите на кнопку "обнаружения" в строке меню (Рисунок 2C) и отрегулировать область измерения (желтый круг яп Рис 2С) путем перетаскивания мышью. Затем нажмите кнопку "автоматического обнаружения" в строке меню (см кнопку на рисунке 2D). Программное обеспечение автоматически определяет гели , показывающие Heatmap (рис 2D).
    4. Нажмите кнопку "OK" , чтобы извлечь контур гелей путем обработки изображений и расчета областей , окруженными контура (рис 2E). После того, как область рассчитывается, расчетная область отображается в отдельном всплывающем окне.
      Примечание: Если гели накладываются друг на друга во время формирования изображения, перемещать гели осторожно с помощью стерильной пипетки.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Во время EMT, эпителиальные клетки теряют эпителиальные маркеры, такие как E-кадгерина, и получить экспрессию маркеров мезенхимальных, таких как виментин и α-актин гладких мышц 4,5. Инкубация человека A549 легочных эпителиальных клеток с TGF- 1 и TNF-a индуцирует EMT. Появление нормальных клеток А549 являются булыжник камень образную форму и форму треугольника , который является характеристикой эпителиальных клеток (рис 3 , а ), но после того, как стимулировали TGF- 1 и TNF-a, внешний вид изменен на длинной форме веретена , который похож на мезенхимальные клетки (фигура 3В).

Экспрессия эпителиальных и мезенхимальных маркеров оценивали, чтобы подтвердить, что клетки подвергались ЕМТ. Выражение Относительная мРНК рассчитывали с помощью метода ΔΔCt. Индивидуальные данные были нормализованы против глицеральдегид-3-фосфатдегидрогеназы (GAPDH), который является ведение домашнего хозяйства гена. A549 клетки , обработанные TGF- 1 и TNF-a в течение 48 ч, значительно пониженную экспрессию CDH1 и значительно повышенную экспрессию VIM и ACTA2 (фиг.4А). Праймеры последовательности, используемые для д-PCR показаны в табл.1. Как показано на фиг.4В, стимуляции TGF- 1 и экспрессии ослабленный Е-кадгерина TNF-alpha, тогда как экспрессия виментину, N-кадгерина и альфа-актин гладких мышц индуцировали.

Анализ гель сжатие проводили для оценки сократимости клеток, которые подверглись ЕМТ. После индукции EMT с TGF- 1 и TNF-alpha, клетки были отлиты в гель коллагена и инкубировали в течение 72 ч в среде, содержащей TGF- 1 и TNF-alpha, или PBS. Как показано на фигуре 5А, гели , содержащие клетки , обработанные с TGF- 1 и ФНО-альфа были меньше , чем контрольные гелей , содержащих клетки , обработанные с PBS. Для кваntify изменением размера геля, гели анализировали с помощью анализатора Лари 0, 24, 48 и 72 ч после обработки. Через 72 ч, размеры гелей , содержащих клетки , обработанные с TGF- 1 и ФНО-альфа были значительно снижены по сравнению с контрольными гелей (рис 5б). Мы также подтвердили, что гели, содержащие клетки, обработанные с TGF- 1 одни были меньше, чем контрольные гели, но были не меньше, чем гели, обработанных TGF- 1 и TNF-alpha (данные не показаны).

Рисунок 1
Рисунок 1. Дополнительный Рисунок для Создания Гели. Эти изображения показывают гели отлитые в лунки. Носитель гель, содержащий клетки является вязким и может легко гель и форма серповидную форму в скважине. (A) Левое изображение показывает , что гели отлиты правильно, а правое изображение показывает схему "аккуратной цилиндрической формы". (B </ Сильный>) Левое изображение показывает, что гели деформироваться, а правое изображение показывает, что воздушные пузырьки загрязнять гели. (C) гели являются мягкими, так легко повреждается и обычно деформируются как "Pac-Man". Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2. Шаги для измерения геля размер. (A) Система документации гель состоит из ПК и системы визуализации геля. "Кнопка Image Acquisition" (B), и картина гелей. "Кнопка обнаружения" (C), и окно для настройки область измерения (желтый круг). "Кнопка автоматического обнаружения" (D), а программное обеспечение делает Heatmap гелей от картины к де Tect контур гелей. (E) Программное обеспечение извлекает контур гелей путем обработки изображений, и вычисляет участки , окруженные контуром. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3. Морфология ЕМТ-индуцированных клеток. A549 эпителии легкого человека , высевали при плотности 1,0 × 10 5 клеток / лунку в 6-луночные планшеты и инкубировали с или без 5 нг / мл TGF- 1 и 10 нг / мл ФНО-α в течение 48 ч, а затем фазовоконтрастном микроскопических изображений. (А) и (В) являются изображения , полученные при х200. Масштабные бары в (А) и (В), 100 мкм. т = "_blank"> Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 4
Рисунок 4. ЕМТ Стимуляция с TGF- 1 и TNF-alpha. (А) QRT-PCR анализ экспрессии маркера EMT (CDH1, VIM, и ACTA2). (В) Вестерн - блот , показывающий экспрессию Е-кадгерина, N-кадгерина, виментину и альфа актин гладких мышц белков в клетках А549 , стимулированных или без TGF- 1 и TNF-alpha. α-тубулина использовали в качестве внутреннего контроля. Клетки А549 культивировали, как на рисунке 1. N = 3 независимых экспериментов. ** Р <0,01; Столбики ошибок обозначают SEM. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Iles / ftp_upload / 53974 / 53974fig5.jpg "/>
Рисунок 5. Ячейки Проходят EMT Приобретенная сократимости. Клетки А549 высевали при плотности 1,0 × 10 6 клеток / чашку в 10 см чашки и инкубировали с или без 5 нг / мл TGF- 1 и 10 нг / мл TNF-a в течение 48 ч. Клетки затем отливают в 500 мкл среды , содержащей 1,75 мг / мл коллагенового геля , при плотности 3,0 × 10 5 клеток / лунку в 24-луночный планшет. После образования геля, они были добавлены в среде с добавлением или без 5 нг / мл TGF- 1 и 10 нг / мл TNF-a в 60 мм чашках и инкубировали в течение 72 ч с последующей обработки изображений (A). Размеры Гелевые были измерены после того, как 0, 24, 48, и 72 ч с использованием системы анализа изображений. N = 9 независимых экспериментов (B). ** Р <0,01; Столбики ошибок обозначают SEM. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Джин Имя Форвард 5 '→ 3' Обратный 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
ВИМ GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Таблица 1. Последовательности праймеров. Последовательности праймеров , используемых для QRT-PCR. GAPDH, использовали в качестве внутреннего контроля.

Лизис буфера: РИПО буфера
20 мМ Трис-HCl, рН 7,5
150 мМ NaCl
1 мМ ЭДТА
1% эфира полиоксиэтилена (9) octyiphenyl эфир
0,1% Na-дезоксихолат
0,1% ДСН
блокирующего буфера
1% блокирующий реагент в буфере для промывки
Промывочный буфер: TBST буфер
NaCl 45 г
1 М Трис рН 7,4 50 мл
Полиоксиэтилен (20) сорбитан монолаурат 2,5 мл
перегонку воды добавить в 5 л
5 л

Таблица 2. Компоненты буферов , используемых. Компоненты лизиса, Блокирующий буфер и промывочный буфер.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Протокол разработан в данном исследовании, включает в себя два этапа. Первый шаг выполняется, чтобы побудить EMT, а второй стадией является анализ гель сжатия. Так как это важно, чтобы подтвердить, что клетки прошли EMT, шаг 2 обеспечивает превосходное дополнение к морфологическим и генных изменений экспрессии. Предыдущие исследования показали , что ЕМТ из клеток A549 индуцировали только 24 TGF- 1; Тем не менее, как мы уже сообщали ранее 10, TNF-α обработка повышает EMT и приобретение маркеров мезенхимальных клеток. Полагают , что механизм TGF-β-опосредованной ЕМТ Smad-зависимый 25. TNF-alpha усиливает TGF- 1-индуцированное EMT, что приводит к усилению контракции геля. Сообщалось , что механизмы TNF & alpha ; для повышения ТФР-β1-индуцированного EMT не только фосфорилирование SMAD2 линкерной области, но и МАРК сигнализации регулирование 26. Таким образом, протокол, разработанный в данном исследовании, включали Стимулвания обоими TGF- 1 и TNF-alpha.

Вложение клеток, прошедших ЕМТ в тип I коллагеновый гель, и плавающие на среде, являются центральными аспектами данного анализа (этап 4). Поскольку гели являются мягкими и легко повреждаются, и имеют различные размеры с каждой стороны, крайняя осторожность требуется при применении гелей для среды и измерения их размеров. Если это трудно осуществить этот шаг, есть альтернативный метод для измерения размеров геля в скважину , не двигая гели в 60 мм блюдо 27,28. Есть несколько распространенных проблем, первая проблема заключается в том, что коллагеновые гели легко желатинирования при комнатной температуре, так что гели часто деформируются, как указано в шаге 4.7. Таким образом, пластина должна быть осторожно встряхивали после заливки гелей в колодцы, чтобы убедиться, что они берут на себя аккуратным цилиндрической формы. Вторая проблема заключается в том, что, если какие-либо пузырьки воздуха вводить гели во время гелеобразования, то размер гелей будет неравномерным. Будьте осторожны, чтобы не допускать воздуха Bubblэс загрязнять гели. Существуют два основных различия между оригинальным методом и этим методом. Первые отличия в том, что конечная концентрация коллагеновых гелей оригинального метода составляет 0,75 мг / мл, но у этого способа составляет 1,75 мг / мл, с тем чтобы гели сжиматься больше, чем они с оригинальным методом. Вторые отличия в том, что оригинальный метод использует безсывороточную среду для геля с плавающей среды, но этот метод использует 1% FBS в геле плавучей среды для того, чтобы сохранить жизнеспособность клеток и поддержания клеток сократимость.

Анализ усадка гель , первоначально разработанный для фибробластов является идеальным в пробирке модель для оценки сократимости клеток , которые вносят вклад в процесс заживления ран и фиброза 13. Прикрепление фибробластов типа 1, коллагена предполагается производить механическую напряженность, что, следовательно, приводит к уменьшению размера коллагеновых гелей. Кроме того, недавно был использован этот анализкак в пробирке модель для изучения сокращения клетки дыхательных путей при воспалительных заболеваниях, в том числе бронхиальной астмы и ХОБЛ 29-31.

Анализ гель сжатия сравнима с другими анализами, такими как миграция клеток анализы, в том, что он не требует особых устройств и демонстрирует высокую количественную воспроизводимость. Тем не менее, есть несколько отчетов , применяющих сократительную анализа гель для оценки EMT 32. В этом исследовании, гели, содержащие клетки, которые прошли ЕМТ значительно уменьшились в размере от 24 до 72 ч после того, как гелеобразование, что указывает на сокращение клеток. Существуют, однако, ограничения этого метода. Во-первых, в этом анализе, изменение размера гелей показывают сумму сократимости всех клеток в геле. Тем не менее, трудно оценить одного сократимость клеток в гелях при применении этого теста. Во-вторых, что клетки А549 представляет собой линию клеток рака, а не нормальные эпителиальные клетки человека. Таким образом, трудно экстраполировать OУр результаты непосредственно к патогенеза легочного фиброза. Тем не менее, клетки А549 широко используются для изучения функции эпителиальных клеток дыхательных путей, и несколько исследований дали доказательства EMT с помощью клеток А549 в качестве модели фиброза легких 33,34.

Таким образом, тип коллагена гели, содержащие мезенхимных клеток, которые подверглись ЕМТ были уменьшены в размерах, что указывает на сокращение этих клеток. Таким образом, анализ сжатия гель следует рассматривать как расширенное в пробирке анализа для оценки приобретения сократительной функции в клетках через процесс ЕМТ.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют конфликта интересов раскрывать.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Развитие<em&gt; In Vitro</em&gt; Анализ для оценки сократительной функции мезенхимальных клеток, перенесшей Эпителиальные-мезенхимальных переходной
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter