Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Utveckling av en doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fibros är involverat i patogenesen för olika kroniska progressiva sjukdomar, såsom interstitiell lungsjukdom, hjärtfibros, levercirros, terminal njursvikt, systemisk skleros och autoimmun sjukdom 1. Bland interstitiell lungsjukdom, är idiopatisk lungfibros (IPF) en kronisk progressiv sjukdom och visar dålig prognos. Patologiskt kännemärke för IPF är utvecklingen av fibroblastisk foci som består av aktiverade fibroblaster och myofibroblaster som är associerade med prognosen. föreslagna Ursprunget till sådana lung fibroblaster komma från flera mesenkymala celler, inklusive ursprungligen bosatta lung fibroblaster och cirkulerande fibrocyter från benmärg. Nyligen har epitelial-mesenkymala övergång (EMT) föreslagits för att vara associerade med bildningen av mesenkymala celler 2, och att bidra till patogenesen av fibrotiska störningar.

Man tror att EMT spelar viktiga roller i processen för fosterutveckling, sårläkning och utvecklingen av cancer, inklusive tumörinvasion och metastas 3. Följande förfarandet av EMT, epitelceller erhålla förmågan hos mesenkymala celler genom förlust av epitel-markörer, såsom E-cadherin, och genom uttryck av mesenkymala markörer, såsom vimentin, och α-glattmuskelaktin (SMA) 4,5. Tidigare studier visade tecken på att EMT process har associerats med utveckling av vävnadsfibros i njuren 6 och lunga 7. Dessutom främjar kronisk inflammation fibrotisk sjukdom 8; dessutom sådana inflammatoriska cytokiner såsom Tumörnekrosfaktor superfamiljmedlem 14 (TNFSF14; LIGHT), tumörnekrosfaktor (TNF) -α, och interleukin-1β, varit har visat sig förstärka EMT 9-12.

Kollagengel kontraktion analys en kollagenbaserad cell kontraktion analys i vilken fibroblaster är inbäddade i typ Ikollagengel tredimensionellt, är en idealisk in vitro-modell för utvärdering av kontraktilitet. Kontraktilitet är ett av de karakteristiska funktionerna hos fibroblaster och bidrar till normal sårläkning och fibros 13. I denna analys är det tänkt att fastsättningen av fibroblaster till typ I-kollagen genom integrin-beroende mekanismer är tänkt för att producera mekanisk spänning under vissa betingelser, och följaktligen leda till vävnadssammandragning.

Här, är utvecklingen av gelén kontraktion assay rapporterats vara anpassad för att utvärdera förvärv av kontraktil funktion i de celler som genomgick EMT. Denna rapport visar att denna modifierade analys är lämplig för att utvärdera kontraktiliteten i mesenkymala celler som genomgick EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Förberedelser och kultur Lung epitelceller

  1. Kultur A549 human lunga epitelceller (adherent cellinje) i Dulbeccos Modified Eagle Medium (DMEM) kompletterat med 10% fetalt bovint serum (FBS), 100 lU / ml penicillin och 100 | ig / ml streptomycin.
  2. Ta bort och kasta cellodlingsmediet från odlingsskålen, och tvätta en gång med 5 - 10 ml av fosfatbuffrad saltlösning (PBS). Efter tvätt, omedelbart aspirera PBS.
  3. Tillsätt 2 ml Trypsin / etylendiamintetraättiksyra (EDTA) (0,05%) och inkubera vid 37 ° C och 5% CO2 under 3 min.
  4. Samla in de lösgjorda celler i centrifugrör innehållande cellodlingsmedium, centrifugera rören vid RT under 4 min vid 150 x g.
  5. Resuspendera cellerna pelle i 2 ml cellodlingsmedium och ta bort ett prov för cellräkning. Räkna antalet cellerna med användning av en hemocytometer med Trypan blå fläcken för att kontrollera cellviabilitet.
  6. Utsäde A549-celler på10 cm polystyren plattor vid en densitet av 0,5 - 1,0 x 10 6 celler / skål med 10 ml medium för gelkontraktion analys. Ympa cellerna på 6 väl polystyrenplattor med en täthet av 0,5 - 1,0 x 10 5 celler / brunn med 2 ml medium för EMT bekräftelse. Inkubera cellerna vid 37 ° C och 5% CO2 under 24 timmar.

2. EMT ordningen

  1. Tillsätt 10 | il TGF-β1 (5 | j, g / ml) och 10 pl av TNF-α (10 | j, g / ml) till plattan för gelkontraktion assay ympas i steg 1,6. Tillsätt 2 pl av TGF-β1 (5 | j, g / ml) och 2 | il av TNF-α (10 | j, g / ml) till plattan för EMT bekräftelse ympades i steg 1,6. Inkubera vid 37 ° C och 5% CO2 under 48 timmar.

3. Bekräftelse av EMT ordningen från PCR och Western blotting

  1. Bekräfta ändring i morfologi (från kullersten-liknande för att spindelform) av behandlade celler med hjälp av faskontrastmikroskopi.
    Obs: Normal A549-celler har kullersten-liknande och triangelformat utseende som är ett kännetecken hos epitelceller, men efter stimulering med TGF-β1 och TNF-α, cellerna förefaller lång och spindeln formade som liknar mesenkymala celler 14,15.
  2. Utvärdera uttrycket av en epitelial markör, såsom E-cadherin, och mesenkymala markörer såsom N-cadherin, vimentin, och α-glatt muskulatur aktin med användning av PCR eller Western blotting.
    1. Extrahera totalt RNA från cellerna med hjälp av RNA-extraktion kit 16 och syntetisera cDNA med användning av omvänt transkriptas 17 enligt tillverkarens protokoll.
    2. Mät uttryck av mRNA-nivåer med hjälp realtids-PCR-system 18 och mono cyaninfärgämne PCR-kit enligt tillverkarens instruktioner. De specifika primrar för GAPDH (glyceraldehyd 3-fosfatdehydrogenas), ACTA2 (alfa-aktin-2), CDH1 (cadherin-1, E-cadherin), och VIM (vimentin) visas i tabell 1
    3. Lyserar cellerna med användning av en lyseringsbuffert (tabell 2) lösning innehållande 1% proteasinhibitorcocktail. Mät alla provproteinkoncentrationerna med hjälp av en proteinanalyssats 19,20, och tillämpa samma mängder protein till en polyakrylamidgel.
      1. Utföra SDS-gel-elektrofores och halvtorr överföring av proteinerna till PVDF-membran 21. Inkubera membranet med primära antikroppar i blockerande buffert under 1 - 2 h. Efter inkubation, tvätta två gånger membranet med tvättbuffert och inkubera membranet 1 h med andra antikroppar.
        Obs: Se Material / utrustning Tabell för antikroppar och utspädningar används i dessa studier. Se tabell 2 för komponenterna i blockeringsbuffert.
      2. Tvätta membranet med tvättbuffert två gånger. Ta bilder av membranet med Western blotting detektionssats 22 med hjälp av en kall CCD-kamera 11,23.

4. Gelkontraktion analys för Utvärdera EMT

  1. Aspirera det konditionerade mediet från cellodlingskärlet, och tvätta väl med 5 - 10 ml av PBS för att avlägsna döda celler. Efter tvätt, omedelbart aspirera PBS.
  2. Tillsätt 2 ml av 0,05% trypsin / EDTA och inkubera vid 37 ° C och 5% CO2 under 3 min.
  3. Samla in de lösgjorda celler i centrifugrör innehållande DMEM kompletterat med trypsininhibitor (1 mg / ml), centrifugera rören vid RT under 4 min vid 150 x g.
  4. Blanda typ 1 kollagen gel med destillerat vatten, och 4 × koncentrerade DMEM att justera volymen för att uppnå en kollagenkoncentration av 1,75 mg / ml, och 1 x DMEM koncentration. Var noga med att hålla gel medium på is under detta steg.
    OBS: För att göra 6 ml gel medium, blanda väl 3,5 ml typ 1 kollagen gel (3 mg / ml), 1,5 ml 4 x koncentrerad DMEM, och 1 ml destillerat vatten.
  5. Resuspendera cellpelleten i 500 | il PBS och ta bort ett prov för cellräkning. Räknaantalet cellerna med användning av en hemocytometer med trypanblått fläcken för att kontrollera cellviabilitet.
  6. Lägga gelmediet för att justera de volymer för att uppnå en celldensitet på 3,0 x 10 5 celler / brunn (6,0 x 10 5 celler / ml) och försiktigt men snabbt blanda det genom att pipettera utan gelning.
  7. Dispensera 0,5 ml av blandningen i varje brunn i en 24-brunnars icke-behandlade plattan snabbt och noggrant för att göra ren cylindrisk form. Var noga med att inte tillåta några luftbubblor förorena gelerna (Figur 1A).
    Notera: Gelén medium innehållande cellerna är trögflytande och kan lätt gela och bilda croissant i brunnen.
  8. Inkubera plattan i 15 minuter i en cellinkubator vid 37 ° C, för att 5% CO2 och 95% fuktighet gel fullständigt.
  9. Lösgöra geler från plattan utan att bryta genom att flytta en steriliserad spatel på ett sätt för att dra en omkrets i en riktning. Användning av en spatel, försiktigt överföra gelema till 60 mm vävnadsodlingsskålarinnehållande 5 ml DMEM / 1% FBS med eller utan TGF-β1 (5 ng / ml) och TNF-α (10 ng / ml).
  10. Skaka försiktigt rätter att säkerställa geler flyter på mediet. Inkubera i en cell-inkubator vid 37 ° C, 5% CO2 och 95% fuktighet.

5. Mätning av Gel Storlek

  1. Mäta kollagengelen storlek efter 0, 24, 48, och 72 timmar med användning av ett bildanalyssystem.
    1. Slå på gelén dokumentationssystemet (figur 2A), och sätta diskgodset i det Ijusavskärmande skåpet. Därefter ta av locket på rätter i skåpet.
    2. Öppna motsvarande gel analysprogram. Klicka på "bildtagning knappen" i menylisten för att visa bilden av geler i skåpet. Klicka sedan på "förvärva" i menyraden för att ta bilder av geler (figur 2B).
    3. Klicka på "-knappen detection" i menyraden (figur 2C) och justera mätområdet (gul cirkel iI figur 2C) genom att dra musen. Klicka sedan på "auto-detect knappen" i menyraden (se knappen i figur 2D). Programvaran upptäcker automatiskt gelerna visar en heatmap (figur 2D).
    4. Klicka på "OK" för att extrahera konturerna av gelerna med bildbehandling och beräkna områden omgivna av konturen (figur 2E). Efter området beräknas, är det beräknade området visas i separat popup-fönster.
      Obs: Om gelerna överlappar varandra under avbildning, flytta geler försiktigt med en steril pipettspets.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Under EMT, epitelceller förlorar epitelceller markörer, som E-cadherin, och få ett uttryck för mesenkymala markörer, såsom vimentin och α-glatt muskulatur aktin 4,5. Inkubering av A549 humana lungepitelceller med TGF-β1 och TNF-α inducerar EMT. Utseendet på normala A549-celler är kullersten liknande form och triangel form som är en egenskap hos epitelceller (figur 3A), men efter stimulerades med TGF-β1 och TNF-α, ändras utseendet till lång spindelform som liknar mesenkymala celler (figur 3B).

Uttrycket av epiteliala och mesenkymala markörer utvärderades för att bekräfta att celler genomgick EMT. Relativ mRNA-expression beräknades med ΔΔCt metod. Individuella uppgifter normaliserades mot glyceraldehyd-3-fosfatdehydrogenas (GAPDH) som är en hushållning gen. A549-celler som behandlats med TGF-β1 och TNF-α under 48 timmar hade signifikant reducerad expression av CDH1 och avsevärt ökat uttryck av VIM och ACTA2 (Figur 4A). Primrarna sekvenser som används för q-PCR visas i tabell 1. Såsom visas i figur 4B, stimulering med TGF-β1 och TNF-α försvagad E-cadherin expression, medan uttrycket av vimentin, N-cadherin, och α-glattmuskelaktin inducerades.

Gelén kontraktion analys utfördes för att utvärdera kontraktilitet av celler som genomgick EMT. Efter inducering av EMT med TGF-β1 och TNF-α ades cellerna kastas i kollagengelen och inkuberades under 72 h i medium innehållande TGF-β1 och TNF-α, eller PBS. Såsom visas i fig 5A, de geler innehållande celler behandlade med TGF-β1 och TNF-α var mindre än kontroll geler innehållande celler behandlade med PBS. att quantify förändringarna i gel storlek gelerna analyserades med användning av en gel-analysator 0, 24, 48, och 72 timmar efter behandling. Efter 72 timmar, storleken på geler innehållande celler behandlade med TGF-β1 och TNF-α reducerades signifikant jämfört med kontroll geler (figur 5B). Vi bekräftade också att geler innehållande celler behandlade med TGF-β1 enbart var mindre än kontroll geler men var inte mindre än gelerna behandlade med TGF-β1 och TNF-α (data visas ej).

Figur 1
Figur 1. Den extra siffra för att göra geler. Dessa bilder visar gelerna gjutna i brunnar. Gelmediet innehållande cellerna är trögflytande och kan lätt gela och bilda croissant i brunnen. (A) Den vänstra bilden visar att gelerna är gjutna korrekt, och den högra bilden visar schemat för "ren cylindrisk form". (B </ Strong>) Den vänstra bilden visar att gelerna deformeras, och den högra bilden visar att luftbubblor förorena gelerna. (C) De geler är mjuka, så lätt skadas och oftast deformeras som "Pac-Man". Klicka här för att se en större version av denna siffra.

figur 2
Figur 2. Stegen för att mäta den Gel storlek. (A) gel dokumentationssystemet består av en dator och en gel avbildningssystem. (B) Den "bildupptagning knappen", och en bild av gelerna. (C) Den "knappen upptäckt", och fönstret för att justera mätområdet (gul cirkel). (D) Den "-knappen automatisk detektering", och programmet gör en heatmap av gelerna från en bild till De tect konturerna av gelerna. (E) Programmet extraherar konturerna av gelerna genom bildbehandling, och beräknar områden omgivna av konturen. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. morfologier EMT-inducerade celler. A549 humana lung epitel ströks ut med en täthet av 1,0 x 10 5 celler / brunn i en 6-brunnsplatta och inkuberades med eller utan 5 ng / ml TGF-β1 och 10 ng / ml TNF-α under 48 timmar, följt av faskontrast mikroskopisk avbildning. (A) och (B) är bilder som erhållits under × 200. Skalans streck i (A) och (B), 100 | j, m. t = "_ blank"> Klicka här för att se en större version av denna siffra.

figur 4
Figur 4. EMT Stimulering med TGF-β1 och TNF-α. (A) QRT-PCR-analys av EMT markör uttryck (CDH1, VIM och ACTA2). (B) Western blöt som visar uttrycket av E-cadherin, N-cadherin, vimentin, och ai glattmuskelaktin proteiner i A549-celler som stimulerats med eller utan TGF-β1 och TNF-α. α-tubulin användes som intern kontroll. A549-celler odlades som i figur 1. N = 3 oberoende experiment. ** P <0,01; felstaplar representerar SEM. Klicka här för att se en större version av denna siffra.

iles / ftp_upload / 53974 / 53974fig5.jpg "/>
Figur 5. celler som genomgår EMT förvärvade kontraktilitet. A549-celler ströks ut med en täthet av 1,0 x 10 6 celler / skål i 10 cm skålar och inkuberades med eller utan 5 ng / ml TGF-β1 och 10 ng / ml TNF-α under 48 timmar. Cellerna överfördes sedan gjuts i 500 | il medium innehållande 1,75 mg / ml kollagengel vid en densitet av 3,0 x 10 5 celler / brunn i en 24-brunnsplatta. Efter gelbildning, de sattes till medium med eller utan 5 ng / ml TGF-β1 och 10 ng / ml TNF-α i 60 mm skålar och inkuberades under 72 h följt av avbildning (A). Gel storlekar mättes efter 0, 24, 48, och 72 timmar med användning av ett bildanalyssystem. N = 9 oberoende experiment (B). ** P <0,01; felstaplar representerar SEM. Klicka här för att se en större version av denna siffra.

Gene Namn Framåt 5 '→ 3' Omvänd 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
VIM GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tabell 1. primersekvenser. Primersekvenser som används för QRT-PCR. GAPDH användes som intern kontroll.

Lysis Buffer: RIPA-buffert
20 mM Tris-HCl pH 7,5
150 mM NaCl
1 mM EDTA
1% Polyoxietylen (9) octyiphenyl eter
0,1% Na-deoxicholat
0,1% SDS
blockerings~~POS=TRUNC buffert~~POS=HEADCOMP
1% blockeringsreagens i tvättbuffert
Tvättbuffert: TBST-buffert
NaCl 45 g
1 M Tris pH 7,4 50 ml
Polyoxietylen (20) sorbitanmonolaurat 2,5 ml
Distill vatten lägg till 5 L
5 L

Tabell 2. Komponenter i buffertar som användes. Komponenterna i lys, blockerande buffert och tvättbuffert.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det protokoll som utvecklats i denna studie består av två steg. Det första steget utförs för att inducera EMT, medan det andra steget är den gelkontraktion analysen. Eftersom det är viktigt att bekräfta att celler genomgick EMT, steg 2 ger ett utmärkt komplement till de morfologiska och genuttryck förändringar. Tidigare studier har visat att EMT av A549-celler inducerades med endast 24 TGF-β1; Men, som vi tidigare 10 har rapporterats förstärker TNF-α behandling EMT och förvärvet av mesenkymala cellmarkörer. Det är tänkt att mekanismerna för TGF-β-medierad EMT är SMAD beroende 25. TNFa ökar TGF-β1-inducerad EMT som leder till förbättring av gel kontraktion. Det har rapporterats att mekanismerna för TNFa för förbättring av TGF-β1-inducerad EMT är inte bara fosforylering av Smad2 linkerregion, men också MAPK signalerings reglering 26. Därför protokoll som utvecklats i denna studie ingår stimulation av både TGF-β1 och TNF-α.

Inbäddning av celler som genomgick EMT in i typ I kollagen-gel, och som flyter på mediet, är centrala aspekter av denna analys (steg 4). Eftersom gelerna är mjuka och skadas lätt, och har olika dimensioner på varje sida, är extrem försiktighet krävs vid tillämpningen gelerna till mediet och mäta deras storlek. Om det är svårt att utföra detta steg, finns det en alternativ metod för att mäta gel storlekar i brunnen utan att flytta gelerna i 60 mm skål 27,28. Det finns flera vanliga problem, är det första problemet att de kollagengeler lätt gelatineras vid RT, så gelerna deformeras ofta som nämns i steg 4,7. Därför måste plattan försiktigt skakas efter gjutningen av gelerna i brunnar för att se till att de tar på ett snyggt cylindrisk form. Det andra problemet är att om några luftbubblor in i gelerna under gelning, då storleken på gelerna kommer att vara ojämn. Var försiktig så att tillåta någon luft bubbles kontaminera gelerna. Det finns två huvudsakliga skillnader mellan ursprungliga metoden och denna metod. De första skillnader är att den slutliga koncentrationen av kollagen-geler av ursprungliga metoden är 0,75 mg / ml, men att med denna metod är 1,75 mg / ml i syfte att möjliggöra de geler att dra ihop sig mer än vad de gör med den ursprungliga metoden. De andra skillnaderna är att den ursprungliga metoden använder serumfritt medium för gelén flytande medium, men denna metod använder en% FBS i gelén flytande mediet för att hålla cellviabilitet och bibehålla cell kontraktilitet.

Gelén kontraktion assay utvecklades ursprungligen för fibroblaster är en idealisk in vitro-modell för utvärdering av kontraktiliteten av celler som bidrar till processen för sårläkning och fibros 13. Fastsättningen av fibroblaster till typ 1 kollagen är tänkt att producera mekaniska spänningar som följaktligen leder till en reduktion av storleken av de kollagengeler. Dessutom har denna analys nyligen använtssom en modell in vitro för att studera sammandragning av luftvägsceller i inflammatoriska sjukdomar, inklusive astma och KOL 29-31.

Gelen kontraktion analysen är jämförbar med andra analyser, såsom cellmigrationsanalyser, eftersom det inte kräver några särskilda enheter och uppvisar hög kvantitativ reproducerbarhet. Det finns dock några rapporter tillämpar gelkontraktion analys för att utvärdera EMT 32. I denna studie, geler innehållande celler som genomgick EMT minskat betydligt i storlek 24-72 timmar efter gelning, vilket tyder på cell kontraktion. Det finns emellertid begränsningar för denna metod. Den första är att i denna analys, storleksändringen av gelerna visar summan av kontraktiliteten hos alla celler i gelerna. Emellertid är det svårt att utvärdera enda cell kontraktilitet i gelerna med användning av denna analys. Den andra är att A549-celler är en cancer-cellinje, som inte är normala humana epitelceller. Därför är det svårt att extrapolera our resultat direkt till patogenesen av lungfibros. Men A549-celler används i stor utsträckning för att studera funktionerna hos epitelceller i luftvägarna, och flera studier gav belägg för EMT med A549-celler som en modell av lungfibros 33,34.

Sammanfattningsvis typ I-kollagen geler innehållande mesenkymala celler som genomgick EMT reducerades i storlek, vilket indikerar sammandragning av dessa celler. Sålunda bör gelkontraktion analysen betraktas som en förlängd in vitro-analys för att utvärdera förvärv av kontraktil funktion i cellerna genom EMT process.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inga intressekonflikter att lämna ut.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Utveckling av en<em&gt; In Vitro</em&gt; Analys för att utvärdera kontraktila funktion av mesenkymala celler som genomgick Epithelial-Mesenkymala Övergångs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter