Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Bir Gelişimi doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fibroz, interstisyel akciğer hastalığı, kardiyak fibroz, karaciğer sirozu, böbrek yetmezliği, terminal, sistemik skleroz, otoimmün hastalık 1 gibi çeşitli kronik progresif hastalıkların patogenezinde rol oynamaktadır. interstisyel akciğer hastalıkları arasında, idiyopatik pulmoner fibrozis (IPF) kronik ilerleyici bir hastalıktır ve kötü prognozu gösterir. IPF patolojik bulgusudur prognoz ile ilişkili olduğu aktive fibroblast ve miyofibroblastlar oluşan fibroblastik odaklar geliştirilmesidir. Bu tür akciğer fibroblast kökenleri aslen ikamet akciğer fibroblastlar dahil olmak üzere ve kemik iliği fibrositlerden dolaşan birkaç mezenkimal hücrelerden, elde edilecek önerilmektedir. Son zamanlarda, epitelyal mezenkimal geçişi (EMT) mezenkimal hücreler 2 oluşumu ile ilişkili olduğu öne sürülmüştür ve fibrotik hastalıkların patogenezine katkıda bulunmak.

Bu düşünülmektedir EMT tümör invazyonu ve metastaz 3 olmak üzere fetal gelişim sürecinde önemli roller, yara iyileşmesi ve kanserin ilerlemesini, oynar. EMT süreci takiben, epitel hücreler, E-kadherin gibi epitelyal belirteçleri kaybıyla mezenkimal hücrelerin yeteneği elde etmek ve örneğin vimentin gibi mezenşimal belirteçleri ve α-düz kas aktini (SMA) 4,5 ekspresyonuyla. Önceki çalışmalar EMT süreç böbrek 6 ve akciğer 7 doku fibrozis gelişimi ile ilişkili olduğunu kanıt gösterdi. Ayrıca, kronik inflamasyon fibrotik hastalığı 8 teşvik; Bundan başka, tümör nekroz faktörü üst aile üyesini 14 (TNFSF14; LIGHT) gibi enflamatuar sitokinler, tümör nekroz faktörü (TNF) -a ve interlökin-1, EMT 9-12 geliştirmek için gösterilmiştir.

Kollajen jel daralma tahlili, fibroblastlar tip I gömülü olduğu bir kollajen bazlı hücre kasılması deneyikolajen jeli üç boyutlu, kontraktilite değerlendirilmesi için in vitro model bir idealdir. Kontraktilite fibroblast karakteristik işlevlerinden biridir ve normal yara onarımı ve fibrozis 13 katkıda bulunur. Bu deneyde, fibroblast ek bazı koşullar altında, mekanik gerilim üretilmesi için gereken I integrin bağlantılı mekanizmalar vasıtasıyla kolajen tip, ve bunun sonucu olarak doku daralmaya yol düşünülmektedir.

Burada, jel daralma deneyinin geliştirilmesi EMT yapılan hücrelerde kontraktil fonksiyonun satın değerlendirmek üzere uyarlanmış olduğu bildirilmektedir. Bu raporda, bu modifiye edilmiş deney EMT uygulanan mezenkimal hücreler kontraktiliteııin değerlendirilmesi için uygun olduğunu göstermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Hazırlıklar ve Kültür Akciğer Epitel Hücreleri

  1. Dulbecco Modifiye Edilmiş Eagle Ortamı (DMEM) içinde kültür A549 insan akciğer epitel hücreleri (yapışık hücre çizgisi), 100 ug / ml streptomisin ve% 10 fetal sığır serumu (FBS), 100 lU / ml penisilin, ve.
  2. Çıkarın ve Kültür bir tabaktan alınan hücre kültürü ortamı atmak ve 5 ile bir kez yıkayın - fosfat tamponlu tuzlu su, 10 ml (PBS). Yıkandıktan sonra, hemen PBS aspire.
  3. 3 dakika boyunca CO2 2 ml tripsin / etilendiamintetraasetik asit (EDTA) (% 0.05) ilave edin ve 37 ° C'de inkübe ve% 5.
  4. Hücre kültürü ortamı, santrifüj 150 x g'de 4 dakika boyunca oda sıcaklığında tüpler ihtiva eden santrifüj tüplerine müstakil hücreleri toplamak.
  5. hücreler, hücre kültür ortamının 2 ml pelet ve hücre sayımı için bir örnek çıkarın. hücre canlılığı kontrol etmek için Tripan mavi leke hemasitometre kullanarak hücrelerin sayısını.
  6. Tohum A549 hücreleri0.5 bir yoğunlukta en az 10 cm polistiren plakaları - jel daralma deneyi için ortam, 10 ml 1.0 x 10 6 hücre / çanak. 0.5 yoğunluğunda 6 oyuklu polistiren plâkalar üzerine hücreleri Tohum - 1.0 x 10 5 hücre / göz ile EMT onay orta 2 mi. 24 saat boyunca CO2 37 ° C'de inkübe hücreleri ve% 5.

2. EMT Prosedürü

  1. Aşama 1.6 tohumlandı jel daralma deneyi için plakaya TGF-ß1 (5 ug / ml) 10 ul ve TNF-a, 10 ul (10 ug / ml) eklenir. Aşama 1.6 tohumlandı EMT onay plakasına TGF-ß1 (5 ug / ml) 2 ul ve TNF-a 2 ul (10 ug / ml) eklenir. 48 saat boyunca CO2 37 ° C'de inkübe edilir ve% 5.

PCR ve Western Blot ile EMT Usul 3. Onay

  1. Faz kontrast mikroskopi kullanılarak tedavi hücrelerin (şekil mili için çakıl taşı gibi itibaren) morfoloji değişikliği onaylayın.
    Not: Normark A549 hücreleri, epitel hücreleri bir özelliğidir çakıl taşı gibi ve üçgen şekilli bir görünüşe sahip, ancak, TGF-ß1 ve TNF-a ile uyarılmasından sonra hücreler uzun görünür ve mil bu mezenkimal hücreler 14,15 benzer şekilli.
  2. Bu E-kadherin gibi bir epitel işaretleyici ekspresyonunu değerlendirmek ve PCR ve Batı lekeleme ile örneğin N-kaderin, vimentin ve α-düz kas aktin gibi mezenşimal belirteçleri.
    1. RNA özütleme kiti 16 ile hücrelerden toplam RNA ekstrakte edin ve üreticinin protokolüne uygun olarak, ters transkriptaz 17 kullanarak cDNA sentezlemek.
    2. Gerçek zamanlı PCR sistemi 18 ve üreticilerin talimatlarına göre monomerik siyanin boyası PCR kiti kullanılarak mRNA seviyelerinin ifadesini ölçün. GAPDH için spesifik primerler (gliseraldehid 3-fosfat dehidrojenaz), ACTA2 (alfa-aktin-2), CDH1 (kaderin-1; E-kadherin) ve VIM (vimentin), Tablo 1 'de gösterilmiştir
    3. Lyse bir parçalama tamponu (Tablo 2)% 1 proteaz önleyici kokteyl içeren çözelti ile hücreleri. Bir protein tahlil kiti 19,20 kullanarak tüm numune protein konsantrasyonlarını ölçmek ve bir poliakrilamid jel protein aynı miktarda uygulanır.
      1. SDS jel-elektroforez ve PVDF membranı 21 proteinlerin yarı-kuru transferi gerçekleştirin. 2 saat 1 - blokaj tamponunda primer antikorlar ile membran inkübe edin. İnkübasyondan sonra yıkama tamponu ile iki defa zarın yıkanması ve ikinci antikor ile membran 1 saat inkübe edilir.
        Not: Bu çalışmalarda kullanılan antikorlar ve seyreltileri malzemeleri / donatım tabloya bakınız. Bloke edici tampon bileşenleri için Tablo 2'ye bakınız.
      2. iki kez yıkama tamponu ile membran yıkayın. Soğuk CCD kamera 11,23 kullanarak Western lekeleme tespit kiti 22 ile membran fotoğraf çekmek.

4. Değerlendirilmesi EMT için Jel Daralma Deneyi

  1. Hücre kültürü kabından koşullu ortam aspire ve 5 ile iyice yıkayın - ölü hücreleri çıkarmak için 10 ml PBS. Yıkandıktan sonra, hemen PBS aspire.
  2. 3 dakika boyunca CO2,% 0.05 tripsin / EDTA 2 ml ilave edilir ve 37 ° C'de inkübe ve% 5.
  3. DMEM 150 x g'de 4 dakika boyunca oda sıcaklığında tripsin inhibitörü (1 mg / ml), santrifüj tüpleri ile takviye içeren santrifüj tüplerine müstakil hücreleri toplamak.
  4. damıtılmış su olan tip 1 kollajen jel karıştırın ve DMEM konsantre edildi 4 x 1.75 mg / ml'lik bir konsantrasyon elde etmek için kolajen seviyesini ayarlamak için ve 1 x DMEM konsantrasyonu. Bu adımı sırasında buz üzerinde jel ortamı tutmak için emin olun.
    Not: Jel ortamı 6 mi yapmak için, iyi 3.5 mi tip 1 kollajen jel (3 mg / ml) 1.5 ila 4 x konsantre edildi mL DMEM ve 1 ml damıtılmış su karıştırılır.
  5. 500 ul PBS hücre pelletini ve hücre sayımı için bir örnek çıkarın. OrtakTripan mavi boyası ile bir hemositometre kullanılarak hücre sayısı, hücre canlılığı ile kontrol edin.
  6. Yavaşça, bir hücre 3.0 x 10 5 hücre yoğunluğu / oyuk (6.0 x 10 5 hücre / ml) ve elde ancak hızla jelleşme olmadan pipetleme ile karıştırarak seviyesini ayarlamak için jel orta ekleyin.
  7. düzgün silindir biçiminde yapmak için hızlı ve dikkatli bir şekilde 24 oyuklu işlenmemiş plakanın her oyuğuna 0.5 ml koyun. Herhangi bir hava kabarcıkları jeller (Şekil 1A) kirletmesine izin vermemek için dikkatli olun.
    hücreleri içeren jel orta viskoz ve kolayca kuyuda jel ve form hilal şekli olabilir: Not.
  8. 37 ° C'de bir hücre kuluçka makinesi içinde, 15 dakika boyunca inkübasyona bırakılır,% 5 CO2 ve% 95 nem, tamamen jel.
  9. Bir yönde bir çevresi çekmek için bir şekilde sterilize edilmiş bir spatula taşıyarak bozmadan plaka jeller ayırın. Bir spatula kullanarak, yavaşça 60 mm doku kültürü yemekleri jeller aktarmakya da TGF-ß1 (5 ng / ml) ve TNF-a (10 ng / ml) olmadan DMEM /% 1 FBS, 5 ml ihtiva etmektedir.
  10. Yavaşça jeller ortamda yüzen sağlamak için yemekler sallayın. 37 ° C'de,% 5 CO2 ve% 95 nemde bir hücre kuluçka makinesi içinde inkübe edin.

Jel Boyutu 5. Ölçüm

  1. bir görüntü analiz sistemi kullanılarak, 0, 24, 48, ve 72 saat sonra kolajen jel boyutu ölçülür.
    1. Jel dokümantasyon sistemi (Şekil 2A) açın ve ışık geçirmeyen bir kabinin içine yemekler koymak. Sonra kabine yemeklerin kapağını çıkarmak.
    2. İlgili jel analiz yazılımı açın. kabine jellerin görüntü göstermek için menü çubuğunda "görüntü elde etme lütfen" tıklayın. Sonra, jeller (Şekil 2B) fotoğraf çekmek için menü çubuğunda "acquire" tıklayın.
    3. Ölçüm bölgesini menü çubuğunda (Şekil 2C) "algılama düğmesini" tıklayın ve ayarlamak (sarı daire ifareyi sürükleyerek n Şekil 2C). Ardından, menü çubuğunda "otomatik algılama düğmesi" (Şekil 2B düğmesini bakınız). Yazılım otomatik olarak bir ısı haritası (Şekil 2B) gösteren jeller algılar.
    4. Görüntü işleme ile jellerin taslağını çıkarmak ve anahat (Şekil 2E) ile çevrili alanlar hesaplamak için "Tamam" a tıklayın. Alan hesaplandıktan sonra, hesaplanan alan ayrı bir pop-up penceresi görüntülenir.
      Not: jeller görüntüleme sırasında birbirleriyle örtüşen, hafifçe steril bir pipet kullanarak jeller taşıyın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EMT sırasında, epitel hücreleri E-kaderin gibi epitel belirteçleri, kaybetmek ve bu vimentin ve α-düz kas 4,5 aktin olarak mezenkimal belirteçler, ifadesini kazanır. TGF-ß1 ve TNF-a ile A549 insan akciğer epitel hücrelerine inkübasyonu EMT indükler. Normal A549 hücrelerinin görünümü epitel hücreleri (Şekil 3A) bir özelliğidir şekil ve üçgen şekli gibi çakıl taşı, ancak, TGF-ß1 ve TNF-a ile uyarılmış sonra görünümü mezenşimal benzer uzun bir mil bir biçime hücreleri (Şekil 3B).

epitelyal ve mezenkimal belirteçlerinin ifade hücreleri EMT uygulanan onaylamak için değerlendirilmiştir. Bağıl mRNA ekspresyon ΔΔCt yöntemi ile hesaplanmıştır. Bireysel veri oda temizliği g gliseraldehid-3-fosfat dehidrojenaz (GAPDH) karşı normalize edildien. TGF-ß1 ve 48 saat süre ile, TNF-a ile tedavi edilen A549 hücreleri önemli ölçüde CDH1 ekspresyonunu azaltmış ve önemli ölçüde VIM ve ACTA2 (Şekil 4A) ekspresyonunu artmıştır. Q-PCR için kullanılan primerler, sekansları Tablo 1 'de gösterilmiştir. Vimentin, N-kadherin ve α-düz kas aktini sentezlenmesi ise, Şekil 4B'de, TGF-ß1 ve TNF-α zayıflatılmış E-kadherin ekspresyonu ile uyarılmasında gösterildiği gibi oluşturuldu.

Jel daralma tahlil EMT uygulanan hücrelerin kasılma değerlendirmek amacıyla yapılmıştır. TGF-ß1 ve TNF-a ile uyarılması EMT sonra, hücreler kolajen jel içine dökülmüştür ve TGF-ß1 ve TNF-a ya da PBS içeren ortamda 72 saat için kuluçkalanmıştır. Şekil 5A'da gösterildiği gibi, TGF-ß1 ve TNF-a ile tedavi edilen hücreleri ihtiva eden j eller, PBS ile muamele edilmiş hücreleri ihtiva eden kontrol jeller daha düşüktü. Adugit içinJel boyutunda değişiklik ntify, jeller, bir jel analizörü, 0, 24, 48, ve tedaviden 72 saat kullanılarak analiz edilmiştir. 72 saat sonra, TGF-ß1 ve TNF-a ile tedavi edilen hücreler ihtiva eden jellerin boyutları önemli ölçüde kontrol jeller (Şekil 5B) ile karşılaştırıldığında azaltılmıştır. Ayrıca TGF-ß1 ile muamele hücreleri ihtiva eden j eller, tek başına kontrol jeller daha küçük ama (veriler gösterilmemiştir), TGF-ß1 ve TNF-a ile tedavi edilen jeller daha küçük olmayan olduğunu gösterdi.

Şekil 1
Şekil 1. Jeller yapmak için Ek Şekil. Bu görüntüler kuyulara dökme jeller göstermektedir. hücreleri içeren jel orta viskoz ve kolayca jel ve kuyu form hilal şekli olabilir. (A) sol görüntü jeller doğru döküm olduğunu gösterir ve sağ görüntü "temiz silindirik formda" şemasını göstermektedir. (B </ Strong>) sol görüntü jeller deforme olduğunu gösterir ve sağ görüntü hava kabarcıkları jeller kontamine olduğunu göstermektedir. (C) jeller, kolayca zarar yumuşak ve genellikle "Pac-Man" gibi deforme. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

şekil 2
Jel Boyutu Ölçüm Şekil 2. Adımlar. (A) jel dokümantasyon sistemi PC ve bir jel görüntüleme sistemi oluşur. (B) "görüntü elde etme düğmesi", ve jellerin bir resim. (C) "algılama düğmesi", ve ölçüm bölgeyi (sarı daire) ayarlamak için bir pencere. (D) "otomatik algılama düğmesi", ve yazılım de bir resimden jeller bir ısı haritası yapar jellerin anahat cuğunuz. (E) yazılım görüntü işleme ile jellerin taslağını ayıklar ve anahat çevrili alanlar hesaplar. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3. EMT kaynaklı hücreler morfolojileri. A549 insan akciğer epitelyum / oyuk, 6 oyuklu plaka içinde 1.0 x 10 5 hücre yoğunluğunda kaplanmıştır ve veya 5 ng / ml TGF-ß1 ve 10 ng / ml olmadan kuluçkalanmıştır faz kontras mikroskopik görüntülemesi, ardından 48 saat boyunca, TNF-α. (A) ve (B) × 200 altında elde edilen görüntülerdir. Ölçeği (A) bar ve (B), 100 um. t = "_ blank"> bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 4,
Şekil 4. TGF-ß1 ve TNF-a ile EMT uyarılması. (A) EMT işaretleyici ifade (CDH1, VIM ve ACTA2) ve QRT-PCR analizi. (B) E-kaderin, N-kaderin, vimentin ekspresyonunu gösteren bir Western blot ve ya da TGF-ß1 ve TNF-a olmayan uyarılmış A549 hücrelerinde protein aktin düz kas a. α-tübülin iç kontrol olarak kullanıldı. A549 hücreleri, Şekil 1, N = 3 bağımsız deneyde olduğu gibi kültürlenmiştir. ** P <0.01; Hata çubukları SEM temsil etmektedir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

iles / ftp_upload / 53974 / 53974fig5.jpg "/>
5. Hücre Gören EMT Edinilen Kasılma Şekil. A549 hücreleri, 10 sm'lik çanaklar içinde 1.0 x 10 6 hücre / tabak yoğunluğunda plakalandı ve veya 5 ng / ml TGF-ß1 ve 48 saat boyunca 10 ng / ml TNF-a yokken kuluçkaya yatırılır. Hücreler daha sonra 24 oyuklu bir plaka içerisinde / oyuk 3.0 x 10 5 hücre yoğunluğunda 1.75 mg / ml kolajen jel içeren bir maddenin 500 ul içine dökülmüştür. Jel oluşumunun ardından, ya da 5 ng / ml TGF-ß1 ve 60 mm lik tabaklar içinde 10 ng / ml TNF-a olmayan ortam ilave edildi ve görüntüleme (A), ardından 72 saat süre ile inkübe edildi. Jel boyutları, bir görüntü analiz sistemi kullanılarak, 0, 24, 48, ve 72 saat sonra ölçüldü. N = 9 bağımsız deneyler (B). ** P <0.01; Hata çubukları SEM temsil etmektedir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

gen Adı İleri 5 '→ 3' 5 '→ 3' ters
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
VIM GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tablo 1. astar dizilerini sıralamaktadır. QRT-PCR için kullanılan astar dizilerini sıralamaktadır. GAPDH iç kontrol olarak kullanıldı.

Liziz Tamponu: RIPA tamponu
20 mM Tris-HCI pH 7.5
150 mM NaCI
1 mM EDTA
% 1 polioksietilen (9) octyiphenyl eter
% 0.1 Na-deoksikolat
% 0.1 SDS
Bloklama Tamponu
Yıkama tamponu içinde% 1 bloke edici ayıracı
Yıkama tamponu: TBST Tamponu
NaCI 45 g
1 M Tris pH 7.4 50 mi
Polioksietilen (20) sorbitan monolaurat 2.5 mi
distile su 5 L ekle
5 L'lik

Tablo 2. Kullanılan Tamponlar Bileşenleri. Lizis bileşenleri, engelleme tampon ve yıkama tamponu.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu çalışmada geliştirilen protokol iki adımları içerir. İlk adım, ikinci bir basamaklı bir jel tahlili daralma ise, EMT indüklemek için gerçekleştirilir. hücrelerin EMT uygulanan onaylamak için önemli olduğundan, adım 2 morfolojik ve gen ekspresyon değişiklikleri için mükemmel bir tamamlayıcı sağlar. Daha önceki çalışmalar, A549 hücrelerinin EMT, TGF-ß1 sadece 24 tarafından indüklendiğini göstermiştir; Daha önce 10 rapor ettiği gibi, ancak, TNF-α tedavisi EMT ve mezenkimal hücre belirteçleri kazanılması artırır. TGF-β-aracılı EMT mekanizmaları Smad bağımlı 25 olduğu düşünülmektedir. TNFa jel daralma arttırılmasına neden TGF-β1 kaynaklı EMT arttırır. TGF-β1 kaynaklı EMT arttırılması için TNFa mekanizmaları Smad2 bağlayıcı bölgenin tek fosforilasyonu olmadığı rapor edilmiştir, ama aynı zamanda düzenleme 26 MAPK sinyal. Bu nedenle, bu çalışmada geliştirilen protokol stimülasyon dahilTGF-ß1 ve TNF-a hem tirme.

I kolajen jel türü içine EMT uygulandı ve ortam üzerinde yüzen hücrelerin gömme, bu deneyde (aşama 4) merkez yönleri vardır. jeller, yumuşak ve kolayca zarar ve her iki tarafta farklı boyutlara sahip olduğundan orta jelleri uygulanması ve bunların boyutlarını ölçerken, son derece dikkatli gereklidir. Bu adımı yürütmek zor ise, 60 mm çanak 27,28 içine jeller hareket ettirmeden de jel boyutlarını ölçmek için alternatif bir yöntem yoktur. Birkaç ortak sorunlar vardır, ilk sorun adımı 4.7'de belirtildiği gibi jeller genellikle deforme böylece kolajen jeller kolayca oda sıcaklığında gelate olmasıdır. Bu nedenle, plaka nazikçe onlar düzgün silindirik formda almak emin olmak için kuyu içine jeller attıktan sonra çalkalanmalıdır. İkinci sorun herhangi bir hava kabarcıkları jelleşme sırasında jeller girerseniz, o zaman jellerin boyutu düzensiz olmasıdır. Herhangi bir hava Bubbl izin dikkatli olunes jelleri kirletmesine. Orijinal yöntem ve bu yöntemin arasındaki iki temel farklılıklar vardır. Orijinal yöntemin kolajen jellerin nihai konsantrasyon ml 0.75 mg / ancak bu yöntemin 1.75 mg / jeller orijinal yöntemle göre daha fazla büzülmesini sağlar amacıyla mi olduğunu ilk farklılıklardır. İkinci bir fark, orijinal bir yöntem jel kayan ortam serum içermeyen ortam kullanan, ancak bu yöntem, hücre daralmasını, hücre canlılığını korumak ve sürdürmek için jel yüzen ortam içinde% 1 FBS kullanır.

Orjinal olarak, fibroblastlar için geliştirilmiş jel daralma deney yara iyileşmesi ve fibrozis 13 sürecine katkıda bulunan hücrelerin kasılma değerlendirilmesi için in vitro model bir idealdir. 1 kollajen tip fibroblast bağlanma Sonuç olarak kollajen jel boyutunda bir azalmaya yol açar, mekanik gerilimleri üretilmesi için gerekiyordu. Buna ek olarak, bu deney en son kullanılmışbronşiyal astım ve KOAH 29-31 dahil olmak üzere inflamatuar hastalıklar, hava yolu hücrelerinin kasılma çalışmak için in vitro bir model olarak.

belirli cihazlar gerektirir ve yüksek sayısal sergileyen ve yok jel daralma tahlili, hücre göçü deneyleri gibi deneylerde, karşılaştırılabilir. Ancak, EMT 32 değerlendirmek için jel daralma tahlil uygulayarak az sayıda rapor vardır. Bu çalışmada, EMT uygulanan hücre içeren jeller önemli ölçüde hücre daralma gösteren jelleşme 72 saat sonra için 24 ila küçültülür. Bu yöntemin sınırlamalar ancak vardır. ilk olarak bu tahlilde, jeller boyutunu değiştirmek jeller tüm hücrelerin kasılma toplamını göstermektedir olmasıdır. Bununla birlikte, bu deneyde kullanılan jeller tek hücre kasılma değerlendirilmesi güçtür. İkinci A549 hücreleri, bir kanser hücresi hattı değil, normal insan epitelyal hücreler olmasıdır. Nedenle, O uyarlamak çok zordurdoğrudan pulmoner fibrozis patogenezinde ur sonuçları. Bununla birlikte, A549 hücreleri, yaygın olarak hava yolu epitel hücrelerin fonksiyonlarını incelemek için kullanılır ve çeşitli çalışmalar pulmoner fibroz 33,34 bir model olarak, A549 hücreleri kullanılarak EMT kanıtlarını vermiştir.

Özet olarak, Tip I EMT bu hücrelerin kasılma gösterir boyutu azalmıştır uygulanan mezenkimal hücreler ihtiva eden jeller hücre oranında yerleştirilmiştir. Sonuç olarak, jelleşme daralma deney EMT sürecinde hücrelerde kontraktil fonksiyonun satın değerlendirmek için in vitro olarak genişletilmiş deneyi olarak kabul edilmelidir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa etmek herhangi bir çıkar çatışmaları var.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Bir Gelişimi<em&gt; İn Vitro</em&gt; Deney Mezenkimal Hücreleri Uyguladığımız Epitel-Mezenkimal Geçiş kasılma Fonksiyonu değerlendirin
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter