Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

قياس ل doi: 10.3791/54581 Published: February 22, 2017

Abstract

البروتينات HIV-1 مغلف الانخراط مستقبلات المشابهة على سطح الخلية المستهدفة، الأمر الذي يؤدي إلى الخلية الفيروسية الانصهار غشاء يليها الافراج عن جوهر قفيصة الفيروسية (CA) في السيتوبلازم. وفي وقت لاحق، والناسخ العكسي الفيروسي (RT)، كجزء من تحمل الاسم نفسه البروتين النووي مجمع يسمى النسخ العكسي مجمع (RTC)، يحول الفيروسي RNA الجينوم واحد الذين تقطعت بهم السبل في نسخة الحمض النووي المزدوج تقطعت بهم السبل (vDNA). وهذا يؤدي إلى نشوء حيوي من مجمع البروتين النووي أخرى، ووصف المجمع قبل التكامل (PIC)، ويتألف من vDNA والبروتينات فيروس المرتبطة بها والعوامل المضيفة. وإنزيم مدمج الفيروسي المرتبطة الموافقة المسبقة عن علم (IN) ينسق دمج vDNA في الحمض النووي الصبغي المضيفة في عملية من خطوتين ينظم زمنيا ومكانيا. أولا، في عمليات ينتهي 3 'من vDNA في السيتوبلازم، وثانيا، بعد بالاتجار الموافقة المسبقة عن علم إلى النواة، فإنه يتوسط دمج vDNA معالجتها في الحمض النووي الصبغي. بلدان جزر المحيط الهادئ معزولةمن الخلايا المستهدفة المصابة تماما مع HIV-1 وظيفية في المختبر، كما أنها مؤهلة لدمج vDNA يرتبط إلى الحمض النووي الهدف مغاير وأضاف خارجيا. وقد ساهمت في فحوصات المختبر التكامل هذه على أساس الموافقة المسبقة عن علم كبير لترسيم تفاصيل الآلية التكامل للفيروسات، وإلى اكتشاف في مثبطات. في هذا التقرير، إلا أننا الإفاضة محدث HIV-1 فحص الموافقة المسبقة عن علم أن يوظف استراتيجية تستند في عملها متداخلة في الوقت الحقيقي البلمرة الكمية سلسلة من ردود الفعل (QPCR) لقياس النشاط في المختبر التكامل بين بلدان جزر المحيط الهادئ الأم معزولة.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1 تكرارها في الخلية المستهدفة ينطوي على خطوات متعددة، مجمعة على نطاق واسع إلى مرحلتين: الأحداث المبكرة والمتأخرة. تبدأ الأحداث في وقت مبكر عندما يتحد HIV-1 بالتتابع لمستقبلات سطح الخلية المستهدفة CD4 واحد من اثنين شارك في مستقبلات (CCR5 أو CXCR4) 1. وبالتالي، فإن الأغشية فتيل الفيروس الخلية، وقفيصة الفيروسية يتم تحريرها (CA) الأساسية في سيتوبلازم 2. يحتوي لب CA الحمض النووي الريبي الفيروسي الجيني واحد الذين تقطعت بهم السبل (ssRNA) والعديد من البروتينات، سواء الفيروسية والخلوية في الأصل. وتشمل البروتينات الفيروسية المرتبطة CA الناسخ العكسي (RT) وإنزيم مدمج (IN)، اثنين من الانزيمات التي تتوسط خطوات حاسمة خلال الأحداث في وقت مبكر في تكاثر الفيروس. وRT وفي وظيفة في إطار مجمعات البروتين النووي، وهي عكس النسخ مجمع (RTC) ومجمع ما قبل الاندماج (PIC)، على التوالي 5 <سوب>، 6. نهايات الفيروسي ssRNA الجينوم محطة ميناء تكرار (R) عناصر المتاخمة للتسلسل U5 فريد (في 5 'النهاية) و U3 (في 3' نهاية). وRTC يحول الجينوم الفيروسي ssRNA إلى المزدوج تقطعت بهم السبل (س) والحمض النووي نسخة (vDNA). النتائج هذه العملية النسخ العكسي أيضا في ازدواجية U5 وU3 متواليات، وبالتالي توليد يكرر محطة الطويلة (LTR) في كلا طرفي vDNA 7 و 8. وفي وقت لاحق، وفي المصاحب الموافقة المسبقة عن علم يحفز اثنين من التفاعلات الكيميائية الحيوية متسلسلة التي تمكن من دمج vDNA في كروموسوم المضيف 9 و 10 و 11. أولا، في السيتوبلازم، في multimers إشراك كلا لتر 12 و يلتصق على ثنائي النوكليوتيد من كل من طرفي 3'-الطرفية. هذه المعالجة 3'نهاية يولد مجموعة الهيدروكسيل في كل نهاية 3'(CA OH) من vDNA.بعد ذلك، الموافقة المسبقة عن علم بالاتجار إلى النواة، حيث يستخدم في vDNA CA OH كما نيوكليوفيل لخفض كل من خيوط من الحمض النووي الصبغي بطريقة متداخلة. في وقت واحد، في التوصيلات coordinately طرفي vDNA لينتج عن ذلك من السندات phosphodiester على مسارات المقابل من الحمض النووي الصبغي. وبعد هذه الخطوة نقل حبلا، آلية الخلية المضيفة يزيل اثنين من النيوكليوتيدات المفردة في نهايات 5 'من vDNA وإصلاح الثغرات واحدة الذين تقطعت بهم السبل التي تلت ذلك عند تقاطع للموقع التكامل. وبالتالي بداية أحداث ذروتها مع إنشاء نسخة الحمض النووي المتكاملة (طليعة الفيروس) للجينوم HIV-1. تقدم طليعة الفيروس بيئة مناسبة للتعبير الجين الفيروسي كفاءة، الذي يبدأ أحداث لاحقة، بما في ذلك التعبير من البروتينات المشفرة فيروس. التجمع من الفيروس غير ناضجة. ومهدها، وإطلاق سراح، والنضج في virions المعدية (13).

المنقى المؤتلف في فيروسات هو المختص لتنفيذ، في المختبر، كلا تجهيز ونقل حبلا الأنشطة 3'نهاية يوم خارجيا تزويد LTR مثل الركيزة الحمض النووي. وقد كشفت الدراسات البيوكيميائية باستخدام هذا في المؤتلف النقي الجوانب الهامة من vDNA التكامل 14، 15، 16، 17. ومع ذلك، خلافا لما حدث في العدوى الطبيعية، وهذا في المختبر رد فعل كيميائي حيوي لا يدعم التكامل متضافرة من طرفي DNA الركيزة في الحمض النووي الهدف. في المقابل، بلدان جزر المحيط الهادئ فيروسات المعزولة من الخلايا المصابة تماما تدمج بشكل منسق طرفي vDNA الذاتية إلى مغاير DNA الهدف. وأدى ذلك إلى اعتماد واسع النطاق والتحسينات اللاحقة من أنا ن المختبر التكامل (IVI) فحوصات باستخدام بلدان جزر المحيط الهادئ الأم معزولة.

في أول ذكرت فيروسات IVI فحص وعصائر هيولية من الخلايا المصابة مع الفئران المؤتلففيروس ابيضاض الدم (MLV) ايواء الجين كولاي supF في LTR لها بمثابة مصدر النشاط في، والحمض النووي لفج امدا متحولة تم تزويد خلل في النمو التحللي خارجيا كما الحمض النووي الهدف. التكامل الناجح لالمؤتلف MLV الحمض النووي نسخ في الحمض النووي فج وأدى التعبير التي تلت ذلك supF لاستعادة القدرة على تشكيل اللوحة التذكارية للفاجات المؤتلف. ومع ذلك، فإن هذه الاستراتيجية التجريبية هو التكامل شاقة والتدابير بطريقة غير مباشرة. لمعالجة مثل هذه المحاذير، وضعت على أساس صمة عار الجنوبي غير مباشر نهاية الوسم الفحص، التي تحدد حجم النشاط IVI المرتبطة الموافقة المسبقة عن علم كإجراء من vDNA الذاتية دمجها الخارجية الجراثيم خطي phiX174 الحمض النووي، 18. رغم أن هذا الأسلوب يوفر مقياسا مباشرا لأحداث التكامل، هناك حاجة إلى كميات عالية نسبيا من إعداد الموافقة المسبقة عن علم، التي ما زالت تشكل تحديا تقنياتسعى. للتحايل على هذا، وقد وضعت المتداخلة المقايسات PCR القائم تتطلب كميات محدودة فقط من بلدان جزر المحيط الهادئ 4 و 5 و 19.

في هذا التقرير، وصفنا نسخة محدثة من مقرها-PCR متداخلة في طريقة المختبر وضعت لتلخيص النشاط التكامل بوساطة PIC-HIV-1 التي تحدث أثناء العدوى الطبيعية. يستخدم هذا الأسلوب مقتطفات هيولية من الخلايا المستهدفة المصابة HIV-1 كمصدر من النشاط الذاتية الموافقة المسبقة عن علم، التي تقاس في الوقت الحقيقي البلمرة الكمية سلسلة من ردود الفعل (QPCR). يتم تكييفها إجراءات عزل بلدان جزر المحيط الهادئ وقياس الأنشطة إدماجهم، مع بعض التعديلات، من البروتوكولات نشرت من قبل المختبر Engelman 20. في هذه الطريقة، يتم بدء النشاط التكامل المرتبط الموافقة المسبقة عن علم من خلال توفير هدفا الحمض النووي الخطية دخيلة 21، والمنتجات الحمض النووي الناجم عنويتم تنقية هذا التفاعل التكامل وتستخدم كمادة أولية لالكمي PCR القائم لاحق. في الجولة الأولى PCR التقليدية، وتتضخم الوصلات الحمض النووي الفيروسي الهدف باستخدام بادئات المناسبة. في الدور الثاني QPCR، وتستخدم بادئات LTR محددة لإثراء تحديدا السكان vDNA من الجولة الاولى المنتجات PCR. الرجاء مراجعة القسم بروتوكول للحصول على وصف مفصل لهذا الأسلوب.

في الدراسات المختبرية مع بلدان جزر المحيط الهادئ فيروسات أدت إلى تقدم كبير في فهمنا لآلية التكامل الحمض النووي للفيروسات، وفي تطوير مثبطات IN. وبناء على زيادة التركيز مؤخرا على مواقع التكامل رسم الخرائط HIV-1، وتحديد دور العوامل الفيروسية والمضيف في HIV-1 التكامل، وتطوير الأدوية المضادة للفيروسات جديدة نحو مكافحة مقاومة الأدوية، نتصور اهتماما متزايدا في والاستخدام الواسع النطاق للIVI المقايسات ، مثل تلك المذكورة في هذا التقرير. وهذا، بدوره، يؤدي إلىالتحسينات المستقبلية في طريقة، وبالتالي تنويع نطاق تطبيقاتها.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

الإنتاج 1. الفيروسات

ملاحظة: لتوليد التتر عالية من العدوى بفيروس نقص المناعة البشرية 1، transfect خط الخلية الجنينية البشرية الكلى (كلوة) 293T مع المعدية HIV-1 استنساخ الجزيئي باستخدام تنشيط القائمة على dendrimer ترنسفكأيشن الكاشف. وقد لوحظ أن الأسلوب فوسفات الكالسيوم ترنسفكأيشن تؤدي إلى نتائج مماثلة.

  1. في مختبر السلامة الأحيائية المستوى 2 (BSL2)، والبذور 3 × 10 6 293T الخلايا في صحن 10 سم في 8 مل من Dulbecco لتعديل النسر متوسطة (DMEM) تستكمل مع 10٪ مصل بقري جنيني (FBS) والبنسلين، والستربتومايسين. ثقافة الخلايا في مجموعة حاضنة عند 37 درجة مئوية و 5٪ CO 2 O / N.
  2. في اليوم التالي، لtransfecting الخلايا في كل طبق 10 سم، وتمييع 8 ميكروغرام من pNL4-3 DNA البلازميد (انظر المواد الجدول) إلى الحجم النهائي من 300 ميكرولتر من DMEM تفتقر الدم والمضادات الحيوية. إضافة 80 ميكرولتر من كاشف ترنسفكأيشن، وتخلط جيدا من قبل pipetting، واحتضانها في RT ل5-10 دقيقة لترنسفكأيشن تشكيل تعقيدا.
  3. إزالة المتوسطة من الأطباق التي كتبها طموح وإضافة 7 مل لكل طبق من DMEM الطازجة التي تحتوي على مصل الدم والمضادات الحيوية.
  4. إضافة 1 مل من DMEM تحتوي على مصل الدم والمضادات الحيوية لمجمع ترنسفكأيشن، مزيج من قبل pipetting، وإضافة هذا الخليط إلى الخلايا. دوامة بلطف الطبق لتسهيل حتى توزيع المجمعات ترنسفكأيشن.
  5. على الفور نقل الخلايا إلى المختبر BSL3، مكان في مجموعة حاضنة عند 37 درجة مئوية و 5٪ CO وثقافة الخلايا لمدة 48 ساعة.
  6. جمع زراعة الأنسجة طاف التي تحتوي على الفيروس باستخدام ماصة ومن ثم نقلها إلى أنبوب الطرد المركزي. أجهزة الطرد المركزي في 300 x ج لمدة 5 دقائق لخلايا بيليه والحطام، ومن ثم تصفية طاف من خلال مرشح حقنة 0.45 ميكرون مسام الحجم.
  7. للقضاء على أي DNA البلازميد المرحل في هذا الإعداد الفيروس خالية من الخلايا، وعلاج مع الدناز 1 (20 ميكروغرام / مل) عند 37 درجة مئوية لمدة 1 ساعة.
  8. لتحديدHIV-1 عيار، استخدم-P24 محددة انزيم مرتبط المناعي فحص (ELISA)، كما هو طريقة سريعة وقابلة للاستخدام الروتيني 22.
    ملاحظة: تجدر الإشارة إلى أن P24 ELISA يقيس عيار البدني (عدد جزيئات الفيروس). بدلا من ذلك، وقياس النشاط المرتبط بفيروس RT (خارجي RT فحص) أو العدوى بفيروس (المقايسات العدوى على أساس خط خلايا مؤشر تزم BL) ستقدم قراءات حصرية من جزيئات الفيروس المعدية.

2. عدوى فيروس من الخلايا سوب-T1 (BSL3 مختبر)

  1. في المختبر BSL2، والحفاظ على خلايا سوب-T1 بين 1.0 × 10 6 و 2.0 × 10 6 خلية / مل في معهد روزويل بارك التذكاري (RPMI) متوسطة تستكمل مع 10٪ الحرارة المعطل FBS والبنسلين، والستربتومايسين (نسبة الانقسام من 1 : 2 كل 2-3 د). تجميع الخلايا سوب-T1 من قوارير الثقافة، وتخلط جيدا من قبل pipetting، وتحديد عدد خلايا قابلة للحياة باستخدام عدادة الكريات والأزرق الاستبعاد التريبان الواحدaining الأسلوب.
    1. إعداد العدد المطلوب من aliquots من 80 × 10 6 خلايا (لكل عدوى فيروس) في 50 مل أنابيب مخروطية أجهزة الطرد المركزي.
    2. الطرد المركزي الخلايا في الدوار يتأرجح دلو في 500 x ج و 25 درجة مئوية لمدة 5 دقائق. دون إزالة مستنبت الخلية، ونقل الأنابيب التي تحتوي على الخلايا مكعبات إلى المختبر BSL3 لمزيد من المعالجة. بعناية نضح مستنبت خلية من الأنبوب من دون إزعاج بيليه الخلية.
  2. إضافة كمية مناسبة من اللقاح فيروس تعامل I-الدناز إلى الخلايا في الأنبوب وتخلط جيدا من قبل pipetting لطيف. 80 × 10 6 خلايا، استخدم 30 مل من فيروس تعامل I-الدناز (50 ميكروغرام من فيروس P24 ما يعادلها).
    ملاحظة: عزل بلدان جزر المحيط الهادئ وظيفية يتطلب يصيب الخلايا المستهدفة مع مولتيبليكيتييس عالية جدا من العدوى (وزارة الداخلية).
  3. توزيع الخليط بالتساوي بين اثنين من لوحات زراعة الأنسجة 6-جيدا (أي 12 قسامات × 2.5 مل، واستخدام لوحات 2 في تصيبأيون).
  4. لspinoculation، ووضع لوحات ثقافة في ناقلات لوحة وأجهزة الطرد المركزي باستخدام الدوار دلو يتأرجح في 480 x ج و 25 درجة مئوية لمدة 2 ساعة.
  5. احتضان الخلايا spinoculated عند 37 درجة مئوية و 5٪ CO 2 لمدة 5 ساعات.

3. حصاد وتحلل الخلايا المصابة (BSL3 مختبر)

  1. تجميع الخلايا المقابلة لكل العدوى من لوحات الثقافة في مل أنبوب مخروطي 50 أجهزة الطرد المركزي (~ 30 مل في المجموع).
  2. حصاد الخلايا بواسطة الطرد المركزي في 300 x ج و 25 درجة مئوية لمدة 10 دقيقة. نضح بعناية طاف من الأنبوب (بدلا من ذلك، استخدم ماصة).
  3. لإزالة أي جزيئات فيروسية المتبقية، ويغسل كل بيليه الخلية بإضافة 2 مل من العازلة K - / - (150 ملي بوكل، 20 ملي HEPES، ودرجة الحموضة 7.6 و 5 ملي MgCl 2) والطرد المركزي العينة في 300 x ج و 25 درجة مئوية لمدة 10 دقائق. ثم، من دون إزعاج بيليه، وإزالة بعناية طاف بواسطة الشفط أو باستخدام ماصة.
  4. Repeaر خطوة 3.3.
  5. بعناية إزالة أي العازلة المتبقية التي كتبها باستخدام micropipette. resuspend كل بيليه خلية في 2 مل من الجليد الباردة العازلة تحلل K + / + (الاحتياطي K - / - تستكمل مع 0.025٪ ديجيتونين، 1 ملم DTT و 20 ميكروغرام / مل أبروتينين)، خلط محتويات طيف من قبل pipetting، ونقل إلى 2 مل أنبوب microcentrifuge.

4. إعداد بلدان جزر المحيط الهادئ حشوية (BSL3 مختبر)

  1. صخرة العينات على شاكر دوارة في RT لمدة 10 دقيقة.
  2. الطرد المركزي العينات، مع الدوار precooled إلى 4 درجات مئوية، في 1500 x ج و 4 درجات مئوية لمدة 4 دقائق.
  3. من دون إزعاج بيليه، ونقل بعناية طاف لأنبوب microcentrifuge الطازجة وأجهزة الطرد المركزي في 16000 x ج و 4 درجات مئوية لمدة 1 دقيقة.
  4. نقل بعناية طاف لأنبوب microcentrifuge الطازجة. إضافة ريبونوكلياز ألف (20 ملغ / مل) إلى تركيز النهائي من 20 ميكروغرام / مل (2 ميكرولتر لمدة 2 مل من بلدان جزر المحيط الهادئ)، واحتضان محتويات في RT لمدة 30 دقيقة (أي هزاز). </ لى>
  5. إضافة السكروز (60٪ ث / ت في المخزن K - / -) لتركيز النهائي من 7٪ وتخلط جيدا من قبل pipetting لطيف. إعداد قسامات (على سبيل المثال، 200 ميكرولتر) من بلدان جزر المحيط الهادئ في أنابيب microcentrifuge، ومضة التجميد في النيتروجين السائل، ومكان في الفريزر -80 درجة مئوية للتخزين على المدى الطويل.

5. في المختبر التكامل (IVI) فحوصات عن طريق HIV-1 بلدان جزر المحيط الهادئ

  1. تحضير الحمض النووي الهدف المستخدمة في فحص IVI عن طريق تضخيم منطقة 2.0 كيلو بايت من DNA البلازميد phiX174 مع PCR باستخدام بادئات حسب الطلب، phiX174-F وphiX174-R.
    1. تجميع خليط PCR كما هو موضح في الجدول رقم 1. أداء PCR في cycler الحرارية باستخدام الظروف الدراجات الحرارية الموصى بها في الجدول 2. هلام تنقية المنتج PCR باستخدام طقم تنقية هلام (بعد بروتوكول الموصى بها من الشركة المصنعة)، وتخزين الحمض النووي الهدف النقي كما aliquots في -80 درجة مئوية حتى الاستخدام.
  2. إضافة 600 نانوغرام من الحمض النووي المستهدف إلى 200 - & #181، L قسامة من بلدان جزر المحيط الهادئ، وتخلط جيدا، واحتضان عند 37 درجة مئوية لمدة 45 دقيقة.
    ملاحظة: ينصح ردود الفعل IVI حذف الحمض النووي الهدف أو بما في ذلك مثبطات إنزيم مدمج (على سبيل المثال، Raltegravir) ردود الفعل السيطرة.
  3. وقف رد فعل IVI بإضافة SDS، EDTA، وبروتين كاف لتركيزات النهائي من 0.5٪ و 8 ملم، و 0.5 ملغ / مل على التوالي. خلط محتويات رد فعل جيدا واحتضان بين عشية وضحاها في 56 درجة مئوية.
  4. في اليوم التالي، وتنقية الحمض النووي الكلي من رد فعل IVI من الفينول استخراج / الكلوروفورم وهطول الأمطار الايثانول. تنفيذ جميع الخطوات الطرد المركزي في 16000 x ج وRT.
  5. إضافة حجم مساو من الفينول على عينة deproteinized، مزيج بقوة من قبل vortexing، وأجهزة الطرد المركزي لمدة 2 دقيقة. إزالة بعناية المرحلة المائية العليا وتحويلها إلى أنبوب جديد.
  6. كرر الخطوة 5.5. نقل المرحلة المائية العليا لأنبوب جديد.
  7. إضافة حجم مساو من 1: 1 الفينول: مزيج الكلوروفورم، ومزيج بقوة من قبل vortexing، وأجهزة الطرد المركزي FO ص 2 دقيقة. نقل المرحلة المائية العليا لأنبوب جديد.
  8. إضافة حجم مساو من كلوروفورم، مزيج بقوة من قبل vortexing، وأجهزة الطرد المركزي لمدة 2 دقيقة. نقل المرحلة المائية العليا لأنبوب جديد.
  9. لترسيب الحمض النووي، إضافة الجليكوجين إلى تركيز النهائي من 0.1 ميكروغرام / ميكرولتر و 3 M من خلات الصوديوم إلى تركيز النهائي من 0.3 م و 2.5 مجلدات من الإيثانول بنسبة 100٪ (كريم الباردة). دوامة لخلط، لفترة وجيزة أجهزة الطرد المركزي لجمع محتويات، ووضع أنبوب في -80 درجة CO / N.
  10. في اليوم التالي، الطرد المركزي العينة لمدة 30 دقيقة في 16000 x ج و 4 درجات مئوية لمدة 30 دقيقة. إزالة بعناية طاف دون الإخلال بيليه.
  11. إضافة 500 ميكرولتر من 80٪ من الإيثانول (المثلج) لبيليه وأجهزة الطرد المركزي في 16000 x ج و 4 درجات مئوية لمدة 10 دقيقة. الهواء الجاف بيليه الحمض النووي في RT و resuspend بدقة في 50 ميكرولتر من nuclease خالية من المياه. تخزين عينات من الحمض النووي في -20 درجة مئوية.

6. PCR فحوصات لقياس الموافقة المسبقة عن علم آخر

= "jove_content"> ملاحظة: عدد نسخة من HIV-1 الحمض النووي دمجها في الحمض النووي الهدف وكميا من خلال استراتيجية PCR المتداخلة التي توظف 2 مجموعات من الاشعال و2 جولات متتابعة من PCR.

  1. إجراء الجولة الأولى PCR التقليدية باستخدام بادئات استهداف LTR الفيروسي وphiX174 الحمض النووي (LTR وphiX174 الاشعال، على التوالي) لتضخيم تقاطعات من HIV-1 الحمض النووي المتكاملة.
    1. تجميع الجولة الأولى-PCR خليط كما هو موضح في الجدول رقم 3. تجميع مزيج الرئيسي لجميع المكونات باستثناء قالب الحمض النووي، الاستغناء قسامات 45 ميكرولتر في أنابيب PCR منفصلة، ​​وإضافة 5 ميكرولتر من الحمض النووي القالب أو nuclease خالية من المياه (السيطرة).
    2. أداء PCR في cycler الحرارية باستخدام الظروف الدراجات الحرارية الموصى بها في الجدول 4.
  2. إجراء الجولة الثانية QPCR باستخدام بادئات التي تكتنف المنطقة قصيرة من LTR الفيروسي (LTR-R والاشعال LTR-U) لتضخيم انتقائي تسلسل vDNA متكاملة من رو الأولمنتجات اوند PCR. لتحديد vDNA متكاملة نسخ الأرقام، وتوليد منحنى قياسي باستخدام 10X التخفيفات المسلسل من الأرقام نسخة المعروف (على سبيل المثال، 10 0-10 8) من استنساخ الجزيئي HIV-1.
    1. تجميع الجولة الثانية QPCR خليط كما هو موضح في الجدول رقم 5. تجميع مزيج الرئيسي لجميع المكونات باستثناء قالب الحمض النووي، بعناية الاستغناء عن 25 مكل إلى العدد المناسب من الآبار في جيدا 96 PCR لوحة رد فعل، ثم قم بإضافة 5 ميكرولتر من الدور الاول غير المكرر، المنتجات PCR أو nuclease خالية من المياه (مراقبة). أداء جميع ردود الفعل QPCR في ثلاث نسخ.
    2. تحميل لوحة PCR في الوقت الحقيقي PCR الصك وأداء QPCR باستخدام الظروف الدراجات الموصى بها في الجدول 6.
    3. تحليل البيانات باستخدام البرمجيات المناسبة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

عزل HIV-1 بلدان جزر المحيط الهادئ

ويصور رسم تخطيطي للبروتوكول يستخدم لعزل HIV-1 بلدان جزر المحيط الهادئ من خلايا سوب-T1 المصابة تماما في الشكل 1. ويستمد هذا البروتوكول من الأساليب التي وصفها Engelman وآخرون. 19، 20. HIV-1 بلدان جزر المحيط الهادئ هي مجمعات البروتين النووي التي يتم تجميعها في الخلايا المصابة وتتكون من vDNA-كتب العكس، البروتينات الفيروسية، والعوامل الخلوية 19 و 20. يستخدم الطريقة الموضحة في هذا التقرير مقتطفات هيولية من الخلايا المصابة HIV-1 كمصدر للنشاط الاندماج المرتبطة الموافقة المسبقة عن علم.

في النشاط التكامل المختبر من HIV-1 بلدان جزر المحيط الهادئ

EP-together.within الصفحات = "1"> ويرد التخطيطي النظر عن الطريقة المستخدمة لقياس النشاط IVI من HIV-1 بلدان جزر المحيط الهادئ في الشكل 2. هذه الطريقة تستخدم استراتيجية المتداخلة استنادا QPCR لقياس النشاط IVI المرتبطة الموافقة المسبقة عن علم، وتكييف الإجراءات، مع بعض التعديلات، من البروتوكولات نشرت من قبل المختبر Engelman 19 و 20 و 21. في هذه الطريقة، يتم بدء النشاط التكامل المرتبط الموافقة المسبقة عن علم من خلال توفير هدف الحمض النووي خطي مغاير 21، والمنتجات DNA الناتجة عن هذا التفاعل التكامل وتنقيته وتستخدم كمادة أولية لالكمي PCR القائم لاحق. في الجولة الأولى PCR التقليدية، وتقاطعات الحمض النووي الفيروسي الهدف وتتضخم باستخدام بادئات المناسبة. في الدور الثاني QPCR، وتستخدم بادئات LTR محددة لإثراء تحديدا السكان vDNA من الجولة الاولى المنتجات PCR. الرجاء مراجعة بروتوكول الصورةection للحصول على وصف مفصل لهذا الأسلوب.

أداء نتائج ممثلة من مقايسة IVI باستخدام ترد HIV-1 بلدان جزر المحيط الهادئ في الشكل (3). تم spinoculated خلايا سوب-T1 (80 × 10 6 خلايا / عدوى) مع 30 مل من الدناز 1 المعاملة HIV-1 (~ 50 ميكروغرام من مكافئ P24) في وجود أو غياب من 1 ميكرومتر HIV-1 في المانع Raltegravir في 480 x ج و 25 درجة مئوية لمدة 2 ساعة. كانت الخلايا المزروعة في وقت لاحق لمدة 5 ساعات عند 37 درجة مئوية و 5٪ CO 2. وكانت بلدان جزر المحيط الهادئ معزولة كما هو موضح في قسم البروتوكول. نفذت ردود الفعل IVI خارج، كل باستخدام 200 ميكرولتر من بلدان جزر المحيط الهادئ و 600 نانوغرام من الحمض النووي الهدف (جزء DNA 2 كيلوبايت تضخيمها من الحمض النووي phiX174 بواسطة PCR)، عند 37 درجة مئوية لمدة 45 دقيقة. تم deproteinized ردود الفعل من قبل بروتين العلاج K في وجود SDS وEDTA عند 56 درجة CO / N. تم استخراج منتجات التفاعل مرتين مع الفينول، مرة واحدة مع الفينول: كلوروفورم (1: 1) خليط، ومرة ​​واحدةمع الكلوروفورم. وفي وقت لاحق، وكان الحمض النووي الايثانول عجلت في وجود الملح والجليكوجين شارك في مرسب، وغسلها بيليه الحمض النووي مرة واحدة مع 80٪ من الإيثانول. وكان معلق الحمض النووي المنقى في 50 ميكرولتر من nuclease خالية من المياه. تم استخدام استراتيجية QPCR المتداخلة لتحديد عدد من vDNA دمجها في phiX174 الحمض النووي. في الجولة الأولى PCR التقليدية، استخدمت الاشعال مكملة لتسلسل الحمض النووي على الهدف phiX174 والمنطقة LTR الفيروسية لتضخيم تقاطعات الحمض النووي الفيروسي متكاملة الهدف من 5 ميكرولتر من المنتجات الحمض النووي رد فعل التكامل. في الدور الثاني QPCR، استخدمت الاشعال LTR-تمتد لتضخيم حصرا تسلسل الحمض النووي فيروس نقص المناعة البشرية محددة من 5 ميكرولتر من المنتجات amplicon أول جولة ومن 10 أضعاف التخفيفات المسلسل من الأرقام نسخة معروفة (10 8 -10 0) من استنساخ الجزيئي HIV-1 (المعايير).

وقد أجريت جميع ردود الفعل QPCR في ثلاث نسخ والبيانات ورالبريد تحليلها باستخدام البرمجيات التجارية. تم التخطيط القيم المستمدة من المعايير لتوليد منحنى القياسية، والتي من vDNA متكاملة نسخ ومحرف الأرقام. تمثل أشرطة الخطأ الانحرافات المعيارية. كما هو مبين في الشكل (3)، وبلدان جزر المحيط الهادئ HIV-1 دمج بقوة على vDNA المرتبطة في الحمض النووي الهدف (حارة 5). الأهم من ذلك، تم تخفيض كفاءة IVI من بلدان جزر المحيط الهادئ إلى حد كبير في ردود الفعل تستكمل مع المانع في Raltegravir (لين 6). هذه الصفات بقوة النشاط التكامل تقاس في هذا الاختبار إلى HIV-1 في. وعلاوة على ذلك، فإن ردود الفعل تحكم يحتوي لست] حشوية من الخلايا غير المصابة (لين 1)، بلدان جزر المحيط الهادئ وحدها (حارة 2)، تستهدف الحمض النووي وحده (حارة 3)، والعازلة وحدها (لين 4) لم تظهر أي نشاط الاندماج. وبالإضافة إلى ذلك، فإن السيطرة التي استبعدت البلمرة طق في الجولة الأولى PCR (لين 7) لا تضخيم المنتجات التكامل. والجدير بالذكر أن أشارت بيانات من سيطرة بلدان جزر المحيط الهادئ بذاتها (حارة 2) أن متداخلة specifi استراتيجية QPCRساتيا يقيس vDNA متكاملة ولكن ليس vDNA المرتبطة الموافقة المسبقة عن علم. بشكل جماعي، وهذه البيانات تظهر قياس النشاط التكامل المرتبط الموافقة المسبقة عن علم.

شكل 1
الشكل 1: تمثيل تخطيطي لبروتوكول لإعداد HIV-1 بلدان جزر المحيط الهادئ. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

يتم عزل مقتطفات هيولية تحتوي على بلدان جزر المحيط الهادئ من خلايا سوب-T1 المصابة HIV-1. وتستخدم هذه بلدان جزر المحيط الهادئ كمصدر للنشاط الاندماج في المختبر في التكامل الفحص.

الشكل 2
الشكل 2: التمثيل التخطيطي لفي المختبر م> التكامل الفحص من HIV-1 بلدان جزر المحيط الهادئ. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

وأجريت فحوصات التكامل في المختبر باستخدام HIV-1 بلدان جزر المحيط الهادئ والهدف مغاير phiX174 الحمض النووي. تم قياس HIV-1 الحمض النووي متكاملة من خلال استراتيجية PCR المتداخلة، حيث أن الجولة الأولى PCR التقليدية تضخم تقاطعات التكامل التي تتضخم تسلسل vDNA محددة تفضيلي في الدور الثاني QPCR.

الشكل (3)
الشكل (3): HIV-1 الموافقة المسبقة عن علم المرتبطة vDNA التكامل آخر. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

"FO: المحافظة على together.within الصفحات =" 1 "> النتائج التمثيلية للفحص النشاط التكامل المرتبطة PIC-HIV-1 vDNA متكاملة نسخ أرقام تم تحديدها من قبل بالتآمر القيم المستمدة من المنحنى القياسي إنشاؤها باستخدام 10X التخفيفات المسلسل. . وقد أجريت أرقام نسخة معروفة من استنساخ الجزيئي HIV-1 جميع ردود الفعل في ثلاث نسخ، وتم تحليل البيانات باستخدام البرمجيات التجارية. أشرطة الخطأ تمثل الانحرافات المعيارية.

مكون مخزون الحجم النهائي للرد فعل 50 ميكرولتر
phiX174 DNA البلازميد 10 نانوغرام / ميكرولتر 5.0 ميكرولتر
رد فعل العازلة GoTaq 5X 10.0 ميكرولتر
مزيج النوكليوتيدات dNTP 10 ملي كل 1.0 ميكرولتر
phiX174-F التمهيدي 10 ميكرومتر 2.5 ميكرولتر
phiX174-R التمهيدي 10 ميكرومتر 2.5 ميكرولتر
GoTaq البلمرة DNA (5 U / ميكرولتر) 0.25 ميكرولتر
الماء المقطر Nuclease خالية من - 28.75 ميكرولتر

الجدول 1.

95 ° C = 2 دقيقة
دورة 34 التكرار من:
95 ° C = 30 ثانية
53 ° C = 30 ثانية
72 ° C = 2 دقيقة
72 ° C = 10 دقيقة
4 ° C = امسك

الجدول 2.

لو فو: المحافظة على together.within الصفحات = "1" FO: المحافظة على مع next.within صفحة = "دائما"> مكون مخزون الحجم النهائي للرد فعل 50 ميكرولتر IVI ناتج التفاعل الحمض النووي - 5.0 ميكرولتر رد فعل العازلة GoTaq 5X 10.0 ميكرولتر مزيج النوكليوتيدات dNTP 10 ملي كل 1.0 ميكرولتر LTR التمهيدي 10 ميكرومتر 2.5 ميكرولتر phiX174 التمهيدي 10 ميكرومتر 2.5 ميكرولتر GoTaq البلمرة DNA (5 U / ميكرولتر) 0.25 ميكرولتر الماء المقطر Nuclease خالية من - 28.75 ميكرولتر

الجدول 3.

الآثار البيئية-together.within الصفحات = "1" FO: المحافظة على مع next.within صفحة = "دائما">
95 ° C = 5 دقيقة
دورة 23 التكرار من:
94 ° C = 30 ثانية
55 ° C = 30 ثانية
72 ° C = 4 دقيقة
72 ° C = 10 دقيقة
4 ° C = امسك

جدول (4).

<td> التحقيق TAQMAN
مكون مخزون الحجم النهائي للرد فعل 30 ميكرولتر
1 ش المنتجات جولة PCR - 5.0 ميكرولتر
LTR-R التمهيدي 10 ميكرومتر 0.9 ميكرولتر
LTR-U التمهيدي 10 ميكرومتر 0.9 ميكرولتر
10 ميكرومتر 0.3 ميكرولتر
معدل الذكاء SUPERMIX 2X 15.0 ميكرولتر
الماء المقطر Nuclease خالية من - 7.9 ميكرولتر

الجدول 5.

95 ° C = 3 دقيقة
دورة 39 التكرار من:
94 ° C = 15 ثانية
58 ° C = 30 ثانية
72 ° C = 30 ثانية
لوحة مقروءة

الجدول 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وقد وفرت التحليلات الكيميائية الحيوية من بلدان جزر المحيط الهادئ فيروسات الأفكار الهامة في آلية التكامل الحمض النووي للفيروسات. قياس النشاط التكامل بين بلدان جزر المحيط الهادئ فيروسات يمكن تحقيق ذلك عن طريق فحص اللوحة تشكيل، تحليل الجنوبي لطخة، ومتداخلة QPCR. الاستراتيجية التجريبية لفحص اللوحة هي شاقة وتستخدم وسيلة غير مباشرة لقياس التكامل 6 و 7 و 18. جنوب القائم على لطخة التكامل فحوصات قياس تتطلب مباشرة ولكن كميات عالية نسبيا من بلدان جزر المحيط الهادئ 6 و 7 و 18.

تفاصيل هذا التقرير استراتيجية QPCR المتداخلة لقياس HIV-1-الموافقة المسبقة عن علم يرتبط النشاط التكامل في المختبر. والميزة الرئيسية وأهمية هذا الأسلوب هو شرط كميات قليلة نسبيا من إعداد الموافقة المسبقة عن علم في رد فعل 4و 5 و 19. الخطوات الأكثر أهمية في هذه الطريقة هي جيل من فيروس ارتفاع عيار العدوى والتعامل مع إعداد الموافقة المسبقة عن علم. وتجدر الإشارة هنا إلى أن الجولة الأولى من PCR ينطوي التضخيم الهائل من التقاطعات التكامل. وبالتالي، فإن الأرقام نسخة متكاملة vDNA تحدد في الجولة QPCR الثاني هي شبه الكمية، وبالتالي، فإن الحد من عدم إعطاء قدر من نسخ vDNA المرتبطة الموافقة المسبقة عن علم. ومع ذلك، فإن vDNA المرتبطة PIC يمكن تحديد QPCR من الحمض النووي تنقيته من بلدان جزر المحيط الهادئ مع الاشعال LTR محددة. نسبة vDNA متكاملة نسخ الأرقام إلى vDNA المقابلة المرتبطة الموافقة المسبقة عن علم يمكن أن توفر معلومات عن كفاءة تكامل في المختبر رد فعل التكامل. هذه الطريقة يمكن تعديلها من خلال دمج غيرها من الحمض النووي الهدف مغاير الاختيار وغيرها من الاشعال للكشف عن التكامل في كل الاتجاهات. وباختصار، فإن طريقةوصفت هنا يقيس النشاط دمج HIV-1 بلدان جزر المحيط الهادئ كميا ويمكن اعتمادها للبحث تطوير فهم من التفاصيل الحيوية التكامل فيروسات.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب تعلن أي المصالح المالية وغير المالية المتنافسة.

Acknowledgments

ويدعم هذا العمل جزئيا من خلال منح DA024558، DA30896، DA033892، وDA021471 من المعهد الوطني / المعاهد الوطنية للصحة لمؤتمر نزع السلاح. ونحن نعترف أيضا منحة G12MD007586 RCMI، فاندربيلت CTSA منح UL1RR024975، مركز بحوث بالحركة ميهاري (MeTRC) CTSA منحة U54 RR026140 من NCRR / المعاهد الوطنية للصحة، وMD007593 منحة U54 من NIMHD / المعاهد الوطنية للصحة، وتينيسي CFAR منحة P30 AI110527.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
قياس ل<em&gt; في المختبر</em&gt; التكامل آخر من HIV-1 Preintegration مجمعات
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter