Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Mesure de doi: 10.3791/54581 Published: February 22, 2017

Abstract

les protéines d'enveloppe du VIH-1 engagent récepteurs correspondants sur la surface de la cellule cible, ce qui conduit à la cellule d'origine virale fusion membranaire, suivie par la libération du noyau capside (CA) dans le cytoplasme. Par la suite, le virus de la transcriptase inverse (RT), dans le cadre d'un complexe du même nom nucléoprotéine appelée Reverse Transcription Complex (RTC), convertit le génome d'ARN simple brin viral dans une copie d'ADN double brin (vDNA). Cela conduit à la biogenèse d'un autre complexe de nucléoprotéine, appelé le complexe de pré-intégration (PIC), composée de la vDNA et des protéines virales associées et les facteurs de l'hôte. L'intégrase virale PIC-associé (IN) orchestrant l'intégration du vDNA dans l'ADN chromosomique de l'hôte dans un processus en deux étapes régulé temporellement et spatialement. D'abord, le processus IN extrémités 3 'du vDNA dans le cytoplasme et, en second lieu, après que le PIC trafique vers le noyau, il médie l'intégration du vDNA transformé dans l'ADN chromosomique. Les PICs isolésà partir de cellules cibles infectées de façon aiguë par le VIH-1 sont fonctionnelles in vitro, car ils sont compétents pour intégrer la vDNA associée à un ADN cible hétérologue ajouté de manière exogène. Dans des tests d'intégration in vitro telle base PIC ont considérablement contribué à délimiter les détails mécanistiques de l' intégration rétrovirale et à la découverte de inhibiteurs de l' IN. Dans ce rapport, nous élaborons sur un VIH-1 PIC test mis à jour qui utilise un imbriquée en temps réel Polymerase Chain Reaction quantitative (qPCR) stratégie à base de mesure de l'activité d'intégration in vitro de PICs indigènes isolés.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1 replication dans la cellule cible implique plusieurs étapes, de façon générale regroupées en deux phases: les événements précoces et tardifs. Les événements précoces commencent lorsque le VIH-1 de façon séquentielle se lie au récepteur de surface des cellules cibles CD4 et l' un des deux co-récepteurs (CCR5 ou CXCR4) 1. Par conséquent, la membrane fusible virus des cellules, et la capside virale (CA) de base est libérée dans le cytoplasme 2. Le noyau CA contient l'ARN viral génomique simple brin (ssRNA) et plusieurs protéines, à la fois virale et cellulaire à l'origine. Les protéines virales associées CA comprennent la transcriptase inverse (RT) et intégrase (IN), deux enzymes qui interviennent dans les étapes critiques pendant les événements précoces de la réplication virale. La RT et IN fonction dans le contexte des complexes de nucléoprotéine, à savoir la transcription inverse complexe (RTC) et le complexe de pré-intégration (PIC), respectivement 3, 4, 5 <sup>, 6. Les extrémités du génome viral de ssRNA terminal portuaire répétition (R) des éléments adjacents aux séquences U5 uniques (à l'extrémité 5 ') et U3 (à l'extrémité 3'). Le RTC convertit le ssRNA génome viral dans un (ds) copie d'ADN double brin (vDNA). Ce processus de transcription inverse se traduit également par une duplication des séquences U3 et U5, générant ainsi des longues répétitions terminales (LTR) aux deux extrémités de la vDNA 7, 8. Par la suite, IN PIC associé catalyse deux réactions biochimiques successives qui permettent l'intégration du vDNA dans le chromosome hôte 9, 10, 11. Tout d' abord, dans le cytoplasme, IN multimères s'engager les deux LTR et 12 cliver un dinucléotide à partir de chacune des extrémités 3 'terminales. Ce traitement génère l' extrémité 3 ' d' un groupe hydroxyle à chaque extrémité 3' (OH CA) de la vDNA.Ensuite, PIC trafique vers le noyau, dans lequel IN utilise le vDNA CA OH comme nucléophile pour couper les deux brins de l'ADN chromosomique en quinconce. Simultanément, se dissocie de façon coordonnée les deux extrémités du vDNA aux liaisons phosphodiester résultant sur des brins opposés de l'ADN chromosomique. Après cette étape de transfert de brin, la machinerie de la cellule hôte supprime les deux nucléotides non appariés aux extrémités 5 'de la vDNA et répare les lacunes simple brin qui en découlent à la jonction du site d'intégration. Les événements précoces aboutissent donc à la création d'une copie d'ADN intégré (provirus) du génome du VIH-1. Provirus fournit un environnement approprié pour l'expression des gènes viraux efficaces, ce qui déclenche des événements ultérieurs, y compris l'expression des protéines codées par le virus; assemblage du virus immature; et le bourgeonnement, la libération et la maturation dans des virions infectieux 13.

Purifié rétroviral IN recombinant est compétent pourréaliser, in vitro, les deux traitement et de transfert de brin activités 3'-terminales sur exogène ADN substrat LTR-like. Des études biochimiques utilisant de tels recombinant purifié IN ont révélé des aspects critiques de l' intégration vDNA 14, 15, 16, 17. Cependant, contrairement à une infection naturelle, cette réaction biochimique in vitro ne supporte pas l' intégration concertée des deux extrémités de l'ADN de substrat dans l'ADN cible. En revanche, les PIP rétrovirales isolées à partir de cellules infectées de façon aiguë intégration concertée des deux extrémités du vDNA endogène dans un ADN cible hétérologue. Cela a conduit à l'adoption généralisée et des améliorations ultérieures de Vitro Intégration (IVI) essais I n en utilisant PICs indigènes isolés.

Dans le premier essai rapporté IVI rétroviraux, des extraits cytoplasmiques provenant de cellules infectées par un recombinant murineVirus de la Leucémie (MLV) hébergeant le gène de E. coli SupF dans sa LTR a servi comme source d'activité IN et l'ADN d'un mutant de phage lambda défectueux dans la croissance lytique a été fourni de manière exogène comme l'ADN cible. l'intégration réussie de l'ADN recombinant MLV la copie dans l'ADN du phage et l'expression qui suit SupF conduit à la restauration de la capacité des phages recombinants de formation de plaques. Cependant, cette stratégie expérimentale est laborieuse et l'intégration de mesures d'une manière indirecte. Pour faire face à ces mises en garde, un test de fin marquage indirect basé blot-Sud, qui quantifie l'activité IVI PIC associée en tant que mesure de la vDNA endogène intégré dans bactériophage linéarisé exogène phiX174 ADN, a été mis au point 6, 7, 18. Bien que cette méthode fournit une mesure directe des événements d'intégration, des quantités relativement élevées de la préparation des PIC sont nécessaires, ce qui reste un défi techniqueeffort. Pour contourner cela, des tests basés sur la PCR imbriquées ne nécessitant que des quantités modestes de PICs ont été développés 4, 5, 19.

Dans ce rapport, nous décrivons une version mise à jour d'une PCR nichée à base in vitro conçu pour récapituler l'activité d'intégration du VIH-1 PIC médiée survenant au cours de l' infection naturelle. Cette méthode utilise les extraits cytoplasmiques des cellules cibles du VIH-1 infectées en tant que source d'activité PIC endogène, qui est mesurée à l'aide d'une polymérase en temps réel quantitative Chain Reaction (PCR quantitative). Les procédures d'isolement PICs et mesurer leurs activités d'intégration sont adaptées, avec des modifications, des protocoles publiés par le laboratoire Engelman 20. Dans ce procédé, l'activité d'intégration PIC associée est déclenchée en fournissant un ADN cible exogène linéaire 21, et les produits d'ADN résultant decette réaction d'intégration sont purifiés et utilisés comme matière de départ pour la quantification par PCR ultérieure. Dans le premier tour de PCR classique, les jonctions d'ADN viral cible sont amplifiés en utilisant des amorces appropriées. Dans le second tour qPCR, amorces LTR-spécifiques sont utilisés pour enrichir spécifiquement la population vDNA des produits de première ronde de PCR. S'il vous plaît voir la section de protocole pour une description détaillée de cette méthode.

Des études in vitro avec PICs rétroviraux ont permis des avancées significatives dans notre compréhension du mécanisme d'intégration de l' ADN rétroviral et dans le développement d'inhibiteurs IN. Sur la base de la récente focalisation accrue sur la cartographie du VIH-1 des sites d'intégration, déterminer le rôle des facteurs viraux et d'accueil du VIH-1 l'intégration et le développement de nouveaux médicaments antiviraux dans la lutte contre la résistance aux médicaments, nous envisageons un intérêt accru et l'utilisation généralisée des IVI essais , comme celle décrite dans le présent rapport. Ceci, à son tour, conduira àaméliorations futures dans la méthode, diversifiant ainsi la portée de ses applications.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Production de virus

Remarque: pour produire des titres élevés de VIH-1 infectieux, transfecter la lignée de rein embryonnaire humain (HEK), des cellules 293T avec un HIV-1 clone moléculaire infectieux en utilisant un réactif de transfection à base de dendrimères activés. Il a été observé que le procédé au phosphate de calcium de transfection donne des résultats comparables.

  1. Dans un niveau de biosécurité 2 (NSB2) laboratoire, graines 3 x 10 6 cellules 293T par boîte de 10 cm dans 8 ml de milieu de Eagle modifié Dulbecco (DMEM) additionné de 10% de sérum bovin fœtal (FBS), de la pénicilline et de la streptomycine. Cultiver les cellules dans un incubateur réglé à 37 ° C et 5% de CO 2 O / N.
  2. Le lendemain, pour transfecter des cellules dans chaque boîte de 10 cm, diluer 8 pg d'ADN de plasmide pNL4-3 (voir le tableau des matériaux) jusqu'à un volume final de 300 ul de milieu DMEM dépourvu de sérum et d' antibiotiques. Ajouter 80 ul du réactif de transfection, bien mélanger par pipetage, et incuber à température ambiante pendant5 - 10 min pour la transfection formation du complexe.
  3. Retirez le support de la vaisselle par aspiration et ajouter 7 ml par boîte de DMEM frais contenant du sérum et des antibiotiques.
  4. Ajouter 1 ml de DMEM contenant du sérum et des antibiotiques pour le complexe de transfection, mélanger par pipetage, et ajoutez ce mélange sur les cellules. Remuer doucement le plat pour faciliter une distribution uniforme des complexes de transfection.
  5. Transférer immédiatement les cellules au laboratoire BSL3, place dans un incubateur réglé à 37 ° C et 5% de CO 2, et de la culture des cellules pendant 48 h.
  6. Recueillir le surnageant de culture de tissus contenant le virus en utilisant une pipette, puis le transférer dans un tube de centrifugation. Centrifuger à 300 g pendant 5 min pour sédimenter les cellules et les débris, puis filtrer le surnageant à travers un filtre à seringue de 0,45 um de taille de pore.
  7. Afin d'éliminer tout ADN plasmidique report dans cette préparation de virus exempt de cellules, on traite avec de la DNase 1 (20 ug / ml) à 37 ° C pendant 1 h.
  8. Pour quantifier laVIH-1 titre, utilisez le spécifique à p24 immuno-enzymatique (ELISA), car il est une méthode rapide et prête pour une utilisation de routine 22.
    NOTE: Il faut noter que le test ELISA p24 mesure le titre physique (nombre de particules virales). En variante, la mesure de l'activité associée au virus RT (dosage par RT exogène) ou le virus infectieux (dosages d'infectivité basés sur la lignée cellulaire indicatrice TZM-bl) fournira une lecture exclusive des particules virales infectieuses.

2. Virus Infection des cellules Sup-T1 (BSL3 Lab)

  1. Dans un laboratoire de NSB2, maintenir les cellules Sup-T1 entre 1,0 x 10 6 et 2,0 x 10 6 cellules / mL à Roswell Park Institute Memorial (RPMI) de milieu additionné de 10% inactivé par la chaleur FBS, de la pénicilline et de la streptomycine (rapport de division de 1 : 2 tous les 2 - 3 d). Réunir les cellules Sup-T1 à partir des flacons de culture, bien mélanger par pipetage, et de déterminer le nombre de cellules viables en utilisant un hémocytomètre et l'exclusion du bleu trypan stméthode aining.
    1. Préparer le nombre requis de parties aliquotes de 80 x 10 6 cellules (par infection virale) dans 50 ml tube conique de centrifugeuse.
    2. Centrifuger les cellules dans un rotor oscillant seau à 500 g et à 25 ° C pendant 5 min. Sans retirer le milieu de culture cellulaire, transférer les tubes contenant les cellules granulées au laboratoire BSL3 pour un traitement ultérieur. aspirer soigneusement le milieu de culture cellulaire à partir du tube sans perturber le culot cellulaire.
  2. Ajouter une quantité appropriée de DNase I-traité inoculum viral aux cellules dans le tube et bien mélanger par pipetage doux. Pour 80 x 10 6 cellules, utiliser 30 ml de virus DNase I-traité (50 pg de virus p24 équivalent).
    NOTE: L'isolement des PICs fonctionnels nécessite d'infecter les cellules cibles avec des multiplicités très élevés d'infection (MOI).
  3. Distribuer uniformément le mélange entre deux plaques de culture de tissus à 6 puits (soit 12 aliquotes x 2,5 mL; utiliser 2 plaques par infection).
  4. Pour spinoculation, placer les plaques de culture dans des supports de plaque et centrifuger à l'aide d'un seau rotor oscillant à 480 xg et 25 ° C pendant 2 h.
  5. Incuber les cellules spinoculated à 37 ° C et 5% de CO 2 pendant 5 h.

3. La récolte et la lyse des cellules infectées (BSL3 lab)

  1. Réunir les cellules correspondant à chaque infection à partir des plaques de culture dans un tube de 50 ml conique de centrifugeuse (~ 30 ml au total).
  2. Récolter les cellules par centrifugation à 300 x g et à 25 ° C pendant 10 min. Aspirer délicatement le surnageant du tube (en variante, utiliser une pipette).
  3. Pour éliminer les particules virales résiduelles, laver chaque culot cellulaire en ajoutant 2 ml de tampon K - / - (mM KCI 150 mM HEPES, pH 7,6, 5 mM de MgCl2 20) et en centrifugeant l'échantillon à 300 x g et à 25 ° C pendant 10 minutes. Puis, sans perturber le culot, retirez soigneusement le surnageant par aspiration ou à l'aide d'une pipette.
  4. REPEAt l'étape 3.3.
  5. Retirez soigneusement le tampon résiduel en utilisant une micropipette. Resuspendre chaque culot cellulaire dans 2 ml de tampon de lyse K glacée + / + (Tampon K - / - additionné de 0,025% digitonine, 1 mM de DTT, 20 pg / ml d' aprotinine), mélanger le contenu par pipetage doux, et transférer à un 2 microtube mL.

4. Préparation de PICs cytoplasmiques (BSL3 lab)

  1. Rock les échantillons sur un agitateur rotatif à température ambiante pendant 10 min.
  2. Centrifuger les échantillons, le rotor prérefroidi à 4 ° C, à 1500 x g et 4 ° C pendant 4 min.
  3. Sans perturber le culot, transférer soigneusement le surnageant dans un tube de microcentrifugation frais et centrifuger à 16 000 xg et 4 ° C pendant 1 min.
  4. Soigneusement transférer le surnageant dans un tube de microcentrifugation frais. Ajouter la RNase A (20 mg / ml) jusqu'à une concentration finale de 20 pg / mL (2 pi pour 2 ml de PIC) et on incube le contenu à la température ambiante pendant 30 minutes (sans balancement). </ Li>
  5. Ajouter le saccharose (60% p / v dans un tampon K - / -) à une concentration finale de 7% et bien mélanger par pipetage doux. Préparer des aliquotes (par exemple, 200 pi) des PICs dans des tubes à centrifuger, flash-gel dans de l' azote liquide, et placer dans un -80 ° C congélateur pour le stockage à long terme.

5. In Vitro Intégration (IVI) Assays Utilisation du VIH-1 PICs

  1. Préparer l'ADN cible utilisée dans le dosage IVI en amplifiant une région de 2,0 kb provenant de l'ADN de plasmide avec phiX174 PCR utilisant des amorces sur mesure, phiX174-F et phiX174-R.
    1. Assembler le mélange de PCR comme décrit dans le Tableau 1. Faire la PCR dans un cycleur thermique en utilisant les conditions de cyclage thermique recommandées dans le tableau 2. Gel purifie le produit PCR en utilisant un kit de purification sur gel (selon le protocole recommandé par le fabricant) et stocker l'ADN cible purifié sous forme d'aliquotes à -80 ° C jusqu'à utilisation.
  2. Ajouter 600 ng d'ADN cible à 200 - & #181; L aliquote de PICs, bien mélanger et incuber à 37 ° C pendant 45 min.
    Remarque: les réactions IVI omettant l' ADN cible ou incluant un inhibiteur de l' intégrase (par exemple, le raltégravir) sont recommandés réactions de contrôle.
  3. Arrêter la réaction par addition d'IVI SDS, de l'EDTA et de la proteinase K à une concentration finale de 0,5%, 8 mM et 0,5 mg / mL, respectivement. Mélanger le contenu de réaction à fond et incuber une nuit à 56 ° C.
  4. Le lendemain, la purification de l'ADN total de la réaction IVI par extraction au phénol / chloroforme et précipitation à l'éthanol. Effectuer toutes les étapes de centrifugation à 16.000 xg et RT.
  5. Ajouter un volume égal de phénol à l'échantillon déprotéiné, mélanger énergiquement par tourbillonnement, et centrifuger pendant 2 min. Retirez délicatement la phase aqueuse supérieure et le transférer dans un nouveau tube.
  6. Répétez l'étape 5.5. Transférer la phase aqueuse supérieure dans un nouveau tube.
  7. Ajouter un volume égal de 1: 1 de phénol: un mélange de chloroforme, mélanger énergiquement par tourbillonnement, et centrifuger foR 2 min. Transférer la phase aqueuse supérieure dans un nouveau tube.
  8. Ajouter un volume égal de chloroforme, mélanger énergiquement par tourbillonnement, et centrifuger pendant 2 min. Transférer la phase aqueuse supérieure dans un nouveau tube.
  9. Pour précipiter l'ADN, ajouter le glycogène à une concentration finale de 0,1 pg / pl, 3 M d'acétate de sodium à une concentration finale de 0,3 M et 2,5 volumes d'éthanol à 100% (glacé). Vortex pour mélanger, centrifuger brièvement pour recueillir le contenu, et placez le tube à -80 ° CO / N.
  10. Le lendemain, centrifuger l'échantillon pendant 30 min à 16 000 x g et 4 ° C pendant 30 min. Retirez délicatement le surnageant sans perturber le culot.
  11. Ajouter 500 ul d'éthanol à 80% (glacé) à la pastille et centrifuger à 16 000 x g et 4 ° C pendant 10 min. Sécher à l'air la pastille d'ADN à température ambiante et remise en suspension à fond dans 50 ul d'eau exempte de nuclease. Conserver les échantillons d'ADN à -20 ° C.

6. Les dosages PCR pour Quantifier PIC Activité

  1. Effectuer la première ronde PCR conventionnelle en utilisant des amorces ciblant le LTR viral et l'ADN phiX174 (LTR et PhiX174 amorces, respectivement) pour amplifier les jonctions du VIH-1 ADN intégré.
    1. Assembler le mélange PCR premier tour comme décrit dans le tableau 3. Assembler un mélange maître de tous les composants à l'exclusion de l'ADN modèle, distribuer des aliquotes de 45 pi dans des tubes de PCR séparés, et ajouter 5 ul d'ADN matrice ou de l'eau sans nucléase (contrôle).
    2. Faire la PCR dans un cycleur thermique en utilisant les conditions de cyclage thermique recommandées dans le tableau 4.
  2. Effectuer la deuxième ronde qPCR utilisant des amorces qui flanquent une courte région du LTR viral (LTR-R et LTR-U amorces) pour amplifier sélectivement les séquences vDNA intégrées de la première-round produits de PCR. Pour déterminer les nombres de copies intégrées vDNA, générer une courbe standard en utilisant des dilutions en série de 10 x nombres de copies connus (par exemple, 10 0 - 10 8) du clone moléculaire de VIH-1.
    1. Assembler le qPCR mélange deuxième ronde comme décrit dans le tableau 5. Assembler un mélange maître de tous les composants à l'exclusion de l'ADN modèle, soigneusement distribuer 25 aliquotes uL dans le nombre approprié de puits dans un 96 puits PCR plaque de réaction, puis ajouter 5 ul de la non purifiée au premier tour des produits de PCR ou de l'eau sans nucléase (contrôle). Effectuer toutes les réactions qPCR en triple.
    2. Chargez la plaque PCR dans l'instrument de PCR en temps réel et effectuer des qPCR en utilisant les conditions de cyclisme recommandées dans le tableau 6.
    3. Analyser les données en utilisant un logiciel approprié.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Isolement du VIH-1 PICs

Un schéma du protocole utilisé pour l'isolement du HIV-1 provenant de cellules PIP Sup-T1 infection aiguë est représenté sur la figure 1. Ce protocole est dérivé des méthodes décrites par Engelman et al. 19, 20. VIH-1 PICs sont complexes nucléoprotéine qui sont assemblés dans des cellules infectées et sont composées de l'vDNA de transcription inverse, les protéines virales et les facteurs cellulaires 19, 20. La méthode décrite dans le présent rapport utilise les extraits cytoplasmiques de cellules VIH-1-infected comme la source de l'activité d'intégration PIC associée.

Dans l' activité d'intégration in vitro du VIH-1 PICs

figure 2. Cette méthode utilise une stratégie basée imbriqué-qPCR pour mesurer l' activité IVI PIC associée, et les procédures sont adaptées, avec des modifications, des protocoles publiés par le laboratoire Engelman 19, 20, 21. Dans ce procédé, l'activité d'intégration PIC associée est déclenchée en fournissant un ADN cible linéaire hétérologue 21, et les produits d'ADN résultant de cette réaction d'intégration sont purifiés et utilisés comme matière de départ pour la quantification par PCR ultérieure. Dans le premier tour de PCR classique, les jonctions d'ADN viral-cibles sont amplifiés en utilisant des amorces appropriées. Dans le second tour qPCR, amorces LTR-spécifiques sont utilisés pour enrichir spécifiquement la population vDNA des produits de première ronde de PCR. S'il vous plaît voir le protocole sexion pour une description détaillée de cette méthode.

Les résultats représentatifs à partir d' un essai IVI effectuées à l' aide du VIH-1 PICs sont présentés dans la figure 3. Cellules Sup-T1 (80 x 10 6 cellules / infection) ont été spinoculated avec 30 ml de DNase 1-traitée du VIH-1 (~ 50 pg de p24 équivalent) en l'absence ou en présence de 1 uM VIH-1 IN inhibiteur raltégravir à 480 x g et à 25 ° C pendant 2 h. Les cellules ont ensuite été mises en culture pendant 5 h à 37 ° C et 5% de CO 2. PIP ont été isolés comme décrit dans la section du protocole. Les réactions ont été réalisées IVI, chacun utilisant 200 pi de PICS et 600 ng de l'ADN cible (un fragment d'ADN de 2 kb amplifié à partir phiX174 ADN par PCR) à 37 ° C pendant 45 min. Les réactions ont été déprotéinisés par la protéinase K en présence de SDS et de l'EDTA à 56 ° CO / N. Les produits de réaction ont été extraits deux fois avec du phénol, une fois avec un mélange phénol: chloroforme (1: 1) mélange, et une foisavec du chloroforme. Ensuite, l'ADN a été précipité à l'éthanol en présence de sel et le glycogène de co-précipitation et le culot d'ADN a été lavé une fois avec 80% d'éthanol. L'ADN purifié a été remis en suspension dans 50 ul d'eau exempte de nuclease. Une stratégie qPCR emboîtée a été utilisée pour déterminer le nombre de vDNA intégré dans l'ADN phiX174. Dans le premier cycle de PCR classique, des amorces complémentaires des séquences sur l'ADN cible et la région phiX174 virale LTR ont été utilisées pour amplifier les jonctions d'ADN viral cible intégrée à partir de 5 ul des produits d'ADN de la réaction d'intégration. Dans le second tour qPCR, amorces LTR-couvrant ont été utilisés pour amplifier exclusivement les séquences d'ADN spécifiques du VIH de 5 pi de la première ronde des produits amplicons et de 10 fois des dilutions en série de nombres de copies connus (10 8 -10 0) du clone moléculaire de VIH-1 (norme).

Toutes les réactions de qPCR ont été réalisées en triple exemplaire et les données were analysée à l'aide de logiciels commerciaux. Les valeurs dérivées des normes ont été tracées pour générer une courbe standard, à partir duquel les vDNA intégrés nombre de copies ont été interpolées. Les barres d'erreur représentent les écarts types. Comme on le voit sur la figure 3, le VIH-1 PIP intégrer solidement la vDNA associée à l'ADN cible (piste 5). Fait important, l'efficacité IVI de PICs a été considérablement réduite dans les réactions complétées avec l'inhibiteur de IN raltégravir (Lane 6). Cet attribut fortement l'activité d'intégration mesuré dans cet essai anti-VIH-1 IN. En outre, les réactions témoins contenant des lysats cytoplasmiques de cellules non infectées (piste 1), seuls PICs (piste 2), ciblent l'ADN seul (piste 3), et tampon seul (Lane 4) n'a montré aucune activité d'intégration. En outre, le contrôle qui exclue la Taq polymérase dans le premier tour de PCR (Lane 7) n'a pas amplifier les produits d'intégration. Notamment, les données de la PICs-seul contrôle (Lane 2) ont indiqué que le imbriquée qPCR stratégie spécifitiquement mesure la vDNA intégrée, mais pas la vDNA PIC associée. Collectivement, ces données démontrent la mesure de l'activité d'intégration PIC associé.

Figure 1
Figure 1: Représentation schématique du Protocole pour la préparation du VIH-1 PICs. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Des extraits cytoplasmiques contenant PICS sont isolés à partir des cellules Sup-T1 HIV-1-infected. Ces photos sont utilisées en tant que source d'activité de l' intégration dans l'analyse in vitro d'intégration.

Figure 2
Figure 2: Représentation schématique de l'in vitro m> Intégration Test du VIH-1 PICs. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Tests d'intégration ont été réalisées in vitro en utilisant le VIH-1 PICs et la cible hétérologue phiX174 ADN. L'ADN du VIH-1 intégré a été mesurée par une stratégie de PCR nichée, dans lequel le premier tour de PCR classique amplifie les jonctions d'intégration à partir desquels des séquences vDNA spécifiques sont de préférence amplifié dans un second tour de PCR quantitative.

figure 3
Figure 3: le VIH-1 PIC associée vDNA Activité d' intégration. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

"Fo: keep-together.within-page =" 1 "> Les résultats représentatifs de l'analyse de l'activité d'intégration du VIH-1 PIC associée Les vDNA intégrés nombre de copies ont été déterminées en traçant des valeurs dérivées à partir d'une courbe standard générée à l'aide 10x dilutions en série de. les nombres de copies connus d'un clone moléculaire de VIH-1. Toutes les réactions ont été réalisées en triple exemplaire et les données ont été analysées en utilisant un logiciel commercial. les barres d'erreur représentent les écarts types.

Composant Stock Le volume final de réaction de 50 ul
phiX174 ADN plasmidique 10 ng / ul 5,0 ul
un tampon de réaction GoTaq 5x 10,0 pi
dNTP nucléotide mélange 10 mM chacun 1,0 ul
phiX174-F amorce 10 pm 2,5 ul
phiX174-R amorce 10 pm 2,5 ul
GoTaq DNA Polymerase (5 U / pl) 0,25 pi
l'eau distillée exempte de nucléase - 28.75 pi

Tableau 1.

95 ° C = 2 min
Cycle 34 répétitions de:
95 ° C = 30 s
53 ° C = 30 s
72 ° C = 2 min
72 ° C = 10 mn
4 ° C = Attente

Tableau 2.

Composant Stock Le volume final de réaction de 50 ul
produit d'ADN de réaction IVI - 5,0 ul
un tampon de réaction GoTaq 5x 10,0 pi
dNTP nucléotide mélange 10 mM chacun 1,0 ul
LTR primaire 10 pm 2,5 ul
phiX174 primaire 10 pm 2,5 ul
GoTaq DNA Polymerase (5 U / pl) 0,25 pi
l'eau distillée exempte de nucléase - 28.75 pi

Tableau 3.

95 ° C = 5 min
Cycle 23 répétitions de:
94 ° C = 30 s
55 ° C = 30 s
72 ° C = 4 min
72 ° C = 10 mn
4 ° C = Attente

Tableau 4.

<td> Taqman Probe
Composant Stock Le volume final de la réaction de 30 ul
1 er tour des produits de PCR - 5,0 ul
LTR-R amorce 10 pm 0,9 pi
LTR-U primaire 10 pm 0,9 pi
10 pm 0,3 pi
iQ Supermix 2x 15,0 pi
l'eau distillée exempte de nucléase - 7,9 pi

Tableau 5.

95 ° C = 3 min
Cycle 39 répétitions de:
94 ° C = 15 s
58 ° C = 30 s
72 ° C = 30 s
Plate Lire

Tableau 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Les analyses biochimiques de PICs rétrovirales ont fourni des informations critiques dans le mécanisme de l'intégration de l'ADN rétroviral. La mesure de l'activité d'intégration des PIC rétroviraux peut être obtenue par un essai de formation de plaque, l'analyse par transfert de Southern et emboîtée qPCR. La stratégie expérimentale de l' essai sur plaque est laborieuse et utilise une méthode indirecte pour mesurer l' intégration 6, 7, 18. Southern blot base-essais mesure l' intégration directe , mais nécessite des quantités relativement élevées de PICs 6, 7, 18.

Ce rapport détaille une stratégie qPCR imbriquée pour mesurer le VIH-1 activité d'intégration PIC associée in vitro. L'avantage et l' importance de cette méthode importante est l'exigence de quantités relativement faibles de la préparation des PIC par réaction 4, 5, 19. Les étapes les plus critiques de ce procédé sont la génération d'un virus à titre élevé pour l'infection et la manipulation de la préparation PIC. Il convient de noter ici que le premier cycle de PCR implique une amplification exponentielle des jonctions d'intégration. Par conséquent, les nombres de copies intégrées vDNA déterminées au second tour qPCR sont semi-quantitative et, par conséquent, ont la limitation de ne pas donner une mesure de vDNA copies PIC associée. Cependant, le vDNA PIC associé peut être déterminée par PCR quantitative de l'ADN purifié à partir d'images avec des amorces LTR-spécifiques. Le rapport des vDNA intégrés nombre de copies à l'vDNA PIC associée correspondante peut fournir des informations sur l'efficacité de l' intégration d'une réaction in vitro d'intégration. Ce procédé peut être modifié en incorporant un autre ADN cible hétérologue de choix et d'autres amorces pour détecter l'intégration dans les deux orientations. En résumé, le procédédécrit ici mesure l'activité d'intégration du VIH-1 PICs quantitativement et peut être adoptée pour la recherche le développement d'une compréhension des détails biochimiques de l'intégration rétrovirale.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent aucun intérêt financiers et non financiers concurrents.

Acknowledgments

Ce travail est en partie financé par des subventions DA024558, DA30896, DA033892 et DA021471 du NIDA / NIH sur CD. Nous reconnaissons également l'octroi G12MD007586 RCMI, le Vanderbilt CSTC accorder UL1RR024975, le Meharry Translational Research Center (MeTRC) CTSA subvention U54 de RR026140 du NCRR / NIH, le MD007593 U54 de subvention du NIMHD / NIH, et le Tennessee CFAR subvention P30 AI110527.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
Mesure de<em&gt; In vitro</em&gt; Activité d&#39;intégration du VIH-1 préintégration Complexes
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter