Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

מדידה doi: 10.3791/54581 Published: February 22, 2017

Abstract

חלבוני מעטפת HIV-1 לעסוק קולטנים מאותו מקור על פני תא היעד, מה שמוביל היתוך קרום ויראלי תאים ואחריו שחרורו של קפסיד ויראלי (CA) הליבה לתוך הציטופלסמה. בהמשך לכך, transcriptase ההפוכה ויראלי (RT), כחלק ממכלול nucleoprotein שם כינתה את השעתוק לאחור המורכב (RTC), ממיר את גנום RNA חד-גדילי ויראלי לתעתיק פעמי גדילי דנ"א (vDNA). זה מוביל biogenesis של אחר מורכבי nucleoprotein, כינה את המורכבות ואינטגרציה-מראש (PIC), מורכבת vDNA וחלבוני הווירוס קשור וגרם מארח. Integrase ויראלי הקשורים PIC (IN) מנצח על אינטגרציה של vDNA לתוך דנ"א כרומוזומלי המארח תהליך בן שני שלבים מוסדר temporally מרחבית. ראשית, בתהליכים הקצוות "3 של vDNA בציטופלסמה, ושנית, לאחר PIC traffics לגרעין, שהוא מתווך אינטגרציה של vDNA מעובד לתוך ה- DNA כרומוזומלי. התמונות מבודדותמתאי היעד נגועים בחריפות עם HIV-1 הם פונקציונליים במבחנה, כפי שהם המוסמכות לשלב את vDNA הקשורים לתוך ה- DNA היעד אקסוגני הוסיף Heterologous. PIC מבוסס כאלה מבחני אינטגרציה במבחנה תרם תרומה משמעותית לתחום את הפרטים מכניסטית של אינטגרצית retroviral וכדי לגלות לפי מעכבים. בדו"ח זה, אנו לפרט על ב assay עודכן HIV-1 PIC המעסיקה תגובת שרשרת פולימראז כמותיים מקוננת בזמן אמת (qPCR) אסטרטגיה מבוססת למדידת פעילות האינטגרציה חוץ גופייה של תמונות יליד מבודדות.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1 שכפול בתא היעד כרוך שלבים מרובים, מקובצים באופן כללי לשתי שלבים: אירועים מוקדמים ומאוחרים. האירועים מוקדם להתחיל כאשר ברצף HIV-1 נקשר לקולטן תא המטרה CD4 ואחד משני הקולטנים-שיתוף (CCR5 או CXCR4) 1. כתוצאה מכך, את פתיל ממברנות תאי וירוס, ואת קפסיד ויראלי (CA) ליבה הוא שוחרר לתוך הציטופלסמה 2. ליבת CA מכיל את רנ"א חד-גדילי גנומית ויראלי (ssRNA) וכמה חלבונים, הן ויראליות הסלולר במקורם. החלבונים ויראלי קשורים CA כוללים transcriptase ההפוכה (RT) ואת אינטגראז (IN), שני אנזימים אשר מתווכים שלבים קריטיים במהלך אירועים מוקדם בשכפול נגיף. קל RT ו בתפקוד בהקשר של מתחמי nucleoprotein, כלומר מורכבים שעתוק לאחור (RTC) ואת מורכבות מראש אינטגרציה (PIC), בהתאמה 3, 4, 5 <sup>, 6. הקצות חוזרות מסוף נמל הגנום הנגיפי ssRNA (R) אלמנטים סמוכים אל U5 הרצפים הייחודי (ב 5 'בסוף) ו- U3 (על 3' בסוף). RTC ממיר את הגנום ssRNA ויראלי לתעתיק פעמיים גדילי דנ"א (DS) (vDNA). תהליך השעתוק לאחור זה גם גרם שכפול של רצפי U5 ו- U3, ובכך לייצר חוזר מהסוף ארוך (LTR) בשני הקצוות של vDNA 7, 8. כתוצאה מכך, לפי קשור PIC מזרז שתי תגובות ביוכימיות רציפות המאפשרות את האינטגרציה של vDNA לתוך כרומוזום מארח 9, 10, 11. ראשית, בציטופלסמה, לפי multimers לעסוק הן Ltrs 12 וידבק dinucleotide מכל הקצוות 3'-סופנית. עיבוד 3'-סוף זה מפיק קבוצת הידרוקסיל בכל 3'-end (CA OH) של vDNA.לאחר מכן, PIC traffics לגרעין, שבו לפי משתמשת CA vDNA OH בתור נוקלאופיל לחתוך שני הגדילים של ה- DNA כרומוזומלי בצורה מדורגת. במקביל, מתואם שזור בשני הקצוות של vDNA אל קשר פוספודיאסטרי וכתוצאה מכך על גדילים השניים של דנ"א כרומוזומלי. בעקבות צעד העברת גדיל זה, מנגנון תא המארח מסיר את שני נוקלאוטידים מזווגים בקץ '5 של vDNA ומתקן את הפערים חד גדילים שהתפתחו בצומת של אתר האינטגרציה. האירועים מוקדם ובכך לשיאה עם הקמת עותק דנ"א משולב (provirus) של הגנום HIV-1. Provirus מספק סביבה מתאימה עבור ביטוי גנים ויראלי יעיל, אשר יוזם אירועים מאוחרים יותר, כולל את הביטוי של חלבונים המקודדים וירוס; הרכבה של וירוס לא בשלה; ניצנים, שחרור, והתבגרות לתוך virions זיהומיות 13.

לפי retroviral רקומביננטי מזוכך מוסמךלבצע, במבחנה, פעילויות 3'-end עיבוד גדיל העברה הן מסופקות אקסוגני DNA מצע LTR דמוי. מחקרים ביוכימיים באמצעות IN רקומביננטי מזוכך כגון חשפו היבטים קריטיים של אינטגרציה vDNA 14, 15, 16, 17. עם זאת, שלא כמו זיהום טבעי, תגובה ביוכימית במבחנה זה אינו תומך אינטגרציה מתואמת של שני הקצוות של DNA המצע לתוך ה- DNA היעד. לעומת זאת, התמונות retroviral מבודד תאים נגועים בחריפות המטפלים יחדיו לשלב את שני הקצוות של vDNA אנדוגני לתוך ה- DNA היעד Heterologous. זה הוביל את האימוץ הנרחב והחידודים הבאים של לי n אינטגרצית Vitro (IVI) מבחנים באמצעות תמונות יליד מבודדות.

בחודש הראשון דיווח assay IVI retroviral, תמציות ציטופלסמית מתאים נגועים Murine רקומביננטיוירוס לוקמיה (MLV) מחסה הגן coli supF א ב LTR שלה ששימשו כמקור הפעילות, ואת ה- DNA של הפאג למבדה מוטציה פגום בצמיחה ממס סופק אקסוגני כמו ה- DNA היעד. השתלבות מוצלחת של ה- DNA MLV רקומביננטי להעתיק לתוך ה- DNA הפאג והביטוי supF שהתפתח הוביל לשיקום היכולת להרכיב פלאק של לפאגים רקומביננטי. עם זאת, אסטרטגיה זו ניסיוני הוא שילוב מייגע צעדים בדרך עקיפה. כדי לטפל אזהרות כאלה, assay תיוג-הסוף עקיף דרום מבוסס כתם, אשר מכמת את פעילות IVI הקשורים PIC כאמצעי של vDNA אנדוגני משולב DNA phiX174 בקטריופאג לינארית אקסוגניים, פותח 6, 7, 18. למרות בשיטה זו מספקת מדידה ישירה של אירועי אינטגרציה, כמויות גבוהות יחסי של הכנת PIC נדרשות, אשר נשארה מאתגר מבחינה טכניתמַאֲמָץ. כדי לעקוף זאת, מבחני PCR מבוססי מקוננות המחייב רק כמויות צנועות של תמונות פותחו 4, 5, 19.

בדו"ח זה, אנו מתארים גרסה מעודכנת של PCR מבוסס מקוננות שיטה במבחנה המציאה כדי לשחזר את פעילות אינטגרצית HIV-1 PIC בתיווך המתרחשת בזמן הדבקה טבעית. שיטה זו משתמשת תמציות cytoplasmic של תאי יעד HIV-1-נגועים כמקור פעילות PIC האנדוג'ינוס נמדד עם תגובת שרשרת פולימראז כמותיים בזמן אמת (qPCR). הנהלים לבידוד תמונות מדידים פעילויות האינטגרציה שלהם מותאמים, עם שינויים, מתוך פרוטוקולים שפורסמו על ידי מעבדת אנגלמן 20. בשיטה זו, פעילות האינטגרציה הקשורים PIC היא שיזמה מתן DNA היעד ליניארי אקסוגניים 21, ואת מוצרי DNA הנובעיםתגובת שילוב הזה הוא מטוהר ושמשה החומר המוצא של כימותים מבוססים PCR הבא. בשנות ה PCR קונבנציונאלי בסיבוב הראשון, הצמתים DNA הנגיפי-היעד הם מוגבר באמצעות פריימרים מתאימים. ב-הסיבוב השני qPCR, פריימרים ספציפיים LTR משמשים להעשרת האוכלוסייה vDNA במיוחד מן המוצרים PCR-בסיבוב הראשון. נא עיין בסעיף פרוטוקול תיאור מפורט של שיטה זו.

במחקרים במבחנה עם התמונות retroviral הובילו להתקדמות משמעותית להבנתנו את מנגנון האינטגרציה DNA retroviral ו בפיתוח מעכבי IN. בהתבסס על ההתמקדות ההולכת וגוברת לאחרונה באתרי אינטגרציה HIV-1 מיפוי, בקביעת התפקיד של גורמים נגיפיים המארח אינטגרצית HIV-1, ופיתוח תרופות אנטי חדשות כלפי במאבק עמיד לתרופות, אנחנו מדמיינים התעניינות מוגברת ואת שימוש נרחב של מבחני IVI , כמו זה המתואר בדו"ח זה. זה, בתורו, יביאחידודים בעתיד בשיטה, ובכך לגוון את טווח היישומים שלה.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הפקת וירוס 1.

הערה: כדי ליצור כותרות גבוהות של HIV-1 זיהומיות, transfect כליה עוברית האנושי (HEK) שורת התאים 293T עם שיבוט מולקולרי זיהומיות HIV-1 באמצעות מגיב transfection מבוסס dendrimer מופעל. זה נצפה כי שיטת סידן פוספט transfection מניבה תוצאות דומות.

  1. בתוך 2 רמת בטיחות ביולוגית (BSL2) במעבדה, זרע 3 x 10 6 293T תאים לכל 10 צלחת ס"מ 8 מ"ל של מדיום הנשר שונה של Dulbecco (DMEM) בתוספת 10% עוברית שור סרום (FBS), פניצילין, סטרפטומיצין. התרבות התאים להגדיר באינקובטור ב 37 מעלות צלזיוס, 5% CO 2 O / N.
  2. למחרת, עבור transfecting תאים בכל צלחת 10 ס"מ, לדלל 8 מיקרוגרם של ה- DNA פלסמיד pNL4-3 (ראה לוח חומרים) לנפח סופי של 300 μL של DMEM חסר בסרום ואנטיביוטיקה. הוסף 80 μL של מגיב transfection, ומערבבים היטב על ידי pipetting ו דגירה ב RT עבור5 - 10 דקות להיווצרות מורכבת transfection.
  3. הוצא את המדיה המנות על ידי שאיפה ולהוסיף 7 מ"ל לכל צלחת של DMEM טריים המכילה סרום ואנטיביוטיקה.
  4. הוסף 1 מ"ל של DMEM המכילה סרום ואנטיביוטיקה למתחם transfection, ומערבבים על ידי pipetting, ולהוסיף את התערובת אל התאים. מערבולת בעדינות את המנה כדי להקל חלוקה שווה של קומפלקסים transfection.
  5. מיד להעביר את התאים במעבדה BSL3, מקום להגדיר באינקובטור ב 37 מעלות צלזיוס, 5% CO 2, והתרבות התאים למשך 48 שעות.
  6. אסוף את supernatant תרבות רקמה המכילה וירוס בעזרת פיפטה ולאחר מכן להעביר אותו צינור צנטריפוגות. צנטריפוגה XG ב 300 במשך 5 דקות עד גלולה התאים ופסולת, ולאחר מכן לסנן את supernatant דרך פילטר מזרק 0.45 מיקרומטר נקבוביות בגודל.
  7. על מנת להפחית את פלסמיד דנ"א שריד כהכנה וירוס תא ללא זה, לטפל עם DNase 1 (20 מיקרוגרם / מ"ל) ב 37 מעלות צלזיוס למשך 1 שעה.
  8. כדי לכמת אתכייל HIV-1, השתמש Assay immunosorbent Enzyme-linked ספציפי-p24 (ELISA), כפי שהוא שיטה מהירה נוחה לשימוש שגרתי 22.
    הערה: יצוין כי p24 ELISA מודד את כייל הפיזי (מספר חלקיקי נגיף). לחלופין, מדידת פעילות RT הקשורים וירוס (assay RT אקסוגניים) או infectivity וירוס (TZM-bl תא מחוון קו מבוססי מבחני infectivity) תספק ההודעה הבלעדית של חלקיקי נגיף מדבק.

2. וירוסים זיהום של תאים Sup-T1 (Lab BSL3)

  1. במעבדה BSL2, לשמור על תאים Sup-T1 בין 1.0 x 10 6 ו 2.0 x 10 6 תאים / מ"ל מכון הזיכרון רוזוול פארק (RPMI) בינוני בתוספת 10% חום מומת FBS, פניצילין, סטרפטומיצין (ביחס פיצול של 1 : 2 כל 2 - 3 ד). פינת התאים Sup-T1 מן צלוחיות תרבות, ומערבבים היטב על ידי pipetting, ולקבוע את ספירת תאי קיימא באמצעות hemocytometer ואת הרחקה כחול trypan staining שיטה.
    1. הכן את המספר הדרוש של aliquots של 80 x 10 6 תאים (מחיר זיהום בנגיף) ב 50 מבחנות צנטריפוגה חרוטי מ"ל.
    2. צנטריפוגה התאים ב הרוטור מתנדנד דלי XG ב 500 ו 25 מעלות צלזיוס למשך 5 דקות. מבלי להסיר את תרבית תאים הבינונית, להעביר את הצינורות המכילים תאי pelleted למעבדת BSL3 לעיבוד נוסף. בזהירות לשאוב את מדיום תרבית תאים מהצינור מבלי להפריע גלולת התא.
  2. הוספת כמות מתאימה של בידוד וירוס שטופל אני DNase אל התאים בצינור ומערבב היטב על ידי pipetting העדין. עבור 80 x 10 6 תאים, השתמש 30 מ"ל של DNase וירוס אני שטופלו (50 מיקרוגרם של וירוס p24-שווה ערך).
    הערה: בידוד של תמונות פונקציונליות דורש הדבקה של תאי היעד עם multiplicities גבוהה מאוד של זיהום (משרד פנים).
  3. פזר את התערובת באופן שווה בין שתי צלחות תרבית הרקמה 6-היטב (כלומר 12 x aliquots 2.5 מ"ל; להשתמש 2 צלחות לכל להדביקיוֹן).
  4. לקבלת spinoculation, במקום צלחות תרבות בנשאיות צלחת צנטריפוגות באמצעות הרוטור דלי מתנדנד ב 480 XG ו -25 מעלות צלזיוס למשך 2 שעות.
  5. דגירת תאי spinoculated ב 37 מעלות צלזיוס, 5% CO 2 למשך 5 שעות.

קציר 3. תמוגה של תאים נגועים (מעבדת BSL3)

  1. לרכז את התאים המתאימים לכל זיהום מהצלחות תרבות לתוך צינור צנטריפוגות חרוטי 50 מ"ל (~ 30 מ"ל בסך הכל).
  2. קציר התאים על ידי צנטריפוגה XG ב 300 ו 25 מעלות צלזיוס למשך 10 דקות. בזהירות לשאוב supernatant מהצינור (לחילופין, להשתמש פיפטה).
  3. למען הסר חלקיקים נגיפיים שיורית, לשטוף כל גלולה התא על ידי הוספת 2 מ"ל של חיץ K - / - (150 מ"מ KCl, 20 HEPES מ"מ, pH 7.6, 5 מ"מ MgCl 2) ו צנטריפוגה מדגם XG ב 300 ו 25 מעלות צלזיוס למשך 10 דק. ואז, מבלי להפריע גלולה, להסיר בזהירות את supernatant על ידי שאיפה או באמצעות פיפטה.
  4. Repeat צעד 3.3.
  5. מוציאים בזהירות כל חיץ שיורית באמצעות micropipette. Resuspend כל גלולה תא 2 מ"ל של K חיץ תמוגה קר כקרח + / + (Buffer K - / - השלימו עם digitonin 0.025%, 1 מ"מ DTT, 20 מיקרוגרם / מ"ל aprotinin), לערבב תוכן על ידי pipetting עדין, ומעבירים צינור 2 מ"ל microcentrifuge.

4. הכנת תמונות cytoplasmic (מעבדת BSL3)

  1. רוק דגימות על שייקר רוטרי ב RT במשך 10 דקות.
  2. צנטריפוגה דגימות, עם הרוטור precooled עד 4 מעלות צלזיוס, ב 1500 XG ו -4 מעלות צלזיוס למשך 4 דקות.
  3. מבלי להפריע גלולה, בזהירות להעביר את supernatant לצינור צנטריפוגות microcentrifuge טריים XG 16,000 ו -4 מעלות צלזיוס במשך 1 דקות.
  4. להעביר בזהירות את supernatant לצינור microcentrifuge טרי. הוסף RNase (20 מ"ג / מ"ל) לריכוז סופי של 20 מיקרוגרם / מ"ל ​​(2 μL עבור 2 מ"ל של התמונות) דגירה את התוכן ב RT במשך 30 דקות (לא נדנדה). </ Li>
  5. הוספת סוכרוז (60% w / v במאגר K - / -) לריכוז סופי של 7% ומערבבים היטב על ידי pipetting עדין. הכן aliquots (למשל, 200 μL) של התמונות צינורות microcentrifuge, פלאש להקפיא בחנקן נוזלי, ומניחים במקפיא -80 ° C עבור אחסון לטווח ארוך.

5. שילוב Vitro (IVI) מבחני שימוש HIV-1 תמונות

  1. הכן את ה- DNA היעד בשימוש assay IVI ידי הגברה אזור 2.0 kb מ- DNA פלסמיד phiX174 עם PCR באמצעות פריימרים מחוייט, phiX174-F ו phiX174-R.
    1. הרכב את תערובת PCR כמתואר בטבלה 1. בצע PCR ב Cycler תרמית באמצעות תנאי רכיבת התרמית מומלצים בטבלה 2. ג'ל לטהר את מוצר ה- PCR באמצעות ערכת ג'ל לטיהור (בעקבות פרוטוקול יצרן מומלץ), ולאחסן את ה- DNA היעד המטוהר כמו aliquots ב -80 ° C עד שימוש.
  2. להוסיף 600 ננוגרם של DNA היעד ל -200 - & #181; aliquot של תמונות L, לערבב היטב, דגירה על 37 מעלות צלזיוס למשך 45 דקות.
    הערה: תגובות IVI השמטת DNA היעד או כוללות מעכבי אינטגראז (למשל, Raltegravir) מומלצות תגובות שליטות.
  3. עצור את התגובה IVI ידי הוספת SDS, EDTA, ו proteinase K לריכוזים סופי של 0.5%, 8 מ"מ, ו -0.5 מ"ג / מ"ל, בהתאמה. מערבבים את התוכן תגובה ביסודיות דגירה לילה בשעה 56 ° C.
  4. למחרת, לטהר את ה- DNA הכולל מן התגובה IVI על ידי מיצוי פנול / כלורופורם משקעים אתנול. לבצע את כל הפעולות צנטריפוגה ב XG 16,000 ו RT.
  5. הוסף נפח שווה של פנול מדגם deproteinized, לערבב נמרצות על ידי vortexing, צנטריפוגות במשך 2 דקות. מוציא בזהירות את השלב מהימי העליון ולהעביר אותו צינור טרי.
  6. חזור על שלב 5.5. מעביר את השלב מהימי העליון לצינור טרי.
  7. הוסף נפח שווה של 1: פנול 1: תערובת כלורופורם, לערבב נמרצות על ידי vortexing, צנטריפוגות FO r 2 דקות. מעביר את השלב מהימי העליון לצינור טרי.
  8. הוסף נפח שווה של כלורופורם, לערבב נמרצות על ידי vortexing, צנטריפוגות במשך 2 דקות. מעביר את השלב מהימי העליון לצינור טרי.
  9. כדי לזרז DNA, להוסיף גליקוגן לריכוז סופי של 0.1 מיקרוגרם / μL, 3 M של נתרן אצטט לריכוז סופי של 0.3 M, ו 2.5 כרכים של 100% אתנול (קרים כקרח). וורטקס לערבב, בקצרה צנטריפוגות כדי לאסוף את התוכן, ולמקם את הצינור ב -80 ° CO / N.
  10. למחרת, צנטריפוגות מדגם למשך 30 דקות ב XG 16,000 ו -4 מעלות צלזיוס למשך 30 דקות. מוציאים בזהירות את supernatant מבלי להפריע גלולה.
  11. הוספת 500 μL של 80% אתנול (קרים כקרח) על גלולה ו צנטריפוגות ב XG 16,000 ו -4 מעלות צלזיוס למשך 10 דקות. אוויר יבש גלולה DNA ב RT וביסודיות resuspend ב 50 μL של מים nuclease חינם. אחסן את דגימות ה- DNA ב -20 ° C.

6. מבחני PCR עבור פעילות כימות PIC

= "Jove_content"> הערה: העותק מספר HIV-1 DNA משולב לתוך ה- DNA היעד הוא לכימות על ידי אסטרטגיה מקוננת PCR המעסיקה 2 סטים של פריימרים ו -2 סיבובים רציפים של PCR.

  1. בצעו את PCR קונבנציונאלי בסיבוב הראשון באמצעות פריימרים מיקוד LTR ויראלי והדנ"א phiX174 (פריימרים LTR ו phiX174, בהתאמה) כדי להגביר את צמתים של דנ"א HIV-1 משולב.
    1. הרכב את התערובת בסיבוב הראשון PCR כמתואר בטבלה 3. להרכיב תערובת אמן של כל הרכיבים למעט ה- DNA תבנית, לוותר aliquots 45 μL לתוך צינורות PCR נפרד, ולהוסיף 5 μL של תבנית ה- DNA או מים חופשי nuclease (שליטה).
    2. בצע PCR ב Cycler תרמית באמצעות תנאי רכיבת התרמית מומלצים בטבלה 4.
  2. בצע את הסיבוב השני qPCR באמצעות פריימרים כי האגף אזור קצר של LTR ויראלי (LTR-R ו- פריימרים LTR-U) כדי להגביר את רצפי vDNA משולב באופן סלקטיבי מן-ro הראשוןמוצרי und PCR. כדי לקבוע את vDNA משולבת להעתיק מספרים, ליצור עקומה רגילה באמצעות 10x דילולי סדרה של מספרי עותק ידועים (למשל, 10 10 - 0 8) של השיבוט המולקולרי HIV-1.
    1. הרכב את התערובת בסיבוב השני qPCR כמתואר בטבלה 5. להרכיב תערובת אמן של כל הרכיבים למעט ה- DNA תבנית, לוותר בקפידה 25 aliquots μL לתוך המספר המתאים של בארות בצלחת התגובה 96-היטב PCR, ולאחר מכן להוסיף 5 μL של מוצרי ה- PCR בסיבוב הראשון unpurified או nuclease ללא מים (לִשְׁלוֹט). בצע את כל התגובות qPCR בשלושה עותקים.
    2. טען את הצלחת ה- PCR לתוך מכשיר PCR בזמן אמת ולבצע qPCR באמצעות התנאים אופניים מומלץ בטבלה 6.
    3. לנתח את הנתונים באמצעות תוכנה מתאימה.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בידוד של HIV-1 תמונות

סכמטי של הפרוטוקול המשמש לבידוד של תמונות HIV-1 מ בחריפות נגוע בתאי Sup-T1 מתואר באיור 1. פרוטוקול זה נגזר השיטות שתוארו על ידי אנגלמן et al. 19, 20. תמונות HIV-1 הן מתחמי nucleoprotein כי הם התאספו בתאים נגועים והם מורכבים של vDNA-עבד ההפוך, חלבונים נגיפיים, וגרם הסלולר 19, 20. השיטה המתוארת בדוח זה משתמשת תמציות cytoplasmic של תאים HIV-1-נגועים כמקור פעילות האינטגרציה הקשורים PIC.

בפעילות אינטגרציה במבחנה של HIV-1 תמונות

EP-together.within-page = "1"> סכמטי של שיטת מדידת פעילות IVI של תמונות HIV-1 מוצג באיור 2. בשיטה זו משתמשת באסטרטגית qPCR מבוססת מקוננות למדידת פעילות IVI הקשורים PIC, ואת הנהלים מותאמים, עם שינויים, מתוך פרוטוקולים שפורסמו על ידי מעבדת אנגלמן 19, 20, 21. בשיטה זו, פעילות האינטגרציה הקשורים PIC היא שיזמה מתן DNA היעד ליניארי Heterologous 21, ואת מוצרי DNA נובע תגובת שילוב הזה הם מטוהרים המשמשים כחומר המוצא כימותים מבוססים PCR הבא. בשנות ה PCR קונבנציונאלי בסיבוב הראשון, הצמתים DNA הנגיפי-היעד הם מוגבר באמצעות פריימרים מתאימים. ב-הסיבוב השני qPCR, פריימרים ספציפיים LTR משמשים להעשרת האוכלוסייה vDNA במיוחד מן המוצרים PCR-בסיבוב הראשון. עיין של הפרוטוקולשיקוף עבור תיאור מפורט של שיטה זו.

תוצאות נציגה ב assay IVI בוצעו באמצעות תמונות HIV-1 מוצגות באיור 3. SUP-T1 תאים (80 x 10 6 תאים / זיהום) היו spinoculated עם 30 מ"ל של DNase 1 שטופלו HIV-1 (~ 50 מיקרוגרם של שווה ערך p24) בהעדר או נוכחות של 1 מיקרומטר HIV-1 IN מעכב Raltegravir ב 480 XG ו -25 מעלות צלזיוס למשך 2 שעות. התאים היו ובהמשך בתרבית למשך 5 שעות ב 37 מעלות צלזיוס, 5% CO 2. תמונות היו מבודדות כפי שתוארו בסעיף בפרוטוקול. תגובות IVI בוצעו, כל שימוש 200 μL של תמונות 600 ng של DNA היעד (קטע DNA 2 kb המוגבר מ- DNA phiX174 ידי PCR), על 37 מעלות צלזיוס למשך 45 דקות. התגובות היו deproteinized ידי טיפול proteinase K בנוכחות SDS ו EDTA ב 56 מעלות CO / N. מוצרי התגובה חולצו פעמים עם פנול, פעם עם פנול: כלורופורם (1: 1) תערובת, ופעםעם כלורופורם. בהמשך לכך, ה- DNA היה אתנול זרז בנוכחות מלח ואת גליקוגן שיתוף הנמהר, לבין גלולת DNA נשטפה פעם עם 80% אתנול. ה- DNA המטוהר היה resuspended ב 50 μL של מי nuclease חינם. אסטרטגית qPCR מקוננות שמשה כדי לקבוע את מספר vDNA השתלב DNA phiX174. בשנתי ה PCR הקונבנציונלי בסיבוב הראשון, תחל משלימה רצפים על ה- DNA יעד phiX174 ואזור LTR ויראלי שמשה כדי להגביר את צומת DNA נגיפי-יעד המשולב בין 5 μL של מוצרי ה- DNA תגובת אינטגרציה. ב-הסיבוב השני qPCR, LTR-פורש פריימרים שימשו אך ורק להגביר את רצפי DNA ספציפיות ל- HIV מ 5 μL של מוצרי amplicon בסיבוב הראשון והחל מה -10 דילולים סדרתי של מספרים עותק ידוע (10 8 -10 0) של שיבוט מולקולרי HIV-1 (התקנים).

כל התגובות qPCR בוצעו בשלושה עותקים והנתונים werהדואר נותח באמצעות תוכנה מסחרית. הערכים הנגזרים הסטנדרטים היו זממו ליצור עקומת סטנדרט, שממנה vDNA משולבת להעתיק מספרים היו אינטרפולציה. ברי שגיאה מייצגים את סטיית התקן. כפי שניתן לראות באיור 3, התמונות HIV-1 וחסונה לשלב את vDNA הקשורים לתוך ה- DNA היעד (Lane 5). חשוב לציין, את היעילות IVI של התמונות היתה פחותה בהרבה בתגובות השלימו עם מעכב לפי Raltegravir (ליין 6). זה מאוד מייחס את פעילות האינטגרציה נמדדת assay זה כדי HIV-1. יתר על כן, התגובות המלאות המכילות lysates ציטופלסמית מתאים נגועים (הליין 1), התמונות לבד (ליין 2), למקד DNA בלבד (מסלול 3), ו חוצצים לבד (מסלול 4) לא הראו שום פעילות אינטגרציה. בנוסף, השליטה שהדירה פולימראז תקי בסיבוב הראשון PCR (Lane 7) לא להגביר מוצרי אינטגרציה. יצוין, כי הנתונים משלט pics-לבד (ליין 2) עולים כי ספציפי האסטרטגיה qPCR מקוננתקאלי מודד את vDNA המשולב אבל לא vDNA הקשורים PIC. ביחד, נתונים אלה מדגימים את מדידת פעילות האינטגרציה קשור PIC.

איור 1
איור 1: ייצוג סכמטי של הפרוטוקול לעריכת תמונות HIV-1. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

תמציות cytoplasmic המכילות תמונות מבודדות מתאי Sup-T1 HIV-1-נגועים. התמונות האלה משמשים כמקור פעילות האינטגרציה ב assay אינטגרציה חוץ גופית.

איור 2
איור 2: ייצוג סכמטי של במבחנה m> Assay האינטגרציה של HIV-1 תמונות. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

מבחני אינטגרציה בוצעו במבחנה באמצעות תמונות HIV-1 ואת היעד Heterologous DNA phiX174. הדנ"א HIV-1 המשולב נמדד על ידי אסטרטגית PCR מקוננת, שבה PCR הקונבנציונלי בסיבוב הראשון מגביר צומת האינטגרציה שממנו הרצפים vDNA הספציפיים הם מוגברים מועדף א-סיבוב שני qPCR.

איור 3
איור 3: HIV-1 PIC הקשורים vDNA שילוב פעילות. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

"FO: keep-together.within-page =" 1 "> תוצאות נציג של assay HIV-1 PIC הקשורים בפעילות אינטגרציה vDNA משולבת להעתיק מספרים נקבעו על ידי התוויית ערכי הנגזרות עקומת סטנדרט שנוצר באמצעות 10x דילולים סדרתי של. מספרי עותק ידועים של שיבוט מולקולרי HIV-1. כל התגובות בוצעו בשלושת עותקים ואת הנתונים נותחו באמצעות תוכנה מסחרית. ברי שגיאה מייצגים את סטיית התקן.

רְכִיב המניה נפח סופי עבור 50 תגובה μL
phiX174 פלסמיד דנ"א 10 ng / μL 5.0 μL
מאגר התגובה GoTaq 5x 10.0 μL
תמהיל נוקלאוטיד dNTP 10 מ"מ כל 1.0 מיקרוליטר
פריימר phiX174-F 10 מיקרומטר 2.5 μL
פריימר phiX174-R 10 מיקרומטר 2.5 μL
GoTaq DNA פולימראז (5 U / μL) 0.25 μL
nuclease ללא מים מזוקקים - 28.75 μL

שולחן 1.

95 ° C = 2 דקות
מחזור 34 חזרות של:
95 ° C = 30 s
53 ° C = 30 s
72 ° C = 2 דקות
72 ° C = 10 דק '
4 ° C = Hold

שולחן 2.

le FO: keep-together.within-page = "1" FO: keep-עם-next.within-page = "תמיד"> רְכִיב המניה נפח סופי עבור 50 תגובה μL מוצר ה- DNA התגובה IVI - 5.0 μL מאגר התגובה GoTaq 5x 10.0 μL תמהיל נוקלאוטיד dNTP 10 מ"מ כל 1.0 מיקרוליטר פריימר LTR 10 מיקרומטר 2.5 μL פריימר phiX174 10 מיקרומטר 2.5 μL GoTaq DNA פולימראז (5 U / μL) 0.25 μL nuclease ללא מים מזוקקים - 28.75 μL

טבלה 3.

יפ-together.within-page = "1" FO: keep-עם-next.within-page = "תמיד">
95 ° C = 5 דקות
מחזור 23 חזרות של:
94 ° C = 30 s
55 ° C = 30 s
72 ° C = 4 דקות
72 ° C = 10 דק '
4 ° C = Hold

לוח 4.

<td> Probe TaqMan
רְכִיב המניה נפח סופי במשך 30 תגובה μL
1 מוצרי PCR העגול st - 5.0 μL
פריימר LTR-R 10 מיקרומטר 0.9 μL
פריימר LTR-U 10 מיקרומטר 0.9 μL
10 מיקרומטר 0.3 μL
iQ Supermix 2x 15.0 μL
nuclease ללא מים מזוקקים - 7.9 μL

לוח 5.

95 ° C = 3 דקות
מחזור 39 חזרות של:
94 ° C = 15 שניות
58 ° C = 30 s
72 ° C = 30 s
פלייט קרא

לוח 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ניתוחים ביוכימיים של התמונות retroviral סיפקו תובנות קריטיות לתוך מנגנון של אינטגרציה DNA retroviral. מדידה של פעילות האינטגרציה של תמונות retroviral יכולה להיות מושגת על ידי assay היווצרות הפלאק, ניתוח כתם דרום המקונן qPCR. האסטרטגיה ניסיון של assay פלאק היא מייגע מנצלת שיטה עקיפה למדידת אינטגרציה 6, 7, 18. אינטגרצית מידת מבחני דרום מבוסס כתם ישירות אך דורשת כמויות גבוהות יחסי של תמונות 6, 7, 18.

דו"ח זה מפרט אסטרטגיה qPCR מקוננות למדידת פעילות האינטגרציה HIV-1-associated PIC במבחנה. היתרון העיקרי ואת המשמעות של שיטה זו היא הדרישה של כמויות נמוכות יחסית של הכנה PIC לכל תגובה 4, 5, 19. השלבים הקריטיים ביותר של שיטה זו הם הדור של וירוס גבוה כייל לזיהום והטיפול כנה PIC. יצוין כאן כי בסיבוב הראשון של ה- PCR כרוך הגברת מעריכי צומת האינטגרציה. כתוצאה מכך, את המספרים עותק של משולבת vDNA שנקבע qPCR בסיבוב השני הם חצי כמותית, ולכן, יש הגבלה של לא נותן מידה של עותקים vDNA הקשורים PIC. עם זאת, vDNA הקשורים PIC יכול להיקבע על ידי qPCR של DNA מטוהרים מן התמונות עם פריימרים LTR ספציפי. היחס בין vDNA משולבת להעתיק מספרים על vDNA PIC הקשורים המקבילה יכול לספק מידע על יעילות השילוב של תגובה אינטגרציה חוץ גופית. שיטה זו יכולה להיות שונה על ידי שילוב ה- DNA יעד Heterologous האחר של פריימרים בחירה ואחרים כדי לזהות השתלבות בבית האוריינטציות שניהם. לסיכום, השיטההמתואר כאן מודד את פעילות האינטגרציה של HIV-1 pics כמותית ניתן לאמץ למחקר פיתוח הבנה של הפרטים ביוכימיים של אינטגרציה retroviral.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים שום אינטרסים כלכליים והן לא מתחרים.

Acknowledgments

עבודה זו נתמכת בחלקה על ידי מענקים DA024558, DA30896, DA033892, ו DA021471 מן NIDA / NIH לתקליטור. אנחנו גם מכירים את G12MD007586 מענק RCMI, ואנדרבילט CTSA להעניק UL1RR024975, מרכז המחקר Translational Meharry (MeTRC) CTSA RR026140 U54 מענק מטעם NCRR / NIH, MD007593 מענק U54 מן NIMHD / NIH, ואת AI110527 P30 מענק טנסי וכפר.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
מדידה<em&gt; במבחנה</em&gt; פעילות האינטגרציה של HIV-1 Preintegration מכלולים
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter