Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

का नाप doi: 10.3791/54581 Published: February 22, 2017

Abstract

एचआईवी -1 लिफाफा प्रोटीन लक्ष्य कोशिका की सतह, जो वायरल-कोशिका झिल्ली संलयन कोशिका द्रव्य में वायरल capsid (सीए) कोर की रिहाई के द्वारा पीछा करने के लिए सुराग पर आत्मीय रिसेप्टर्स संलग्न हैं। बाद में, वायरल रिवर्स ट्रांसक्रिपटेस (आरटी), एक हमनाम nucleoprotein परिसर का हिस्सा के रूप में कहा रिवर्स प्रतिलेखन कॉम्प्लेक्स (आरटीसी), एक डबल असहाय डीएनए प्रतिलिपि (vDNA) में वायरल एकल असहाय आरएनए जीनोम धर्मान्तरित। यह एक और nucleoprotein परिसर के जीवजनन की ओर जाता है, पूर्व एकीकरण जटिल (पीआईसी), vDNA और जुड़े वायरस प्रोटीन और मेजबान कारकों से बना करार दिया। PIC जुड़े वायरल इंटिग्रेस (में) एक अस्थायी और स्थानिक विनियमित दो कदम प्रक्रिया में मेजबान गुणसूत्र डीएनए में vDNA के एकीकरण orchestrates। सबसे पहले, कोशिका द्रव्य में vDNA के 3 'सिरों संसाधित करता है और, दूसरा, के बाद PIC नाभिक को traffics, यह गुणसूत्र डीएनए में संसाधित vDNA के एकीकरण मध्यस्थता करता है। Pics का अलग-थलगलक्ष्य कोशिकाओं तीव्रता से एचआईवी -1 से संक्रमित से, इन विट्रो में कार्य कर रहे हैं के रूप में वे एक exogenously जोड़ा heterologous लक्ष्य डीएनए में जुड़े vDNA एकीकृत करने के लिए सक्षम हैं। इस तरह के PIC आधारित इन विट्रो एकीकरण assays में काफी रेट्रोवायरल एकीकरण के यंत्रवत विवरण का वर्णन करने के लिए और अवरोधकों में खोज करने के लिए योगदान दिया है। इस रिपोर्ट में, हम एक अद्यतन एचआईवी -1 PIC परख है कि पृथक मूल निवासी pics के लिए इन विट्रो एकीकरण गतिविधि को मापने के लिए एक नेस्टेड वास्तविक समय मात्रात्मक पोलीमरेज़ चेन रिएक्शन (qPCR) आधारित रणनीति को रोजगार पर प्रकाश डालेंगे।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

जल्दी और देर घटनाओं: लक्ष्य सेल में एचआईवी -1 प्रतिकृति कई कदम, मोटे तौर पर दो चरणों में बांटा शामिल है। प्रारंभिक घटनाओं शुरू जब एचआईवी -1 क्रमिक रूप से लक्ष्य कोशिका की सतह रिसेप्टर सीडी 4 और दो सह-रिसेप्टर्स (CCR5 या CXCR4) 1 में से एक को बांधता है। नतीजतन, वायरस-कोशिका झिल्ली फ्यूज, और वायरल capsid (सीए) कोर कोशिका द्रव्य 2 में जारी की है। सीए कोर वायरल जीनोमिक एकल असहाय शाही सेना (ssRNA) और कई प्रोटीन, दोनों वायरल और मूल में सेलुलर शामिल हैं। सीए जुड़े वायरल प्रोटीन रिवर्स ट्रांसक्रिपटेस (आरटी) और इंटिग्रेस (IN), दो एंजाइमों कि वायरल प्रतिकृति में जल्दी घटनाओं के दौरान महत्वपूर्ण कदम मध्यस्थता शामिल हैं। आर टी और nucleoprotein परिसरों, अर्थात् रिवर्स प्रतिलेखन कॉम्प्लेक्स (आरटीसी) और पूर्व एकीकरण जटिल (पीआईसी) क्रमश: 3, 4, 5 के संदर्भ में समारोह में <sup>, 6। वायरल जीनोम ssRNA बंदरगाह टर्मिनल दोहराने (आर) अद्वितीय दृश्यों U5 से सटे तत्वों (5 पर 'अंत) और U3 (3 पर' अंत) के सिरों। आरटीसी एक डबल असहाय (डी एस) डीएनए प्रतिलिपि (vDNA) में वायरल जीनोम ssRNA धर्मान्तरित। यह रिवर्स प्रतिलेखन प्रक्रिया भी U5 और U3 दृश्यों का दोहराव में यह परिणाम है, इस प्रकार vDNA 7, 8 के दोनों सिरों पर लंबे टर्मिनल दोहराता (लीटर) पैदा होता है। इसके बाद, तस्वीर जुड़े में दो अनुक्रमिक जैव रासायनिक प्रतिक्रियाओं है कि मेजबान गुणसूत्र 9, 10, 11 में vDNA के एकीकरण सक्षम उत्प्रेरित। सबसे पहले, कोशिका द्रव्य में, multimers में दोनों लीटर 12 संलग्न हैं और 3'-टर्मिनल सिरों में से प्रत्येक से एक डाईन्यूक्लियोटाइड फोड़ना। इस 3'अंत प्रसंस्करण प्रत्येक 3'अंत vDNA की (CA OH) में एक हाइड्रॉक्सिल समूह उत्पन्न करता है।अगले, तस्वीर, नाभिक को traffics जिसमें में vDNA सीए ओह उपयोग करता है एक nucleophile के रूप में एक कंपित फैशन में गुणसूत्र डीएनए के दोनों किस्में कटौती करने के लिए। इसके साथ ही, में coordinately गुणसूत्र डीएनए के विपरीत किस्में पर जिसके परिणामस्वरूप phosphodiester बांड के लिए vDNA के दोनों सिरों splices। इस कतरा हस्तांतरण कदम के बाद, मेजबान सेल मशीनरी एकीकरण साइट के जंक्शन पर vDNA के 5 'समाप्त होता है और मरम्मत आगामी एकल असहाय अंतराल पर दो अयुगल न्यूक्लियोटाइड हटा। प्रारंभिक घटनाओं इस प्रकार एचआईवी -1 जीनोम का एक एकीकृत डीएनए प्रतिलिपि (provirus) की स्थापना के साथ culminate। provirus कुशल वायरल जीन अभिव्यक्ति है, जो वायरस इनकोडिंग प्रोटीन की अभिव्यक्ति सहित बाद की घटनाओं, शुरू की के लिए एक उपयुक्त वातावरण प्रदान करता है; अपरिपक्व वायरस के विधानसभा; और नवोदित, रिहाई, और संक्रामक virions 13 में परिपक्वता।

शुद्ध पुनः संयोजक रेट्रोवायरल में करने के लिए सक्षम हैबाहर ले जाने, इन विट्रो में, दोनों 3'अंत प्रसंस्करण और कतरा हस्तांतरण गतिविधियों पर exogenously आपूर्ति की लीटर की तरह सब्सट्रेट डीएनए। इस तरह शुद्ध में पुनः संयोजक का उपयोग कर जैव रासायनिक अध्ययन vDNA एकीकरण 14, 15, 16, 17 के महत्वपूर्ण पहलुओं को उजागर किया है। हालांकि, प्राकृतिक संक्रमण के विपरीत, इस लिए इन विट्रो जैव रासायनिक प्रतिक्रिया लक्ष्य डीएनए में सब्सट्रेट डीएनए के दोनों सिरों के ठोस एकीकरण का समर्थन नहीं करता। इसके विपरीत, तीव्रता से संक्रमित कोशिकाओं से अलग रेट्रोवायरल PICs concertedly heterologous लक्ष्य डीएनए में अंतर्जात vDNA के दोनों सिरों को एकीकृत। यह अलग मूल निवासी Pics का उपयोग करते हुए व्यापक अपनाने और मैं n इन विट्रो एकता (IVI) assays के बाद के शोधन के लिए नेतृत्व किया।

पहले में रेट्रोवायरल IVI परख, एक पुनः संयोजक Murine से संक्रमित कोशिकाओं से cytoplasmic अर्क सूचना दील्यूकेमिया वायरस (MLV) ने अपनी लीटर में ई कोलाई supF जीन को शरण देने में गतिविधि का स्रोत है, और एक उत्परिवर्ती लैम्ब्डा फेज अपघट्य विकास में दोषपूर्ण exogenously लक्ष्य डीएनए के रूप में आपूर्ति की गई थी की डीएनए के रूप में कार्य किया। पुनः संयोजक डीएनए MLV के सफल एकीकरण फेज डीएनए में कॉपी और आगामी supF अभिव्यक्ति पुनः संयोजक फगेस की पट्टिका के गठन की क्षमता की बहाली के लिए नेतृत्व किया। हालांकि, इस प्रयोगात्मक रणनीति एक अप्रत्यक्ष तरीके से श्रमसाध्य और उपायों एकीकरण है। इस तरह के निरंतर संबोधित करने के लिए, एक दक्षिणी धब्बा आधारित अप्रत्यक्ष अंत लेबलिंग परख है, जो अंतर्जात बहिर्जात linearized जीवाणुभोजी phiX174 डीएनए में एकीकृत vDNA का एक उपाय के रूप में PIC जुड़े IVI गतिविधि quantifies, 6 विकसित किया गया था, 7, 18। हालांकि इस विधि एकीकरण की घटनाओं का एक सीधा उपाय प्रदान करता है, तस्वीर तैयार करने के अपेक्षाकृत उच्च मात्रा की आवश्यकता होती है, जो एक तकनीकी रूप से चुनौतीपूर्ण बनी हुई हैप्रयास। इस दरकिनार करने के लिए, नेस्टेड पीसीआर आधारित pics के केवल मामूली मात्रा में आवश्यकता होती है assays 4 विकसित किए गए, 5, 19।

इस रिपोर्ट में, हम का एक अद्यतन संस्करण का वर्णन एक विट्रो विधि एचआईवी -1 पीआईसी की मध्यस्थता एकीकरण गतिविधि प्राकृतिक संक्रमण के दौरान होने वाली पुनरावृत्ति करने के लिए तैयार में नेस्टेड पीसीआर आधारित। इस विधि अंतर्जात PIC गतिविधि का एक स्रोत है, जो एक वास्तविक समय मात्रात्मक पोलीमरेज़ चेन रिएक्शन (qPCR) के साथ मापा जाता है के रूप में एचआईवी -1 से संक्रमित लक्ष्य कोशिकाओं के cytoplasmic अर्क का उपयोग करता है। Pics का अलग-थलग करने और उनके एकीकरण की गतिविधियों को मापने के लिए प्रक्रियाओं संशोधनों के साथ अनुकूलित कर रहे हैं, Engelman प्रयोगशाला 20 द्वारा प्रकाशित प्रोटोकॉल से। इस विधि में, तस्वीर जुड़े एकीकरण गतिविधि एक exogenous रेखीय लक्ष्य डीएनए 21, और डीएनए से उत्पन्न उत्पाद उपलब्ध कराने के द्वारा शुरू की हैइस एकीकरण प्रतिक्रिया शुद्ध और बाद पीसीआर आधारित मात्रा का ठहराव के लिए शुरू सामग्री के रूप में इस्तेमाल कर रहे हैं। पहले दौर में पारंपरिक पीसीआर में, वायरल लक्ष्य डीएनए जंक्शनों उचित प्राइमरों का उपयोग करके परिलक्षित कर रहे हैं। दूसरे दौर में qPCR, लीटर विशिष्ट प्राइमरों विशेष पहले दौर पीसीआर उत्पादों से vDNA आबादी को समृद्ध करने के लिए इस्तेमाल कर रहे हैं। कृपया इस विधि का एक विस्तृत विवरण के लिए प्रोटोकॉल अनुभाग देखें।

रेट्रोवायरल pics के साथ इन विट्रो अध्ययन में रेट्रोवायरल डीएनए एकीकरण की व्यवस्था के बारे में हमारी समझ में और अवरोधकों के विकास में उल्लेखनीय प्रगति हुई है। , मानचित्रण एचआईवी -1 एकीकरण साइटों पर हाल ही में बढ़ा फोकस के आधार पर एचआईवी -1 एकीकरण में वायरल और मेजबान कारकों की भूमिका का निर्धारण, और दवा प्रतिरोध का मुकाबला करने की दिशा में नई एंटीवायरल दवाओं के विकास, हम में वृद्धि हुई ब्याज और IVI assays के व्यापक उपयोग की परिकल्पना की गई इस रिपोर्ट में वर्णित एक तरह। यह, बारी में, को बढ़ावा मिलेगाविधि में भविष्य के शोधन, जिससे उसके आवेदन के दायरे में विविधता लाने के।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. वायरस उत्पादन

नोट: संक्रामक एचआईवी -1 के उच्च titers उत्पन्न करने के लिए, एक सक्रिय डेनड्रीमर आधारित अभिकर्मक अभिकर्मक का उपयोग कर एक संक्रामक एचआईवी -1 आणविक क्लोन के साथ मानव भ्रूण गुर्दे (HEK) सेल लाइन 293T transfect। यह देखा गया है कि कैल्शियम फॉस्फेट अभिकर्मक विधि तुलनीय परिणाम पैदावार गया है।

  1. एक जैव सुरक्षा स्तर 2 (BSL2) प्रयोगशाला में, बीज 3 एक्स 10 6 293T 8 में प्रति 10 सेमी पकवान कोशिकाओं Dulbecco संशोधित ईगल मध्यम (DMEM) के साथ 10% भ्रूण गोजातीय सीरम (FBS), पेनिसिलिन, और स्ट्रेप्टोमाइसिन पूरक के एमएल। संस्कृति एक मशीन 37 डिग्री सेल्सियस पर सेट और 5% में कोशिकाओं सीओ 2 हे / एन।
  2. अगले दिन, प्रत्येक 10 सेमी डिश में कोशिकाओं transfecting के लिए, सीरम और एंटीबायोटिक दवाओं की कमी DMEM के 300 μL के अंतिम मात्रा को pNL4-3 प्लास्मिड डीएनए (देखें सामग्री तालिका) के 8 माइक्रोग्राम पतला। अभिकर्मक अभिकर्मक के 80 μL जोड़ें, pipetting द्वारा अच्छी तरह मिक्स, और के लिए आरटी पर सेते5 - अभिकर्मक जटिल गठन के लिए 10 मिनट।
  3. आकांक्षा से व्यंजन से मध्यम निकालें और ताजा सीरम और एंटीबायोटिक दवाओं युक्त DMEM के पकवान प्रति 7 एमएल जोड़ें।
  4. DMEM युक्त सीरम और एंटीबायोटिक दवाओं के 1 एमएल अभिकर्मक जटिल को जोड़ें, pipetting द्वारा मिश्रण, और कोशिकाओं के लिए इस मिश्रण जोड़ें। धीरे पकवान ज़ुल्फ़ अभिकर्मक परिसरों का भी वितरण की सुविधा के लिए।
  5. इसके तत्काल बाद कोशिकाओं BSL3 प्रयोगशाला, जगह के लिए एक मशीन 37 डिग्री सेल्सियस और 5% पर सेट सीओ 2 में 48 घंटे के लिए कोशिकाओं को हस्तांतरण, और संस्कृति।
  6. वायरस युक्त टिशू कल्चर एक पिपेट का उपयोग कर सतह पर तैरनेवाला लीजिए और फिर एक अपकेंद्रित्र ट्यूब को हस्तांतरण। 5 मिनट के लिए 300 XG पर अपकेंद्रित्र कोशिकाओं और मलबे गोली, और फिर एक 0.45 माइक्रोन ताकना आकार सिरिंज फिल्टर के माध्यम से सतह पर तैरनेवाला फिल्टर।
  7. इस सेल मुक्त वायरस तैयार करने में किसी भी कैरीओवर प्लास्मिड डीएनए को समाप्त करने के लिए, 1 घंटे के लिए 37 डिग्री सेल्सियस पर DNase 1 (20 माइक्रोग्राम / एमएल) के साथ व्यवहार करते हैं।
  8. योंएचआईवी -1 अनुमापांक, पी 24 विशेष एंजाइम से जुड़ी immunosorbent परख (एलिसा) का उपयोग करने के रूप में यह नियमित प्रयोग 22 के लिए एक तेजी से और उत्तरदायी विधि है।
    नोट: यह ध्यान दिया जाना चाहिए कि पी 24 एलिसा शारीरिक अनुमापांक (वायरस कणों की संख्या) के उपाय। वैकल्पिक रूप से, वायरस से जुड़े आरटी गतिविधि (बहिर्जात आरटी परख) या वायरस संक्रामकता (TZM बीएल सूचक सेल लाइन आधारित संक्रामकता assays) को मापने संक्रामक वायरस कणों के अनन्य readout प्रदान करेगा।

2. वायरस Sup-T1 कोशिकाओं के संक्रमण (BSL3 लैब)

  1. एक BSL2 प्रयोगशाला में, Sup-T1 कोशिकाओं 1.0 6 के बीच एक्स 10 6 और 2.0 x 10 कोशिकाओं / रोसवेल पार्क मेमोरियल संस्थान (RPMI) मध्यम 10% गर्मी निष्क्रिय FBS, पेनिसिलिन के साथ पूरक, और स्ट्रेप्टोमाइसिन में एमएल (1 के विभाजन अनुपात को बनाए रखने : 2 हर 2 - 3 डी)। , संस्कृति बोतल से Sup-T1 कोशिकाओं पूल pipetting द्वारा अच्छी तरह मिक्स, और एक hemocytometer और trypan नीले बहिष्कार सेंट का उपयोग करके व्यवहार्य कोशिकाओं की संख्या का निर्धारणविधि aining।
    1. 80 x 10 6 कोशिकाओं (वायरस के संक्रमण के अनुसार) 50 एमएल शंक्वाकार अपकेंद्रित्र ट्यूब में की aliquots की अपेक्षित संख्या को तैयार है।
    2. 500 XG पर एक झूलते बाल्टी रोटर में कोशिकाओं अपकेंद्रित्र और 5 मिनट के लिए 25 डिग्री सेल्सियस। सेल संस्कृति के माध्यम से हटाने के बिना, आगे की प्रक्रिया के लिए BSL3 प्रयोगशाला में pelleted कोशिकाओं युक्त ट्यूबों हस्तांतरण। ध्यान से सेल गोली परेशान बिना ट्यूब से सेल संस्कृति के माध्यम aspirate।
  2. ट्यूब में कोशिकाओं को DNase मैं इलाज वायरस inoculum का एक उचित मात्रा में जोड़ें और कोमल pipetting द्वारा अच्छी तरह से मिलाएं। 80 x 10 6 कोशिकाओं के लिए, DNase मैं इलाज वायरस (पी 24 समकक्ष-वायरस के 50 ग्राम) का 30 एमएल का उपयोग करें।
    नोट: कार्यात्मक pics के अलगाव (MOI) के संक्रमण का बहुत ही उच्च multiplicities के साथ लक्ष्य कोशिकाओं को संक्रमित करने की आवश्यकता है।
  3. समान रूप से दो 6 अच्छी तरह से टिशू कल्चर प्लेट (यानी 12 x 2.5 एमएल aliquots के बीच मिश्रण वितरित; संक्रमित प्रति 2 प्लेटों का उपयोगआयन)।
  4. spinoculation के लिए, 480 XG पर एक झूलते बाल्टी रोटर और 2 घंटे के लिए 25 डिग्री सेल्सियस का उपयोग कर प्लेट वाहक और सेंट्रीफ्यूज में संस्कृति प्लेटों जगह है।
  5. 5 घंटे के लिए 37 डिग्री सेल्सियस पर spinoculated कोशिकाओं को सेते हैं और 5% सीओ 2।

3. कटाई और lysis संक्रमित कोशिकाओं के (BSL3 लैब)

  1. कोशिकाओं को एक 50 मिलीलीटर शंक्वाकार अपकेंद्रित्र ट्यूब में संस्कृति प्लेटों से प्रत्येक संक्रमण के लिए इसी (~ में कुल 30 एमएल) पूल।
  2. 300 XG पर centrifugation द्वारा कोशिकाओं फसल और 10 मिनट के लिए 25 डिग्री सेल्सियस। ध्यान से ट्यूब से सतह पर तैरनेवाला aspirate (वैकल्पिक रूप से, एक पिपेट का उपयोग करें)।
  3. किसी भी अवशिष्ट वायरल कणों को निकालने के लिए बफर कश्मीर के 2 एमएल जोड़कर प्रत्येक कोशिका गोली धोने - / - (150 मिमी KCl, 20 मिमी HEPES, पीएच 7.6, 5 मिमी MgCl 2) और 300 XG पर नमूना और 25 डिग्री सेल्सियस के लिए centrifuging दस मिनट। फिर, गोली परेशान बिना, ध्यान से आकांक्षा से या एक पिपेट का उपयोग करके सतह पर तैरनेवाला हटा दें।
  4. repeaटी 3.3 कदम।
  5. ध्यान से एक micropipette का उपयोग करके किसी भी अवशिष्ट बफर हटा दें। ठंडा lysis बफर कश्मीर के 2 एमएल में प्रत्येक कोशिका गोली Resuspend + + / (बफर कश्मीर - / - 0.025% digitonin, 1 मिमी डीटीटी, 20 माइक्रोग्राम / एमएल aprotinin के साथ पूरक), मिश्रण कोमल pipetting द्वारा सामग्री, और एक के लिए स्थानांतरण 2 एमएल microcentrifuge ट्यूब।

4. Cytoplasmic pics के तैयारी (BSL3 लैब)

  1. 10 मिनट के लिए आरटी पर एक रोटरी प्रकार के बरतन पर नमूने रॉक।
  2. नमूने अपकेंद्रित्र, रोटर 4 डिग्री सेल्सियस तक precooled के साथ, 1500 XG पर और 4 मिनट के लिए 4 डिग्री सेल्सियस।
  3. गोली परेशान बिना, ध्यान से 16,000 XG पर एक ताजा microcentrifuge ट्यूब और सेंट्रीफ्यूज स्थानांतरण सतह पर तैरनेवाला और 1 मिनट के लिए 4 डिग्री सेल्सियस।
  4. ध्यान से एक ताजा microcentrifuge ट्यूब स्थानांतरण सतह पर तैरनेवाला। 30 मिनट (कोई कमाल) के लिए 20 माइक्रोग्राम / एमएल (2 Pics के 2 एमएल के लिए μL) की एक अंतिम एकाग्रता के लिए RNase एक (20 मिलीग्राम / एमएल) जोड़ें और आरटी पर सेते सामग्री। </ Li>
  5. 7% की एक अंतिम एकाग्रता के लिए और कोमल pipetting द्वारा अच्छी तरह मिक्स (- - / बफर कश्मीर में 60% w / v) सुक्रोज जोड़ें। , Microcentrifuge ट्यूब में pics के aliquots (जैसे, 200 μL) तैयार एक -80 में तरल नाइट्रोजन में फ्लैश फ्रीज, और जगह ° लंबी अवधि के भंडारण के लिए सी फ्रीजर।

5. इन विट्रो एकीकरण में (IVI) Assays एचआईवी -1 Pics का उपयोग करना

  1. लक्ष्य पीसीआर के साथ phiX174 प्लास्मिड डीएनए से एक 2.0 केबी क्षेत्र amplifying कस्टम बनाया प्राइमरों, phiX174-एफ और phiX174-आर का उपयोग करके IVI परख में इस्तेमाल डीएनए तैयार करें।
    1. तालिका 1 में वर्णित के रूप में पीसीआर मिश्रण इकट्ठा करो। थर्मल साइकिल चालन की स्थिति तालिका 2 में सिफारिश का उपयोग कर एक थर्मल cycler में पीसीआर प्रदर्शन करना। जेल शुद्ध एक जेल शुद्धि किट (निर्माता की सिफारिश प्रोटोकॉल के बाद) का उपयोग पीसीआर उत्पाद, और उपयोग करें जब तक डिग्री सेल्सियस -80 पर aliquots के रूप में शुद्ध लक्ष्य डीएनए की दुकान।
  2. लक्ष्य डीएनए के 600 एनजी 200 को जोड़ें - & #181; pics के एल विभाज्य, मिश्रण अच्छी तरह से, और 45 मिनट के लिए 37 डिग्री सेल्सियस पर सेते हैं।
    नोट: लक्ष्य डीएनए को छोड़ते हुए या एक इंटिग्रेस अवरोध (जैसे, Raltegravir) सहित IVI प्रतिक्रियाओं को नियंत्रित प्रतिक्रियाओं सिफारिश कर रहे हैं।
  3. 0.5%, 8 मिमी, और 0.5 मिलीग्राम / एमएल, क्रमशः के अंतिम सांद्रता एसडीएस, EDTA, और proteinase कश्मीर जोड़कर IVI प्रतिक्रिया बंद करो। अच्छी तरह से प्रतिक्रिया सामग्री मिलाएं और रात भर में 56 डिग्री सेल्सियस सेते हैं।
  4. अगले दिन, फिनोल / क्लोरोफॉर्म निष्कर्षण और इथेनॉल तेज़ी से IVI प्रतिक्रिया से कुल डीएनए शुद्ध। 16,000 XG और आरटी पर सभी centrifugation कदम बाहर ले।
  5. 2 मिनट के लिए deproteinized नमूने के लिए फिनोल के एक बराबर मात्रा जोड़ने, vortexing द्वारा सख्ती मिश्रण, और सेंट्रीफ्यूज। ध्यान से ऊपरी जलीय चरण को हटाने और एक ताजा ट्यूब को हस्तांतरण।
  6. दोहराएँ कदम 5.5। एक ताजा ट्यूब ऊपरी जलीय चरण स्थानांतरण।
  7. , क्लोरोफॉर्म मिश्रण vortexing द्वारा सख्ती मिश्रण, और सेंट्रीफ्यूज के लिए: 1 फिनोल: 1 के एक बराबर मात्रा में जोड़ेंआर 2 मिनट। एक ताजा ट्यूब ऊपरी जलीय चरण स्थानांतरण।
  8. क्लोरोफॉर्म के एक बराबर मात्रा जोड़ने, vortexing द्वारा सख्ती मिश्रण है, और 2 मिनट के लिए अपकेंद्रित्र। एक ताजा ट्यूब ऊपरी जलीय चरण स्थानांतरण।
  9. डीएनए वेग करने के लिए, 0.3 एम के अंतिम एकाग्रता के लिए 0.1 माइक्रोग्राम / μL, सोडियम एसीटेट के 3 एम की एक अंतिम एकाग्रता के लिए ग्लाइकोजन जोड़ने के लिए, और 100% इथेनॉल (ठंडा) के 2.5 संस्करणों। भंवर मिश्रण करने के लिए, सेंट्रीफ्यूज संक्षेप सामग्री एकत्र करने के लिए, और -80 डिग्री सीओ / एन पर ट्यूब जगह है।
  10. अगले दिन, 16,000 XG पर 30 मिनट के लिए नमूना अपकेंद्रित्र और 30 मिनट के लिए 4 डिग्री सेल्सियस। ध्यान से गोली परेशान बिना सतह पर तैरनेवाला हटा दें।
  11. 16,000 XG पर गोली और सेंट्रीफ्यूज से 80% इथेनॉल (ठंडा) के 500 μL जोड़ें और 10 मिनट के लिए 4 डिग्री सेल्सियस। आरटी पर डीएनए गोली हवा शुष्क और अच्छी तरह से nuclease मुक्त पानी की 50 μL में resuspend। -20 डिग्री सेल्सियस पर डीएनए के नमूने संग्रहित करें।

6. बढ़ाता PIC गतिविधि के लिए पीसीआर assays

  1. एकीकृत एचआईवी -1 डीएनए के जंक्शनों बढ़ाना (क्रमशः लीटर और phiX174 प्राइमरों,) वायरल लीटर और phiX174 डीएनए को निशाना प्राइमरों का उपयोग पहले दौर में पारंपरिक पीसीआर प्रदर्शन करना।
    1. तालिका 3 में वर्णित के रूप में पहले दौर पीसीआर मिश्रण इकट्ठा करो। टेम्पलेट डीएनए को छोड़कर सभी घटकों के एक मास्टर मिश्रण इकट्ठा, अलग पीसीआर ट्यूबों में 45 μL aliquots बांटना, और टेम्पलेट डीएनए या nuclease मुक्त पानी (नियंत्रण) के 5 μL जोड़ें।
    2. थर्मल साइकिल चालन की स्थिति तालिका 4 में सिफारिश का उपयोग कर एक थर्मल cycler में पीसीआर प्रदर्शन करना।
  2. दूसरे दौर qPCR प्राइमरों कि वायरल लीटर (लीटर आर और लीटर यू प्राइमरों) की एक छोटी क्षेत्र पार्श्व का उपयोग कर चुनिंदा पहले आरओ से एकीकृत vDNA दृश्यों बढ़ाना करने के लिए प्रदर्शनund पीसीआर उत्पादों। निर्धारित करने के लिए एकीकृत vDNA संख्या नकल, प्रतिलिपि जाना जाता संख्या के 10x धारावाहिक dilutions का उपयोग करके एक मानक वक्र उत्पन्न (जैसे, 10 0 - 10 8) एचआईवी -1 आणविक क्लोन की।
    1. 5 तालिका में वर्णित के रूप में दूसरे दौर qPCR मिश्रण इकट्ठा करो। टेम्पलेट डीएनए को छोड़कर सभी घटकों के एक मास्टर मिश्रण इकट्ठा, ध्यान से एक 96 अच्छी तरह से पीसीआर प्रतिक्रिया थाली में कुओं की उपयुक्त संख्या में 25 μL aliquots बांटना, और फिर पीसीआर उत्पादों या nuclease मुक्त पानी unpurified पहले दौर के 5 μL जोड़ने (नियंत्रण)। तीन प्रतियों में सभी qPCR प्रतिक्रियाओं प्रदर्शन करना।
    2. वास्तविक समय पीसीआर साधन में पीसीआर प्लेट लोड और साइकिल चालन की स्थिति तालिका 6 में सिफारिश का उपयोग कर qPCR प्रदर्शन करते हैं।
    3. एक उपयुक्त सॉफ्टवेयर का उपयोग कर डेटा का विश्लेषण।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

एचआईवी -1 pics के अलगाव

तीव्रता से संक्रमित Sup-T1 कोशिकाओं से एचआईवी -1 pics के अलगाव के लिए इस्तेमाल किया प्रोटोकॉल का एक योजनाबद्ध चित्र 1 में दिखाया गया है। इस प्रोटोकॉल Engelman एट अल द्वारा वर्णित विधि से ली गई है। 19, 20। एचआईवी -1 PICs nucleoprotein परिसरों कि संक्रमित कोशिकाओं में इकट्ठा कर रहे हैं और रिवर्स लिखित vDNA के शामिल हैं, वायरल प्रोटीन, और सेलुलर कारकों 19, 20 हैं। विधि इस रिपोर्ट में वर्णित PIC जुड़े एकीकरण गतिविधि के स्रोत के रूप में एचआईवी -1 से संक्रमित कोशिकाओं के cytoplasmic अर्क का उपयोग करता है।

एचआईवी -1 pics के इन विट्रो एकीकरण गतिविधि में

चित्रा 2 में दिखाया गया है। इस विधि PIC जुड़े IVI गतिविधि को मापने के लिए एक नेस्टेड qPCR आधारित रणनीति का इस्तेमाल करता है, और प्रक्रियाओं संशोधनों के साथ, अनुकूलित कर रहे हैं Engelman प्रयोगशाला 19, 20, 21 से प्रकाशित प्रोटोकॉल से। इस विधि में, तस्वीर जुड़े एकीकरण गतिविधि एक heterologous रेखीय लक्ष्य डीएनए 21 को उपलब्ध कराने के द्वारा शुरू की है, और डीएनए इस एकीकरण प्रतिक्रिया से उत्पन्न उत्पादों शुद्ध और बाद पीसीआर आधारित मात्रा का ठहराव के लिए शुरू सामग्री के रूप में इस्तेमाल कर रहे हैं। पहले दौर में पारंपरिक पीसीआर में, वायरल लक्ष्य डीएनए जंक्शनों उचित प्राइमरों का उपयोग परिलक्षित कर रहे हैं। दूसरे दौर में qPCR, लीटर विशिष्ट प्राइमरों विशेष पहले दौर पीसीआर उत्पादों से vDNA आबादी को समृद्ध करने के लिए इस्तेमाल कर रहे हैं। कृपया देखें प्रोटोकॉल रोंइस विधि का विस्तृत विवरण के लिए ection।

एक IVI परख से प्रतिनिधि परिणामों का उपयोग एचआईवी -1 PICs 3 चित्र में दिखाया जाता है प्रदर्शन किया। Sup-T1 कोशिकाओं (80 x 10 6 कोशिकाओं / संक्रमण) DNase 1 का इलाज एचआईवी -1 के 30 एमएल के साथ spinoculated थे (~ 50 माइक्रोग्राम पी 24 के बराबर) की अनुपस्थिति या अवरोध Raltegravir में 1 माइक्रोन एचआईवी -1 की उपस्थिति 480 से कम में XG और 2 घंटे के लिए 25 डिग्री सेल्सियस। कोशिकाओं बाद 37 डिग्री सेल्सियस पर 5 घंटे और 5% सीओ 2 के लिए सुसंस्कृत थे। Pics का पृथक प्रोटोकॉल खंड में वर्णित के रूप में थे। IVI प्रतिक्रियाओं 45 मिनट के लिए, बाहर किए गए pics के प्रत्येक 200 μL और लक्ष्य डीएनए के 600 एनजी (एक 2 KB डीएनए टुकड़ा पीसीआर द्वारा phiX174 डीएनए से परिलक्षित) का उपयोग कर 37 डिग्री सेल्सियस पर। प्रतिक्रियाओं 56 डिग्री सीओ / एन पर एसडीएस और EDTA की उपस्थिति में proteinase कश्मीर उपचार द्वारा deproteinized थे। एक बार मिश्रण है, और प्रतिक्रिया उत्पादों दो बार फिनोल के साथ निकाले गए थे, एक बार एक फिनोल के साथ: क्लोरोफॉर्म (1 1)क्लोरोफॉर्म के साथ। इसके बाद डीएनए इथेनॉल उपजी नमक और सह-तेज़ ग्लाइकोजन की उपस्थिति में किया गया था, और डीएनए गोली 80% इथेनॉल के साथ एक बार धोया गया था। शुद्ध डीएनए nuclease मुक्त पानी की 50 μL में resuspended किया गया था। एक नेस्टेड qPCR रणनीति vDNA की संख्या phiX174 डीएनए में एकीकृत निर्धारित करने के लिए इस्तेमाल किया गया था। पहले दौर में पारंपरिक पीसीआर में, phiX174 लक्ष्य डीएनए और वायरल लीटर क्षेत्र पर दृश्यों के लिए पूरक प्राइमरों एकीकरण प्रतिक्रिया डीएनए उत्पादों के 5 μL से एकीकृत वायरल लक्ष्य डीएनए जंक्शनों बढ़ाना इस्तेमाल किया गया। दूसरे दौर में qPCR, लीटर फैले प्राइमरों विशेष रूप से पहले दौर amplicon उत्पादों के 5 μL से और से एचआईवी विशिष्ट डीएनए दृश्यों बढ़ाना इस्तेमाल किया गया 10 गुना ज्ञात प्रतिलिपि संख्या के धारावाहिक dilutions (10 8 -10 0) एचआईवी -1 आणविक क्लोन की (मानक)।

सभी qPCR प्रतिक्रियाओं डेटा wer तीन प्रतियों में प्रदर्शन किया और कर रहे थेई वाणिज्यिक सॉफ्टवेयर का उपयोग कर विश्लेषण किया। मूल्यों मानकों से निकाली गई एक मानक वक्र, जिसमें से एकीकृत vDNA कॉपी संख्या interpolated थे उत्पन्न करने के लिए साजिश रची थे। त्रुटि दंड मानक विचलनों को दर्शाते हैं। के रूप में 3 चित्र में दिखाया, एचआईवी -1 PICs मजबूती के साथ लक्ष्य डीएनए (लेन 5) में जुड़े vDNA एकीकृत। महत्वपूर्ण बात है, pics के IVI दक्षता काफी में अवरोध Raltegravir (6 लेन) के साथ पूरक प्रतिक्रियाओं में कम हो गया था। यह दृढ़ता से एकीकरण गतिविधि एचआईवी -1 में करने के लिए इस परख में मापा जिम्मेदार बताते हैं। इसके अलावा, नियंत्रण असंक्रमित कोशिकाओं से cytoplasmic lysates युक्त प्रतिक्रियाओं (1 लेन), अकेले तस्वीरें (2 लेन), अकेले डीएनए (3 लेन) को लक्षित, और अकेले बफर (4 लेन) किसी भी एकीकरण गतिविधि नहीं दिखा था। इसके अलावा, नियंत्रण है कि पहले दौर पीसीआर में Taq पोलीमरेज़ अपवर्जित (लेन 7) एकीकरण उत्पादों बढ़ाना नहीं था। विशेष रूप से, तस्वीरें अकेले नियंत्रण (2 लेन) के आंकड़ों से संकेत दिया कि नेस्ट qPCR रणनीति specifiबड़ी सफाई से एकीकृत vDNA नहीं बल्कि PIC जुड़े vDNA उपाय। सामूहिक रूप से, इन आंकड़ों PIC जुड़े एकीकरण गतिविधि की माप प्रदर्शित करता है।

आकृति 1
चित्रा 1: एचआईवी -1 pics के तैयारी के लिए प्रोटोकॉल के योजनाबद्ध प्रतिनिधित्व। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Cytoplasmic PICs युक्त अर्क एचआईवी -1 से संक्रमित Sup-T1 कोशिकाओं से अलग कर रहे हैं। इन pics में इन विट्रो एकीकरण परख में एकीकरण गतिविधि के स्रोत के रूप में इस्तेमाल कर रहे हैं।

चित्र 2
चित्रा 2: इन विट्रो की योजनाबद्ध प्रतिनिधित्व M> एचआईवी -1 pics के एकता परख। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

एकता assays एचआईवी -1 pics और heterologous लक्ष्य phiX174 डीएनए का उपयोग कर इन विट्रो में किए गए। एकीकृत एचआईवी -1 डीएनए एक नेस्टेड पीसीआर रणनीति, जिसमें पहले दौर में पारंपरिक पीसीआर एकीकरण जंक्शनों से vDNA-विशिष्ट दृश्यों रियायत के तौर पर एक-दूसरे दौर qPCR में परिलक्षित कर रहे हैं amplifies द्वारा मापा गया था।

चित्र तीन
चित्रा 3: एचआईवी -1 PIC जुड़े vDNA एकता गतिविधि। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

"Fo: रख-together.within-पेज =" 1 "> एचआईवी -1 PIC जुड़े एकीकरण गतिविधि परख एकीकृत vDNA संख्या के 10x धारावाहिक dilutions का उपयोग कर उत्पन्न एक मानक वक्र से निकाली गई मूल्यों साजिश रचने के द्वारा निर्धारित किया गया है कॉपी के प्रतिनिधि परिणाम है। एक एचआईवी -1 आणविक क्लोन के नाम से जाना जाता प्रतिलिपि संख्या। सभी प्रतिक्रियाओं तीन प्रतियों में प्रदर्शन किया गया और डेटा वाणिज्यिक सॉफ्टवेयर का उपयोग कर विश्लेषण किया गया। त्रुटि सलाखों के मानक विचलन का प्रतिनिधित्व करते हैं।

अंग स्टॉक 50 μL प्रतिक्रिया के लिए अंतिम मात्रा
phiX174 प्लास्मिड डीएनए 10 एनजी / μL 5.0 μL
GoTaq प्रतिक्रिया बफर 5x 10.0 μL
dNTP न्यूक्लियोटाइड मिश्रण 10 मिमी प्रत्येक 1.0 μL
phiX174-एफ प्राइमर 10 माइक्रोन 2.5 μL
phiX174 आर प्राइमर 10 माइक्रोन 2.5 μL
GoTaq डीएनए पोलीमरेज़ (5 यू / μL) 0.25 μL
Nuclease मुक्त आसुत जल - 28.75 μL

तालिका एक।

95 डिग्री सेल्सियस = 2 मिनट
साइकिल 34 के repetitions:
95 डिग्री सेल्सियस = 30 s
53 डिग्री सेल्सियस = 30 s
72 डिग्री सेल्सियस = 2 मिनट
72 डिग्री सेल्सियस = 10 मिनट
4 डिग्री सेल्सियस = पकड़ो

सारणी 2।

अंग स्टॉक 50 μL प्रतिक्रिया के लिए अंतिम मात्रा
IVI प्रतिक्रिया डीएनए उत्पाद - 5.0 μL
GoTaq प्रतिक्रिया बफर 5x 10.0 μL
dNTP न्यूक्लियोटाइड मिश्रण 10 मिमी प्रत्येक 1.0 μL
लीटर प्राइमर 10 माइक्रोन 2.5 μL
phiX174 प्राइमर 10 माइक्रोन 2.5 μL
GoTaq डीएनए पोलीमरेज़ (5 यू / μL) 0.25 μL
Nuclease मुक्त आसुत जल - 28.75 μL

टेबल तीन।

95 डिग्री सेल्सियस = 5 मिनट
साइकिल 23 repetitions:
94 डिग्री सेल्सियस = 30 s
55 डिग्री सेल्सियस = 30 s
72 डिग्री सेल्सियस = 4 मिनट
72 डिग्री सेल्सियस = 10 मिनट
4 डिग्री सेल्सियस = पकड़ो

तालिका 4।

<टीडी> TaqMan जांच
अंग स्टॉक 30 μL प्रतिक्रिया के लिए अंतिम मात्रा
1 सेंट दौर पीसीआर उत्पादों - 5.0 μL
लीटर आर प्राइमर 10 माइक्रोन 0.9 μL
लीटर यू प्राइमर 10 माइक्रोन 0.9 μL
10 माइक्रोन 0.3 μL
बुद्धि Supermix 2x 15.0 μL
Nuclease मुक्त आसुत जल - 7.9 μL

तालिका 5।

95 डिग्री सेल्सियस = 3 मिनट
साइकिल 39 के repetitions:
94 डिग्री सेल्सियस = 15 s
58 डिग्री सेल्सियस = 30 s
72 डिग्री सेल्सियस = 30 s
प्लेट पढ़ें

तालिका 6।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

रेट्रोवायरल pics के जैव रासायनिक विश्लेषण रेट्रोवायरल डीएनए एकीकरण की व्यवस्था में महत्वपूर्ण अंतर्दृष्टि प्रदान की है। रेट्रोवायरल pics के एकीकरण गतिविधि का मापन पट्टिका गठन परख, दक्षिणी धब्बा विश्लेषण, और नेस्टेड qPCR द्वारा प्राप्त किया जा सकता है। पट्टिका परख की प्रयोगात्मक रणनीति श्रमसाध्य है और एकीकरण 6, 7, 18 को मापने के लिए एक अप्रत्यक्ष विधि का इस्तेमाल करता है। दक्षिणी धब्बा आधारित assays उपाय के एकीकरण सीधे लेकिन PICs 6, 7, 18 की अपेक्षाकृत अधिक मात्रा में आवश्यकता होती है।

इस रिपोर्ट में इन विट्रो में एचआईवी -1 PIC जुड़े एकीकरण गतिविधि को मापने के लिए एक नेस्टेड qPCR रणनीति का विवरण। प्रमुख लाभ और इस विधि के महत्व प्रतिक्रिया 4 प्रति PIC तैयारी की अपेक्षाकृत कम मात्रा की आवश्यकता है, 5, 19। इस विधि का सबसे महत्वपूर्ण कदम के संक्रमण के लिए एक उच्च अनुमापांक वायरस की पीढ़ी और तस्वीर तैयारी की संभाल रहे हैं। यहां यह ध्यान दिया जाना चाहिए कि पीसीआर के पहले दौर के एकीकरण जंक्शनों का तेजी से प्रवर्धन शामिल है। नतीजतन, एकीकृत vDNA की प्रतिलिपि संख्या दूसरे दौर qPCR में निर्धारित किया है PIC जुड़े vDNA प्रतियां का एक उपाय नहीं देने की सीमा अर्द्ध मात्रात्मक हैं और इसलिए। हालांकि, तस्वीर जुड़े vDNA qPCR द्वारा निर्धारित किया जा सकता है की डीएनए लीटर विशिष्ट प्राइमरों के साथ pics से शुद्ध। एकीकृत vDNA के अनुपात इसी PIC जुड़े vDNA करने के लिए संख्या की प्रतिलिपि इन विट्रो एकीकरण प्रतिक्रिया के एकीकरण दक्षता के बारे में जानकारी प्रदान कर सकते हैं। इस विधि के चुनाव और अन्य प्राइमरों के अन्य heterologous लक्ष्य डीएनए को शामिल दोनों झुकाव में एकीकरण का पता लगाने के द्वारा संशोधित किया जा सकता है। सारांश में, विधियहाँ वर्णित मात्रात्मक एचआईवी -1 pics के एकीकरण गतिविधि के उपाय और अनुसंधान रेट्रोवायरल एकीकरण के जैव रासायनिक विवरण की समझ विकसित करने के लिए अपनाया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों कोई प्रतिस्पर्धा वित्तीय और गैर वित्तीय हितों की घोषणा।

Acknowledgments

इस काम आंशिक रूप से अनुदान DA024558, DA30896, DA033892, और DA021471 NIDA / एनआईएच सीडी से द्वारा समर्थित है। हम यह भी RCMI अनुदान G12MD007586 स्वीकार करते हैं, वेंडरबिल्ट सीटीएसए अनुदान UL1RR024975, Meharry ट्रांसलेशनल रिसर्च सेंटर NCRR / एनआईएच, NIMHD / एनआईएच से U54 अनुदान MD007593, और टेनेसी CFAR अनुदान P30 AI110527 से (MeTRC) सीटीएसए अनुदान U54 RR026140।

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
का नाप<em&gt; इन विट्रो</em&gt; एचआईवी -1 Preintegration परिसर की एकता गतिविधि
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter