Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Измерение doi: 10.3791/54581 Published: February 22, 2017

Abstract

ВИЧ-1 белки оболочки участвовать родственные рецепторы на поверхности клетки-мишени, что приводит к слиянию мембран вирусной клеток с последующим выделением ядра вирусный капсид (СА) в цитоплазму. Впоследствии обратной транскриптазы вируса (RT), как часть одноименным нуклеопротеидную комплекса называется обратной транскрипцией комплекс (РТК), преобразует вирусную одноцепочечной РНК-геном в копию двухцепочечной ДНК (vDNA). Это приводит к биогенезе другого нуклеопротеидной комплекса, называемый предварительно интеграционного комплекса (PIC), состоящий из vDNA и ассоциированных вирусных белков и факторов организма. PIC-ассоциированный вирусный интегразы (IN) оркеструет интеграции vDNA в хромосомной ДНК хозяина в во времени и пространстве регулируется двухступенчатого процесса. Во-первых, в процессах концы 3 'в vDNA в цитоплазму и, во-вторых, после того, как ПИК трафиков к ядру, он опосредует интеграцию обработанного vDNA в хромосомную ДНК. В ОСТО изолированныеот клеток - мишеней , остро инфицированных ВИЧ-1 , являются функциональными в лабораторных условиях , так как они компетентны интегрировать соответствующий vDNA в экзогенно добавленного гетерологичной ДНК - мишени. Такой PIC на основе анализов в пробирке интеграции в значительной мере способствовали разграничению механистические детали ретровирусной интеграции и обнаружения ингибиторами. В этом докладе мы подробно остановимся на обновленном ВИЧ-1 ПОС анализа , в которой используется -На стратегию вложенная в реальном масштабе времени количественной полимеразной цепной реакции (КПЦР) для измерения интеграции активности в пробирке изолированных коренных ТОС.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ВИЧ-1 репликации в клетке-мишени включает в себя несколько этапов, в широком смысле, сгруппированных в два этапа: ранние и поздние события. Ранние события начинают , когда ВИЧ-1 последовательно связывается с поверхностным рецептором клетки - мишени CD4 и один из двух корецепторами (CCR5 или CXCR4) 1. Следовательно, вирус-клеточных мембран взрыватель, и вирусный капсид (СА) ядро высвобождается в цитоплазму 2. Ядро СА содержит вирусную геномную одноцепочечной РНК (ssRNA) и несколько белков, как вирусными и клеточными по своему происхождению. CA-ассоциированных вирусные белки включают обратной транскриптазы (RT) и интегразы (IN), двух ферментов, которые опосредуют важные шаги в ходе ранних событий в репликации вируса. RT и IN функции в контексте нуклеопротеидных комплексов, а именно с обратной транскрипцией комплекс (РТК) и пре-интеграционного комплекса (ПОС), соответственно 3, 4, 5 <SUP>, 6. Концы вирусного генома ssRNA гавани концевого повтора (R) элементов примыкающие к уникальной последовательности U5 (на 5'-конце) и U3 (на 3'-конце). RTC преобразует вирусный геном ssRNA в двухцепочечной (DS) ДНК-копии (vDNA). Этот обратный процесс транскрипции также приводит к дублированию U5 и U3 последовательностей, таким образом , генерируя длинные концевые повторы (LTR) на обоих концах vDNA 7, 8. Впоследствии КВС-ассоциирована в катализирует два последовательных биохимических реакций , которые позволяют интеграцию vDNA в хромосому хозяина 9, 10, 11. Во- первых, в цитоплазме, В мультимеры участвовать оба Ltrs 12 и расщепляют динуклеотид от каждого из 3'-концевых. Этот 3'-конце обработки генерирует гидроксильную группу на каждом 3'-конце (CA ОН) от vDNA.Затем ПИК трафиков к ядру, где в использует vDNA CA ОН в качестве нуклеофильного агента, чтобы отрезать обе нити хромосомной ДНК в шахматном порядке. Одновременно в координационно сростков оба конца vDNA к результирующим фосфодиэфирной связи на противоположных нитей в хромосомную ДНК. После этой стадии переноса цепи, клетка-хозяин машины удаляет два неспаренных нуклеотида на концах 5 'vDNA и ремонт вытекающие отсюда одноцепочечные пробелы на стыке сайта интеграции. Первые события, таким образом, завершаются с созданием интегрированной ДНК-копии (провирусной) от ВИЧ-1 генома. Провирус обеспечивает подходящую среду для эффективной экспрессии вирусного гена, который инициирует последующие события, в том числе экспрессию вирусных-кодируемых белков; сборка незрелого вируса; и подающий надежды, выпуск и созревание в инфекционных вирионов 13.

Очищенный рекомбинантный ретровирусный В компетентенпроводить в лабораторных условиях , оба вида деятельности для обработки и переноса цепи 3'-конец на экзогенно ДНК LTR-как субстрат. Биохимические исследования с использованием такого очищенного рекомбинантного IN выявили критические аспекты vDNA интеграции 14, 15, 16, 17. Тем не менее, в отличие от естественной инфекции, эта биохимическая реакция в пробирке не поддерживает согласованную интеграцию обоих концов субстратной ДНК в ДНК - мишени. В противоположность этому, ретровирусные ТОС, выделенные из остро инфицированных клеток скоординированно интегрировать оба конца эндогенных vDNA в гетерологичной ДНК-мишени. Это привело к широкому распространению и последующих уточнений Vitro интеграции (IVI) анализов I N с использованием выделенных родных ОСТО.

В первом сообщалось ретровирусов IVI анализа цитоплазматические экстракты из клеток, инфицированных рекомбинантным мышинойЛейкоз Вирус (MLV) укрывает ген кишечной палочки supF в его LTR служил в качестве источника активности IN, и ДНК мутантного фага лямбда неполноценный в литического роста был экзогенно в качестве ДНК - мишени. Успешная интеграция рекомбинантной ДНК MLV скопировать в ДНК фага и последующее supF выражение привело к восстановлению бляшкообразующих способности рекомбинантных фагов. Тем не менее, эта стратегия эксперимента является трудоемким и меры по интеграции косвенным образом. Для решения таких предостережений, Южный непрямое мечение по концам блот на основе, которая квантифицирует ПИК-ассоциированной IVI деятельности в качестве меры эндогенных vDNA интегрированной в экзогенный Линеаризованная бактериофага PHIX174 ДНК, была разработана 6, 7, 18. Хотя этот метод обеспечивает прямое измерение интеграционных мероприятий, относительно высокие количества препарата ПОС необходимы, которая остается сложной техническистремиться. Чтобы обойти это, гнездовой ПЦР на основе анализов , требующих лишь скромные суммы ОСТО были разработаны 4, 5, 19.

В этом докладе мы описываем обновленную версию вложенной ПЦР на основе в пробирке методом изобретенной резюмировать ВИЧ-1 PIC-опосредованного интеграции деятельности , происходящих во время естественной инфекции. Этот метод использует цитоплазматические экстракты ВИЧ-1-инфицированных клеток-мишеней в качестве источника эндогенного PIC активности, которая измеряется в режиме реального времени количественной полимеразной цепной реакции (КПЦР). Процедуры выделения ОСТО и измерения их деятельности по интеграции адаптированы, с изменениями, из протоколов , опубликованных в лаборатории Engelman 20. В этом методе, интегрирование активности ПОС-ассоциированной инициируется путем создания ДНК - мишени экзогенной линейный 21, и продукты ДНК в результатеэта реакция интеграции очищают и используют в качестве исходного материала для последующего ПЦР-квантификации. В первом раунде обычной ПЦР, стыки ДНК вирусно-мишени амплифицируют с использованием соответствующих праймеров. Во втором раунде КПЦР, LTR-специфические праймеры используются специально обогащают популяцию vDNA от первого раунда ПЦР-продуктов. Пожалуйста, смотрите раздел протокола для подробного описания этого метода.

В пробирке исследования с ретровирусных ОСТО привели к значительному прогрессу в понимании механизма интеграции ретровируса ДНК и в разработке ингибиторов IN. На основе недавнего повышенного внимания отображение ВИЧ-1 интеграции сайтов, определение роли вирусных и принимающих факторов у ВИЧ-1 интеграции, а также разработки новых противовирусных препаратов на борьбу с лекарственной устойчивостью, мы предусматриваем повышенный интерес и широкое применение IVI анализов , как описанный в настоящем докладе. Это, в свою очередь, приведет кбудущих уточнений в методе, таким образом, диверсифицировать сферу ее применения.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Вирус Производство

Примечание: Для генерации высокие титры инфекционного ВИЧ-1, трансфекции клеточной линии эмбриональной почки человека (НЕК) 293T с инфекционным ВИЧ-1 молекулярного клона с использованием активированного дендримера на основе реагента для трансфекции. Было установлено, что метод с фосфатом кальция трансфекцию дает сравнимые результаты.

  1. В лаборатории биологической безопасности 2 -го уровня (BSL2), семена 3 × 10 6 клеток 293Т на 10 см чашку в 8 мл Дульбекко в модификации Дульбекко (DMEM) , дополненной 10% фетальной бычьей сыворотки (FBS), пенициллином и стрептомицином. Культуры клеток в инкубатор при температуре 37 ° С и 5% СО 2 O / N.
  2. На следующий день, для трансфекции клеток в каждой 10 см чашку, разбавленные 8 мкг pNL4-3 плазмидной ДНК (см Материалы таблицу) до конечного объема 300 мкл DMEM , не хватает сыворотки и антибиотики. Добавить 80 мкл реагента для трансфекции, хорошо перемешать с помощью пипетки и инкубировать при комнатной температуре5 - 10 мин для образования комплекса трансфекции.
  3. Извлеките носитель из тарелок с помощью аспирации и добавить 7 мл на чашку свежей DMEM, содержащей сыворотки и антибиотики.
  4. Добавить 1 мл DMEM, содержащей сыворотку крови и антибиотики трансфекции комплексом, перемешать с помощью пипетки, и добавить эту смесь к клеткам. Аккуратно водоворот блюдо, чтобы облегчить равномерное распределение трансфекцию комплексов.
  5. Сразу передачи клетки в BSL3 лаборатории, место в термостате при 37 ° С и 5% СО 2, и культуру клеток в течение 48 ч.
  6. Собирают вируссодержащих тканевой культуры супернатанта с помощью пипетки, а затем передать ее в центрифужную пробирку. Центрифуга при 300 мкг в течение 5 мин для осаждения клеток и мусора, а затем фильтровать супернатанта через шприцевой фильтр 0,45 мкм размером пор.
  7. Чтобы устранить любую переходящий плазмидной ДНК в этой бесклеточной препарата вируса, лечения с ДНКазы 1 (20 мкг / мл) при 37 ° С в течение 1 ч.
  8. Для количественной оценкиВИЧ-1 титр, используют р24 специфические твердофазного иммуноферментного анализа (ELISA), так как это быстрый и поддающийся метод для повседневного использования 22.
    Примечание: Следует отметить, что р24 ELISA измеряет физическую титр (количество вирусных частиц). В качестве альтернативы, измерение активности вируса RT-ассоциированной (экзогенные анализа RT) или инфекционность вируса (ПЗМ-бл анализы в отношении инфекционности индикатора клеточной линии на основе) обеспечит исключительное считывание инфекционных вирусных частиц.

2. Вирус Инфекция Sup-T1 клетки (BSL3 Lab)

  1. В лаборатории BSL2, поддерживать клетки Sup-T1 от 1,0 × 10 6 и 2,0 × 10 6 клеток / мл в Институте Roswell Park Memorial (RPMI) среде , дополненной 10% инактивированной нагреванием FBS, пенициллином и стрептомицином (расщепленный соотношении 1 : 2 раз в 2 - 3 г). Объединяют клетки Sup-T1 из культуральных флаконах, хорошо перемешать с помощью пипетки, и определить количество жизнеспособных клеток с помощью гемоцитометра и трипанового синего улметод Aining.
    1. Подготовьте необходимое количество аликвоты 80 х 10 6 клеток (за вирусной инфекции) в 50 мл коническую центрифужные пробирки.
    2. Центрифуга клетки в бакет-роторе при 500g и 25 ° С в течение 5 мин. Без снятия клеточной культуральной среды, перенести пробирки, содержащие осажденные клетки в лабораторию BSL3 для дальнейшей обработки. Тщательно аспирата среду для культивирования клеток из трубки, не нарушая клеточный осадок.
  2. Добавьте соответствующее количество ДНКазы I-обработанной вирусной посевного материала к клеткам в трубе и хорошо перемешать, осторожно пипеткой. Для 80 - х 10 6 клеток, используют 30 мл ДНКазы I-обработанного вируса (50 мкг р24-эквивалент вируса).
    Примечание: Выделение функциональных ОСТО требует заражения клеток-мишеней с очень высокой кратности инфекции (MOI).
  3. Распределить смесь равномерно между двумя 6-луночные планшеты для тканевых культур (т.е. 12 х 2,5 мл аликвоты, использовать 2 пластин в Infectиона).
  4. Для spinoculation, поместите планшеты для культивирования в несущих плит и центрифуге с использованием Бакет ротор на 480 XG и 25 ° С в течение 2 ч.
  5. Инкубируйте spinoculated клетки при 37 ° С и 5% СО 2 в течение 5 ч.

3. Сбор и лизис зараженных клеток (BSL3 лаборатории)

  1. Объединяют клетки, соответствующие каждой инфекции из культуры пластин в 50 мл коническую центрифужную пробирку (~ 30 мл в общей сложности).
  2. Урожай клетки центрифугированием при 300 х г и 25 ° С в течение 10 мин. Тщательно аспирата супернатант из трубки (в качестве альтернативы, используйте пипетку).
  3. Для того, чтобы удалить любые остаточные вирусные частицы, моют каждый клеточный осадок путем добавления 2 мл буфера K - / - (150 мМ КСl, 20 мМ HEPES, рН 7,6, 5 мМ MgCl 2) и центрифугирование пробы при 300 х г и 25 ° С в течение 10 минут. Затем, не нарушая гранул, осторожно удалите супернатант аспирацией или с помощью пипетки.
  4. Repeaт шаг 3.3.
  5. Осторожно удалить остатки буфера с помощью микропипетки. Ресуспендируют каждый осадок клеток в 2 мл охлажденного льдом буфера для лизиса K + / + (Buffer K - / - с добавлением 0,025% дигитонин, 1 мМ DTT, 20 мкг / мл апротинина), перемешать содержимое осторожно пипеткой, и перенести в 2 мл микроцентрифужных трубки.

4. Получение цитоплазматической ОСТО (BSL3 лаборатории)

  1. Рок образцы на ротационном шейкере при комнатной температуре в течение 10 мин.
  2. Центрифуга образцов, с ротором, предварительно охлажденным до 4 ° С, при 1500 х г и 4 ° С в течение 4 мин.
  3. Без нарушая гранул, тщательно передачи супернатант в свежую пробирку микроцентрифужных и центрифуге при 16000 х г и 4 ° С в течение 1 мин.
  4. Аккуратно перенести супернатант в свежую пробирку микроцентрифужных. Добавить РНКазы А (20 мг / мл) до конечной концентрации 20 мкг / мл (2 мкл на 2 мл ТОС) и инкубировать содержимое при комнатной температуре в течение 30 мин (не-качалка). </ Li>
  5. Добавить сахарозы (60% вес / объем в буфере K - / -) до конечной концентрации 7% и хорошо перемешать, осторожно пипеткой. Подготовка аликвоты (например, 200 мкл) ТОС в микропробирок, флэш-замораживание в жидком азоте, а также место в -80 ° C морозильнике для длительного хранения.

5. In Vitro интеграции (IVI) наборы для определения ВИЧ-1 ОСТО

  1. Подготовьте целевой ДНК, используемой в анализе IVI путем амплификации участка 2,0 кб из ДНК плазмиды PHIX174 с помощью ПЦР с использованием заказных праймеров, PHIX174-F и PHIX174-R.
    1. Собрать ПЦР - смеси , как описано в таблице 1. Выполните ПЦР в термоциклеру с использованием теплового режима езды на велосипеде , рекомендованные в таблице 2. Гель-очистки продукта ПЦР с использованием набора для гель-очистки (в соответствии с протоколом, рекомендованный производителем), а не хранить очищенный ДНК-мишени в виде аликвот при -80 ° С до использования.
  2. Добавьте 600 нг ДНК-мишени до 200 - & #181; L Аликвоту ОСТО, хорошо перемешать и инкубировать при температуре 37 ° С в течение 45 мин.
    Примечание: IVI реакции опускаю ДНК - мишени или включая ингибитор интегразы (например, ралтегравиром) рекомендуются реакции контроля.
  3. Остановить реакцию IVI путем добавления ДСН, ЭДТА и протеиназы К до конечной концентрации 0,5%, 8 мМ и 0,5 мг / мл, соответственно. Смешайте содержимое реакции тщательно и инкубировать в течение ночи при 56 ° C.
  4. На следующий день, очищают Общую ДНК из реакции IVI фенолом / экстракции хлороформом и осаждением этанолом. Выполнить все операции центрифугирования при 16,000 XG и РТ.
  5. Добавить равный объем фенола к депротеинизированной образца, энергично перемешать встряхиванием и центрифуги в течение 2 мин. Осторожно снимите верхнюю водную фазу и перенести его в чистую пробирку.
  6. Повторите шаг 5.5. Перенести верхнюю водную фазу в свежую пробирку.
  7. Добавить равный объем 1: 1 фенол: хлороформ, энергично перемешать встряхиванием, и центрифуга FOг 2 мин. Перенести верхнюю водную фазу в свежую пробирку.
  8. Добавить равный объем хлороформа, энергично перемешать встряхиванием и центрифугировать в течение 2 мин. Перенести верхнюю водную фазу в свежую пробирку.
  9. Для того, чтобы осадить ДНК, добавляют гликоген до конечной концентрации 0,1 мкг / мкл, 3 М ацетата натрия до конечной концентрации 0,3 М и 2,5 объемов 100% этанола (охлажденного на льду). Vortex смешивать, центрифугу на короткое время, чтобы собрать содержимое, и поместить трубку при -80 ° CO / N.
  10. На следующий день, центрифугирование образца в течение 30 мин при 16000 х г и 4 ° С в течение 30 мин. Осторожно удалите супернатант, не нарушая гранул.
  11. Добавьте 500 мкл 80% этанола (охлажденного на льду) к осадку и центрифугируют при 16000 х г и 4 ° С в течение 10 мин. Высушите осадка ДНК при комнатной температуре и тщательно ресуспендируют в 50 мкл нуклеазы без воды. Хранить образцы ДНК при -20 ° С.

6. ПЦР для количественной оценки ПОС активность

  1. Выполнение первого раунда обычной ПЦР с использованием праймеров, нацеленные на вирусный LTR и ДНК PHIX174 (LTR и PHIX174 праймеров, соответственно) для усиления стыках интегрированной ДНК ВИЧ-1.
    1. Сборка первого раунда ПЦР смеси , как описано в таблице 3. Собирают мастер смеси всех компонентов, за исключением ДНК-матрицы, дозировать 45-мкл аликвоты в отдельные пробирки для ПЦР, и добавляют 5 мкл матричной ДНК или нуклеазы без воды (контроль).
    2. ПЦР в амплификатор с использованием теплового режима езды на велосипеде , рекомендованные в таблице 4.
  2. Выполните второй тур КПЦР с использованием праймеров, которые фланкируют короткую область вирусного LTR (LTR-R и LTR-U праймеров), чтобы избирательно усиливать интегрированные vDNA последовательности из первого-ропродукты унд ПЦР. Для того, чтобы определить , интегрированные vDNA копировать номера, генерировать стандартную кривую, используя 10x серийные разведения известных числа копий (например, 10 0 - 10 8) молекулярного клона ВИЧ-1.
    1. Соберите второй тур КПЦР смеси , как описано в таблице 5. Соберите мастер смеси всех компонентов, за исключением матричной ДНК, тщательно 25 мкл аликвоты в соответствующее количество лунок в 96-луночного реакционного планшета ПЦР, а затем добавляют 5 мкл неочищенной первого раунда ПЦР-продуктов или нуклеазы без воды (контроль). Выполните все реакции КПЦР в трех экземплярах.
    2. Вставьте пластину ПЦР в ПЦР в реальном времени инструмент и выполнять КПЦР с использованием условий , езда на велосипеде , рекомендованные в таблице 6.
    3. Анализ данных с помощью соответствующего программного обеспечения.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Выделение ВИЧ-1 ОСТО

Схема протокола , используемого для изоляции ВИЧ-1 ОСТО из остро инфицированных клеток Sup-T1 изображен на рисунке 1. Этот протокол является производным от методов , описанных Engelman и соавт. 19, 20. ВИЧ-1 ОСТО нуклеопротеида комплексы , которые собраны в инфицированных клетках и состоят из обратной транскрипции vDNA, вирусные белки и клеточные факторы , 19, 20. Описанный в данном отчете метод использует цитоплазматические экстракты ВИЧ-1-инфицированных клеток в качестве источника PIC-ассоциированной интеграционной деятельности.

В пробирке интеграции активности ВИЧ-1 ОСТО

рисунке 2. Этот метод использует вложенную стратегию КПЦР на основе измерения PIC-ассоциированной IVI активности, а процедуры адаптированы, с некоторыми изменениями, из протоколов , опубликованных в лаборатории Engelman 19, 20, 21. В этом методе, интегрирование активности ПОС-ассоциированной инициируется путем предоставления целевой ДНК гетерологичный линейную 21, а продукты ДНК , возникающие в результате этой реакции интеграции очищают и используют в качестве исходного материала для последующего ПЦР-квантификации. В первом раунде обычной ПЦР, стыки ДНК вирусно-мишени амплифицируют с использованием соответствующих праймеров. Во втором раунде КПЦР, LTR-специфические праймеры используются специально обогащают популяцию vDNA от первого раунда ПЦР-продуктов. Пожалуйста, обратитесь к протоколу SАЗДЕЛ подробное описание этого метода.

Типичные результаты анализе IVI проводили с использованием ВИЧ-1 ОСТО показаны на рисунке 3. Sup-T1 клетки (80 х 10 6 клеток / инфекция) были spinoculated 30 мл ДНКазы 1 , обработанного ВИЧ-1 (~ 50 мкг р24 эквивалента) в отсутствие или в присутствии 1 мкМ ВИЧ-1 ингибитора ралтегравиром при 480 XG и 25 ° С в течение 2 ч. Затем клетки культивировали в течение 5 ч при температуре 37 ° С и 5% CO 2. ТОС были выделены, как это описано в разделе протокола. Реакции IVI проводились, каждый из которых использует 200 мкл ТОС и 600 нг ДНК-мишени (ДНК-фрагмент в 2 кб амплифицировали из ДНК PHIX174 с помощью ПЦР), при 37 ° С в течение 45 мин. Реакции депротеинизировали протеиназой К в присутствии додецилсульфата натрия и ЭДТА при 56 ° CO / N. Продукты реакции дважды экстрагировали фенолом и один раз фенолом: хлороформом (1: 1) смеси, и один разхлороформом. Затем ДНК осаждали этанолом в присутствии соли и совместного осадителя гликоген, и осадок ДНК промывали один раз 80% этанолом. Очищенную ДНК ресуспендировали в 50 мкл нуклеазы без воды. Вложенный стратегия КПЦР была использована для определения количества vDNA интегрированного в ДНК PHIX174. В первом раунде обычной ПЦР, праймеры, комплементарные последовательностям на ДНК-мишени PHIX174 и вирусного LTR области были использованы для амплификации интегрированных вирусно-мишеней ДНК из перекрестков 5 мкл продуктов ДНК реакции интеграции. Во втором раунде КПЦР, LTR остовного праймеры использовали для амплификации исключительно ВИЧ-специфических последовательностей ДНК из 5 мкл первого раунда ампликоне продуктов и от 10-кратных серийных разведений известных числа копий (10 8 -10 0) молекулярного клона ВИЧ-1 (Стандарты).

Все реакции КПЦР проводили в трех экземплярах и данные WERе проанализированы с использованием коммерческого программного обеспечения. Значения, полученные от стандартов были построены для получения стандартной кривой, из которой интегрированные vDNA копировать номера интерполировались. Столбики ошибок обозначают стандартные отклонения. Как показано на рисунке 3, ВИЧ-1 ОСТО робастно интегрировать соответствующий vDNA в ДНК - мишени (полоса 5). Важно отметить, что эффективность IVI из ОСТО была значительно уменьшена в реакциях с добавлением ингибитора в ралтегравиром (Lane 6). Это сильно приписывает интеграционную активность, измеренную в данном анализе на ВИЧ-1. Кроме того, реакции управления, содержащие цитоплазматические лизаты из неинфицированных клеток (дорожка 1), по отдельности ТОС (дорожка 2), задачи в одиночку ДНК (дорожка 3), и только буфер (дорожка 4) не показал какой-либо интеграционной деятельности. Кроме того, контроль, исключающий Taq-полимеразы в первом раунде ПЦР (дорожка 7) не усиливать продуктов интеграции. Следует отметить, что данные из ТОС-Alone контроля (дорожка 2), показали, что вложенная стратегия КПЦР Удельныйтически измеряет интегрированный vDNA но не ПОС-ассоциированной vDNA. В совокупности эти данные показывают измерения ПОС-ассоциированной интеграционной деятельности.

Рисунок 1
Рисунок 1: Схематическое представление Протокола по подготовке ВИЧ-1 ОСТО. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Цитоплазма экстракты, содержащие ТОС изолированы от ВИЧ-1-инфицированных клеток Sup-T1. Эти ОСТО используются в качестве источника интеграции активности в пробирке интеграции анализа в.

фигура 2
Рисунок 2: Схематическое изображение в Vitro м> Интеграция Анализ ВИЧ-1 ОСТО. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Интеграционные анализы проводили в пробирке с использованием ВИЧ-1 и ТОС гетерологичный мишень PHIX174 ДНК. Интегральная ДНК ВИЧ-1 была измерена с помощью вложенной стратегии ПЦР, в которой в первом раунде обычной ПЦР усиливает интеграционные перекрестки из которых vDNA-специфические последовательности преимущественно дополненную в втором раунде КПЦР.

Рисунок 3
Рисунок 3: ВИЧ-1 ПОС-ассоциированной vDNA интеграционной деятельности. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

"ВОК: Keep-together.within-страницу =" 1 "> Представитель результаты ВИЧ-1 ПОС-ассоциированной интеграции Анализ активности Интегрированные vDNA число копий были определены путем построения графика значений, полученных из стандартной кривой, полученной с помощью 10x серийные разведения. известные числа копий ВИЧ-1 молекулярного клона. Все реакции проводили в трех экземплярах, и данные были проанализированы с использованием коммерческого программного обеспечения. Столбики ошибок обозначают стандартные отклонения.

Компонент Акции Конечный объем для реакции 50 мкл
PHIX174 плазмидной ДНК 10 нг / мкл 5,0 мкл
реакционный буфер GoTaq 5x 10,0 мкл
дНТФ нуклеотид смесь 10 мМ каждого 1,0 мкл
PHIX174-F праймер 10 мкМ 2,5 мкл
PHIX174-R праймер 10 мкМ 2,5 мкл
GoTaq ДНК-полимераза (5 ед / мкл) 0,25 мкл
Нуклеазы без дистиллированной воды - 28.75 мкл

Таблица 1.

95 ° С = 2 мин
Цикл 34 повторений:
95 ° C = 30 сек
53 ° C = 30 сек
72 ° С = 2 мин
72 ° C = 10 мин
4 ° C = Удержание

Таблица 2.

Компонент Акции Конечный объем для реакции 50 мкл IVI продукт реакции ДНК - 5,0 мкл реакционный буфер GoTaq 5x 10,0 мкл дНТФ нуклеотид смесь 10 мМ каждого 1,0 мкл LTR праймер 10 мкМ 2,5 мкл PHIX174 праймер 10 мкМ 2,5 мкл GoTaq ДНК-полимераза (5 ед / мкл) 0,25 мкл Нуклеазы без дистиллированной воды - 28.75 мкл

Таблица 3.

95 ° C = 5 мин
Цикл 23 повторений:
94 ° C = 30 сек
55 ° C = 30 сек
72 ° С = 4 мин
72 ° C = 10 мин
4 ° C = Удержание

Таблица 4.

<TD> Taqman Probe
Компонент Акции Конечный объем для реакции 30 мкл
1 - й раунд ПЦР - продукты - 5,0 мкл
LTR-R праймер 10 мкМ 0,9 мкл
LTR-U праймера 10 мкМ 0,9 мкл
10 мкМ 0,3 мкл
Iq Supermix 2x 15,0 мкл
Нуклеазы без дистиллированной воды - 7,9 мкл

Таблица 5.

95 ° С = 3 мин
Цикл 39 повторений:
94 ° С = 15 с
58 ° C = 30 с
72 ° C = 30 сек
Тарелка Читать

Таблица 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Биохимические анализы ретровирусных ОСТО обеспечили критические идеи в механизм ретровируса интеграции ДНК. Измерение активности интеграции ретровирусных ТОС может быть достигнута с помощью зубного налета анализа формирования, Саузерн-блот-анализа, и гнездовой кПЦР. Экспериментальная стратегия анализа бляшек является трудоемким и использует косвенный метод для измерения интеграции 6, 7, 18. Саузерн - блот на основе интеграции анализы мера непосредственно , но требуют относительно больших количеств ТОС 6, 7, 18.

В настоящем докладе подробно вложенную стратегию КПЦР для измерения ВИЧ-1 ПОС-ассоциированной интеграции активности в пробирке. Главное преимущество и значимость этого метода является требование относительно низких количеств препарата PIC на реакцию 4, 5, 19. Наиболее важными этапами этого способа являются генерация вируса с высоким титром для инфекции и обработка подготовки ПОС. Следует отметить, что первый раунд ПЦР включает в себя экспоненциальное усиление интеграционных переходов. Следовательно, число копий интегрированного vDNA определены во втором раунде кПЦР являются полуколичественный и, следовательно, имеют ограничение не дает меру ПОС-ассоциированной vDNA копий. Тем не менее, ПОС-ассоциированной vDNA может быть определена путем кПЦР ДНК очищали из ТОС с ДКП-специфических праймеров. Соотношение интегрированных vDNA число копий к соответствующему ПОС-ассоциированной vDNA может предоставить информацию об эффективности интеграции в пробирке реакции интеграции в. Этот метод может быть изменен путем включения других гетерологичную ДНК-мишени выбора и других праймеров для обнаружения интеграции в обоих направлениях. Таким образом, методОписанная здесь измеряет интеграционную активность ВИЧ-1 ОСТО количественно и могут быть приняты для исследования развития понимания биохимических деталей ретровируса интеграции.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют нет конкурирующих финансовых и нефинансовых интересов.

Acknowledgments

Эта работа частично поддержана грантами DA024558, DA30896, DA033892 и DA021471 из NIDA / NIH на компакт-диске. Мы также признаем грант G12MD007586 RCMI, Вандербильта CTSA грант UL1RR024975, то Мехарри Поступательное Научно-исследовательский центр (MeTRC) CTSA грант U54 RR026140 от NCRR / NIH, грант U54 MD007593 от NIMHD / NIH и Теннесси CFAR грант P30 AI110527.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
Измерение<em&gt; In Vitro</em&gt; Интеграция активность ВИЧ-1 Preintegration Комплексы
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter