Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

mätning av doi: 10.3791/54581 Published: February 22, 2017

Abstract

HIV-1-höljesproteiner i ingrepp besläktade receptorer på målcellens yta, vilket leder till viral-cellmembranfusion, följt av frisättning av den virala kapsiden (CA) kärnan in i cytoplasman. Därefter det virala omvänt transkriptas (RT), som en del av en namne nukleoprotein komplex kallas omvänd transkription Complex (RTC), omvandlar den virala enkelsträngat RNA-genom in i en dubbelsträngad DNA-kopia (vDNA). Detta leder till biogenes av annan nukleoprotein komplex, kallas pre-integrationskomplex (PIC), bestående av vDNA och tillhörande virusproteiner och värdfaktorer. PIC-associerad viral integras (IN) dirigerar integreringen av vDNA: t in i värdens kromosomala DNA i en temporalt och spatialt reglerat tvåstegsprocess. För det första, i processer 3'-ändarna av vDNA: t i cytoplasman och, för det andra, efter det PIC trafikerar till kärnan, medierar den integrering av det bearbetade vDNA in i kromosomalt DNA. Pics isoleradefrån målceller akut infekterade med HIV-1 är funktionella in vitro, eftersom de är kompetenta att integrera tillhörande vDNA i en exogent tillsatt heterolog mål-DNA. Sådan PIC-baserade in vitro-analyser integrations har väsentligt bidragit till avgränsar de mekanistiska detaljerna i retroviral integration och upptäcka IN hämmare. I denna rapport har vi vidareutveckla en uppdaterad HIV-1 PIC-analys som använder en kapslad i realtid kvantitativ Polymerase Chain Reaction (qPCR) -baserad strategi för att mäta integration aktiviteten hos isolerade infödda PIC in vitro.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1-replikation i målcellen involverar flera steg, i stort sett grupperade i två faser: tidiga och sena händelser. De tidiga händelser börjar när HIV-1 sekventiellt binder till målet cellytereceptor CD4 och en av de två co-receptorer (CCR5 eller CXCR4) 1. Följaktligen viruset-cellmembran säkring, och den virala kapsiden (CA) kärnan frisätts i cytoplasman 2. CA-kärna innehåller det virala genomiska enkelsträngat RNA (ssRNA) och flera proteiner, både viralt och cellulärt ursprung. CA-associerade virala proteiner inkluderar omvänt transkriptas (RT) och integras (IN), två enzymer som förmedlar viktiga steg under tidiga händelser i virusreplikation. RT och IN-funktionen i samband med nukleoprotein komplex, nämligen omvänd transkription Complex (RTC) och pre-integrationskomplex (PIC), respektive 3, 4, 5 <sup>, 6. Ändarna på virala ssRNA genomet hamnterminalen upprepa (R) elementen som gränsar till den unika sekvenser U5 (vid 5 'änden) och U3 (vid 3'-änden). RTC omvandlar den virala ssRNA genomet i en dubbelsträngad (ds) DNA-kopia (vDNA). Denna omvända transkriptionen resulterar också i dubbel U5 och U3-sekvenser, vilket genererar långa terminala upprepningar (LTR) vid båda ändarna av vDNA 7, 8. Därefter katalyserar PIC-associerade IN två sekventiella biokemiska reaktioner som möjliggör integrationen av vDNA: t in i värdkromosomen 9, 10, 11. Först, i cytoplasman, IN multimerer fästa ihop de båda LTR 12 och klyva en dinukleotid från vardera av de 3'-terminala ändarna. Detta 3'-änden bearbetning ger en hydroxylgrupp vid varje 3'-ände (CA OH) av vDNA: t.Nästa, trafikerar PIC till kärnan, varvid IN använder vDNA CA OH som en nukleofil för att skära båda strängarna av det kromosomala DNA på ett förskjutet sätt. Samtidigt, IN skarvar koordinerat båda ändarna av vDNA: t till de resulterande fosfodiesterbindningar på motsatta strängar av kromosomalt DNA. Efter denna strängöverföringssteg, avlägsnar värdcellmaskineriet de två oparade nukleotider vid 5'-ändarna av vDNA: t och reparationer de följande enkelsträngade gap vid korsningen av integrationsstället. De tidiga händelser således kulminera med inrättandet av ett integrerat DNA-kopia (provirus) av HIV-1-genomet. Proviruset tillhandahåller en lämplig miljö för effektiv viral genexpression, vilket initierar senare händelser, inklusive uttrycket av viruskodade proteiner; montering av omogna virus; och spirande, release, och mognad i infektiösa virioner 13.

Renat rekombinant retroviral IN är behörig attgenomföra in vitro, både 3'-end bearbetning och sträng överföringar på exogent medföljande LTR-liknande substrat-DNA. Biokemiska studier med sådan renat rekombinant IN har avslöjat kritiska aspekter av vDNA integration 14, 15, 16, 17. Emellertid, till skillnad från vid naturlig infektion, detta in vitro biokemisk reaktion stöder inte samordnat integrering av båda ändarna av substrat-DNA in i mål-DNA. I kontrast, retrovirala PIC isolerade från akut infekterade celler concertedly integrera båda ändarna av den endogena vDNA in heterolog mål-DNA. Detta ledde till utbredd och efterföljande förfiningar av I n Vitro Integration (IVI) analyser med hjälp av isolerade infödda PIC.

I den första rapporterade retrovirala IVI-analysen, cytoplasmatiska extrakt från celler infekterade med en rekombinant murinLeukemivirus (MLV) härbärgerande E. coli supF-genen i dess LTR tjänade såsom källa för IN-aktivitet, och DNA: t av en mutant lambdafag defekta i lytisk tillväxt var exogent tillhandahålls som mål-DNA. Framgångsrik integration av rekombinant MLV DNA kopiera i fag DNA och den efterföljande supF uttryck ledde till återupprättande av plackbildande förmåga rekombinanta fager. Detta är dock experimentella strategi mödosam och integrationsåtgärder på ett indirekt sätt. För att ta itu sådana förbehåll ades en Southern blöt-baserad analys indirekt ändmärkning, som kvantifierar PIC-associerade IVI-aktivitet som ett mått på den endogena vDNA integreras i exogen linjäriserade bakteriofag PhiX174 DNA, utvecklade sex, 7, 18. Även om denna metod ger ett direkt mått på integrationshändelser är relativt höga halter av PIC preparatet krävs, som fortfarande är en tekniskt utmanandesträvan. För att kringgå detta har kapslade PCR-baserade analyser kräver endast blygsamma mängder av bilder utvecklats 4, 5, 19.

I denna rapport beskriver vi en uppdaterad version av en innesluten PCR-baserad in vitro-metod fram för att sammanfatta den HIV-1 PIC-medierad integration aktivitet som inträffar under naturlig infektion. Denna metod använder cytoplasmiska extrakt av HIV-1-infekterade målceller som en källa av endogen PIC aktivitet, som mäts med en realtids kvantitativ Polymerase Chain Reaction (qPCR). Förfaranden för att isolera PIC och mäta deras integrationsarbetet anpassas, med ändringar, från protokoll som offentliggjorts av Engelman laboratorium 20. I denna metod, är PIC-associerade integration aktivitet initieras genom att tillhandahålla en exogen linjärt mål-DNA 21, och DNA-produkter som härrör fråndenna integrationsreaktionen renas och används som utgångsmaterial för efterföljande PCR-baserad kvantifiering. I första omgången konventionell PCR är de virala-mål-DNA korsningar amplifieras genom användning av lämpliga primrar. I den andra omgången qPCR är LTR-specifika primers användas för att specifikt berika vDNA befolkningen från första omgången PCR-produkter. Se protokollenheten för en detaljerad beskrivning av denna metod.

In vitro-studier med retrovirala ansvariga har lett till betydande framsteg i vår förståelse av mekanismen för retroviral DNA-integration och i utvecklingen av in-hämmare. Baserat på den senaste tidens ökade fokus på kartläggning HIV-1 platser integrations bestämma roll av virala och värdfaktorer i HIV-1 integration, och utveckla nya antivirala läkemedel i kampen mot läkemedelsresistens, tänka vi ett ökat intresse och en utbredd användning av IVI-analyser , som den som beskrivs i denna rapport. Detta, i sin tur, kommer att leda tillframtida förbättringar i metoden och därmed diversifiera omfattningen av dess tillämpningar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Virusproduktion

OBS: För att generera höga titrar av infektiöst HIV-1, transfektera humana embryonala njur (HEK) cellinje 293T med en smittsam HIV-1 molekylär klon med hjälp av en aktiverad dendrimer-baserade transfektion reagens. Det har observerats att den kalciumfosfattransfektion metod ger jämförbara resultat.

  1. I en Biosäkerhetsnivå 2 (BSL2) lab, frö 3 x 10 6 293T celler per 10 cm skål i 8 ml Dulbeccos Modified Eagle Medium (DMEM) kompletterat med 10% fetalt bovint serum (FBS), penicillin och streptomycin. Odla cellerna i en inkubator inställd på 37 ° C och 5% CO 2 O / N.
  2. Nästa dag, för att transfektera celler i varje 10 cm skål, späd 8 pg av pNL4-3 plasmid-DNA (se Material tabell) till en slutlig volym av 300 mikroliter av DMEM utan serum och antibiotika. Tillsätt 80 mikroliter av transfektionsreagens, blanda väl genom pipettering, och inkubera vid RT i5-10 min för transfektion komplexbildning.
  3. Avlägsna mediet från skålarna genom aspiration och tillsätt 7 ml per skål av färskt DMEM innehållande serum och antibiotika.
  4. Tillsätt 1 ml av DMEM innehållande serum och antibiotika till transfektion komplexa, blanda genom pipettering, och lägga till denna blandning till cellerna. Snurra försiktigt skålen för att underlätta jämn fördelning av transfektion komplex.
  5. Omedelbart överföra celler till BSL3 lab, placera i en inkubator inställd på 37 ° C och 5% CO2, och odla cellerna under 48 timmar.
  6. Samla in virusinnehållande vävnadskultur supernatant med användning av en pipett och sedan överföra den till ett centrifugrör. Centrifugera vid 300 xg under 5 min för att pelletera cellerna och skräp, och sedan filtrera supernatanten genom ett 0,45 | im porstorlek sprutfilter.
  7. För att eliminera varje överföring plasmid-DNA i detta cellfria viruspreparat, behandla med DNas 1 (20 | ig / ml) vid 37 ° C under 1 h.
  8. Att kvantifieraHIV-1-titer, använd p24-specifik enzymkopplad immunosorbentanalys (ELISA), eftersom det är en snabb och lämpade metod för rutinmässig användning 22.
    OBS: Det bör noteras att den p24-ELISA mäter den fysiska titer (antal viruspartiklar). Alternativt kommer att mäta virusassocierade RT-aktiviteten (exogen RT-analys) eller virus smittsamhet (TZM-bl indikator-cellinje-baserade smitt analyser) ger exklusiv avläsning av infektiösa viruspartiklar.

2. Virus Infektion av Sup-T1-celler (BSL3 Lab)

  1. I en BSL2 lab, underhålla Sup-T1 celler mellan 1,0 x 10 6 och 2,0 x 10 6 celler / ml i Roswell Park Memorial Institute (RPMI) medium supplementerat med 10% värmeinaktiverat FBS, penicillin och streptomycin (delningsfaktorn för en : 2 varje 2-3 d). Sammanställa Sup-T1-celler från odlingskolvar, blanda väl genom pipettering, och bestämma den viabla celler med användning av en hemocytometer och trypanblåttexklusion staining metod.
    1. Förbered önskat antal portioner av 80 x 10 6 celler (per virusinfektion) i 50 ml koniska centrifugrör.
    2. Centrifugera cellerna i en swinging-bucket rötor vid 500 xg och 25 ° C under 5 min. Utan att avlägsna cellkulturmediet, överföra rören innehållande pelleterade cellerna till BSL3 labbet för vidare bearbetning. Försiktigt aspirera cellodlingsmediet från röret utan att störa cellpelleten.
  2. Tillsätta en lämplig mängd av DNas I-behandlat virus inokulum till cellerna i röret och blanda väl genom försiktig pipettering. För 80 x 10 6 celler, använder 30 ml av DNas I-behandlat virus (50 pg av p24-ekvivalenter virus).
    OBS: Isolering av funktionella ansvariga kräver infektera målceller med mycket höga multipliciteter av infektion (MOI).
  3. Fördela blandningen jämnt mellan två 6-brunnars vävnadskulturplattor (dvs. 12 x 2,5 ml-alikvoter; använd 2 plattor per infectJon).
  4. För spinoculation, placera odlingsplattor i plattbärare och centrifugera med hjälp av en svängande hink rotor vid 480 xg och 25 ° C under 2 timmar.
  5. Inkubera spinoculated cellerna vid 37 ° C och 5% CO2 under 5 h.

3. Skörd och lys av infekterade celler (BSL3 lab)

  1. Pool cellerna som motsvarar varje infektion från odlingsplattorna i ett 50 ml koniskt centrifugrör (~ 30 ml totalt).
  2. Skörda cellerna genom centrifugering vid 300 x g och 25 ° C under 10 min. Försiktigt aspirera supernatanten från röret (alternativt använda en pipett).
  3. För att avlägsna eventuella kvarvarande viruspartiklar, tvätta varje cellpellet genom att tillsätta 2 ml buffert K - / - (150 mM KCl, 20 mM HEPES, pH 7,6, 5 mM MgCl2) och centrifugering av provet vid 300 x g och 25 ° C under 10 min. Sedan, utan att störa pelleten, försiktigt bort supernatanten genom aspiration eller med hjälp av en pipett.
  4. Repeat steg 3,3.
  5. Försiktigt bort eventuellt kvarvarande buffert genom att använda en mikropipett. Resuspendera varje cellpelleten i 2 ml iskall lysbuffert K + / + (Buffert K - / - kompletterat med 0,025% digitonin, 1 mM DTT, 20 mikrogram / ml aprotinin), blanda innehållet genom försiktig pipettering och överför till en 2 ml mikrocentrifugrör.

4. Framställning av Cytoplasmatiska PIC (BSL3 lab)

  1. Vagga proverna på en roterande skakanordning vid RT under 10 min.
  2. Centrifugera proverna, med rotorn förkyld till 4 ° C, vid 1500 xg och 4 ° C under 4 min.
  3. Utan att störa pelleten, noggrant överföra supernatanten till ett nytt mikrocentrifugrör och centrifugera vid 16000 xg och 4 ° C under 1 min.
  4. Noggrant överföra supernatanten till ett nytt mikrocentrifugrör. Lägga RNas A (20 mg / ml) till en slutlig koncentration av 20 mikrogram / ml (2 mikroliter för 2 mL PIC) och inkubera innehållet vid RT i 30 min (ingen gungande). </ Li>
  5. Lägg sackaros (60% vikt / volym i buffert K - / -) till en slutlig koncentration av 7% och blanda väl genom försiktig pipettering. Förbered alikvoter (t.ex. 200 mikroliter) av bilder i mikrocentrifugrör, flash-frysa i flytande kväve, och lägg i en -80 ° C frys för långtidslagring.

5. In vitro Integration (IVI) Analyser Använda HIV-1 ansvariga

  1. Förbered mål-DNA som används i IVI-analysen genom att förstärka en 2,0 kb region från PhiX174 plasmid-DNA med PCR med hjälp av skräddarsydda primers, PhiX174-F och PhiX174-R.
    1. Montera PCR-blandningen enligt beskrivning i Tabell 1. Utföra PCR i en termocykelapparat med användning av de termiska cykelbetingelser som rekommenderas i tabell 2. Gel-rena PCR-produkten med användning av en gel-reningskit (efter tillverkarens rekommenderade protokoll), och lagra den renade mål-DNA som alikvoter vid -80 ° C fram till användning.
  2. Lägg 600 ng mål-DNA till 200 - & #181; L delmängd av ansvariga, blanda väl och inkubera vid 37 ° C under 45 minuter.
    Obs: IVI reaktioner utelämna mål-DNA eller inklusive en integrashämmare (t.ex. Raltegravir) rekommenderas kontrollreaktioner.
  3. Stoppa IVI reaktionen genom tillsats av SDS, EDTA och proteinas K till slutkoncentrationer av 0,5%, 8 mM och 0,5 mg / ml, respektive. Blanda reaktionsinnehållet noggrant och inkubera över natten vid 56 ° C.
  4. Nästa dag, rena den totala DNA från IVI reaktionen genom fenol / kloroform-extraktion och etanolutfällning. Utföra alla centrifugeringssteg vid 16.000 xg och RT.
  5. Tillsätt en lika stor volym fenol till avproteiniserad provet, blanda kraftigt genom att vortexa och centrifugera i 2 min. Försiktigt bort den övre vattenfasen och överföra det till ett nytt rör.
  6. Upprepa steg 5,5. Överför den övre vattenhaltiga fasen till ett färskt rör.
  7. Tillsätt en motsvarande volym av 1: 1 fenol: kloroform-blandning, blanda kraftigt genom att vortexa och centrifugera for 2 min. Överför den övre vattenhaltiga fasen till ett färskt rör.
  8. Tillsätt en lika stor volym kloroform, blanda kraftigt genom virvling, och centrifugera under 2 min. Överför den övre vattenhaltiga fasen till ett färskt rör.
  9. För att fälla ut DNA, tillsätt glykogen till en slutlig koncentration av 0,1 | ig / | il, 3 M natriumacetat till en slutlig koncentration av 0,3 M, och 2,5 volymer av 100% etanol (iskall). Vortex för att blanda, centrifugera kort att samla innehållet, och placera röret vid -80 ° CO / N.
  10. Nästa dag, centrifugera provet under 30 min vid 16000 xg och 4 ° C under 30 min. Försiktigt bort supernatanten utan att störa pelleten.
  11. Tillsätt 500 mikroliter av 80% etanol (iskall) till pelleten och centrifugera vid 16000 xg och 4 ° C under 10 min. Lufttorka DNA-pelleten vid RT och grundligt resuspendera i 50 mikroliter av nukleasfritt vatten. Lagra DNA-prover vid -20 ° C.

6. PCR-analyser för att kvantifiera PIC Aktivitet

  1. Utför första omgången konventionell PCR med användning av primers som riktar sig till virala LTR och PhiX174 DNA (LTR och PhiX174 primers, respektive) för att förstärka korsningar av den integrerade HIV-1-DNA.
    1. Montera första omgången PCR-blandning som beskrivs i tabell 3. Montera en huvudblandning av alla komponenter med undantag av templat-DNA, dispensera 45-l alikvoter i separata PCR-rör, och tillsätt 5 mikroliter av mall-DNA eller nukleasfritt vatten (kontroll).
    2. Utföra PCR i en termocykelapparat med användning av de termiska cykelbetingelser som rekommenderas i tabell 4.
  2. Utföra den andra Ligt qPCR med användning av primrar som flankerar ett kort region av det virala LTR (LTR-R och LTR-U-primrar) för att selektivt amplifiera de integrerade vDNA-sekvenser från den första-round PCR-produkter. För att bestämma de integrerade vDNA kopiera nummer, generera en standardkurva genom att använda 10x serieutspädningar av kända kopieantal (t.ex. 10 0 - 10 8) av HIV-1 molekylär klon.
    1. Montera den andra Ligt qPCR blandning som beskrivs i tabell 5. Montera en mästare blandning av alla komponenter utom mall-DNA, noggrant dosera 25 mikroliter alikvoter i lämpligt antal brunnar i en 96-håls PCR reaktionsplattan, och sedan lägga till 5 mikroliter av den orenade första omgången PCR-produkter eller nukleasfritt vatten (kontrollera). Utför alla qPCR reaktioner i tre exemplar.
    2. Ladda PCR plattan i realtids-PCR instrument och utföra qPCR med cykelförhållanden som rekommenderas i tabell 6.
    3. Analysera data med hjälp av en lämplig mjukvara.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Isolering av HIV-1 ansvariga

En schematisk bild av det protokoll som används för isolering av HIV-1 ansvariga från akut infekterade Sup-T1-celler visas i figur 1. Detta protokoll är härledd från de metoder som beskrivits av Engelman et al. 19, 20. HIV-1 ansvariga är nukleoprotein komplex som är monterade i infekterade celler och utgörs av omvänd transkriberade vDNA, virusproteiner och cellulära faktorer 19, 20. Den metod som beskrivs i denna rapport använder cytoplasmiska extrakt av HIV-1-infekterade celler som källa för PIC-associerad integration aktivitet.

In vitro aktivitet av HIV-1 PIC integration

figur 2. Denna metod använder en kapslad qPCR-baserade strategi för mätning av PIC-associerad IVI aktivitet, och förfarandena är anpassade, med ändringar, från protokoll som offentliggjorts av Engelman laboratorium 19, 20, 21. I denna metod, är PIC-associerade integration aktivitet initieras genom att tillhandahålla en heterolog linjärt mål-DNA 21, och DNA-produkter som härrör från denna integrationsreaktionen renas och användas som utgångsmaterial för efterföljande PCR-baserad kvantifiering. I första omgången konventionell PCR, de virus mål-DNA korsningar amplifieras med användning av lämpliga primers. I den andra omgången qPCR är LTR-specifika primers användas för att specifikt berika vDNA befolkningen från första omgången PCR-produkter. Se protokollet svsnitt för en detaljerad beskrivning av denna metod.

Representativa resultat från en IVI-analys utfördes med användning av HIV-1-PIC visas i figur 3. Sup-T1-celler (80 x 10 6 celler / infektion) till spinoculated med 30 ml DNas 1-behandlad HIV-1 (~ 50 ^ g av p24 ekvivalent) i frånvaro eller närvaro av 1 | iM HIV-1 IN inhibitor Raltegravir vid 480 xg och 25 ° C under 2 h. Celler var därefter odlades under 5 h vid 37 ° C och 5% CO2. Ansvariga isolerades såsom beskrivits i protokollet avsnitt. De IVI reaktioner utfördes, var och en använder 200 mikroliter av PIC och 600 ng av mål-DNA (ett 2 kb DNA-fragment som amplifierats från PhiX174 DNA genom PCR), vid 37 ° C under 45 min. Reaktionerna avproteiniserades genom proteinas K-behandling i närvaro av SDS och EDTA vid 56 ° CO / N. Reaktionsprodukterna extraherades två gånger med fenol, en gång med en fenol: kloroform (1: 1) -blandning, och en gångmed kloroform. Därefter DNA var etanolutfälldes i närvaro av saltet och den sam-fällnings glykogen, och DNA-pelleten tvättades en gång med 80% etanol. Det renade DNA: t återsuspenderades i 50 | il av nukleasfritt vatten. En kapslad qPCR strategi användes för att bestämma antalet vDNA integreras i PhiX174 DNA. I första omgången konventionell PCR, primers komplementära till sekvenser på PhiX174 mål-DNA och viralt LTR-regionen används för att förstärka de integrerade virus mål-DNA korsningar från 5 mikroliter av integration reaktions DNA-produkterna. I den andra omgången qPCR var LTR-spänner primers som används för att enbart förstärka HIV-specifika DNA-sekvenser från 5 mikroliter av de första runt amplikon produkter och från 10-faldiga serieutspädningar av kända kopieantal (10 8 -10 0) av HIV-1 molekylär klon (Standards).

Alla qPCR reaktioner utfördes i tre exemplar och data Were analyseras med hjälp av kommersiell programvara. De värden som härrör från de normer avsattes för att generera en standardkurva, från vilken de integrerade vDNA kopiera nummer interpolerades. Felstaplar representerar standardavvikelser. Såsom visas i fig 3, HIV-1-PIC robustly integrera den associerade vDNA in i mål-DNA (spår 5). Viktigt är att IVI effektivitet ansvariga minskades kraftigt i reaktioner kompletteras med IN hämmaren Raltegravir (Lane 6). Detta attribut starkt integrationsaktiviteten mättes i denna analys för att HIV-1 IN. Vidare är kontrollreaktioner innehållande cytoplasmiska lysat från ej infekterade celler (spår 1), ensamma PIC (spår 2), mål-DNA enbart (Lane 3), och buffert enbart (Lane 4) uppvisade inte någon integration aktivitet. Dessutom gjorde den kontroll som uteslutits Taq-polymeras i den första omgången PCR (spår 7) inte förstärka integrationsprodukter. Noterbart är data från PIC-ensam kontroll (Lane 2) indikerade att den kapslade qPCR strategi specifitiskt mäter den integrerade vDNA men inte PIC-associerade vDNA. Sammantaget visar dessa data mätning av PIC-associerad integration aktivitet.

Figur 1
Figur 1: Schematisk representation av protokollet för framställning av HIV-1 ansvariga. Klicka här för att se en större version av denna siffra.

Cytoplasmaextrakt innehåller bilder är isolerade från HIV-1-infekterade Sup-T1-celler. Dessa bilder används som källa integrations aktivitet i in vitro integrationstest på.

figur 2
Figur 2: Schematisk representation av in vitro m> Integration Analys av HIV-1 ansvariga. Klicka här för att se en större version av denna siffra.

Integrations analyser utfördes in vitro med användning av HIV-1 ansvariga och den heterologa mål-PhiX174 DNA. Den integrerade HIV-1-DNA mättes med en innesluten PCR-strategin, varvid den första omgången konventionell PCR amplifierar de integrations korsningar från vilken vDNA-specifika sekvenser är företrädesvis förstärks i en andra omgång qPCR.

Figur 3
Figur 3: HIV-1 PIC-associerad vDNA Integration aktivitet. Klicka här för att se en större version av denna siffra.

"Fo: keep-together.within-page =" 1 "> Representativa resultat av HIV-1 PIC-associerad integration aktivitetsanalys De integrerade vDNA kopiera nummer bestämdes genom att plotta värdena härledda från en standardkurva genereras med användning av 10x serieutspädningar av. kända kopietal av en HIV-1 molekylär klon. Alla reaktioner utfördes i tre exemplar och data analyserades med hjälp av kommersiell programvara. Felstaplar representerar standardavvikelser.

Komponent Stock Slutvolym för 50 mikroliter reaktion
PhiX174-plasmid-DNA 10 ng / mikroliter 5,0 | il
GoTaq reaktionsbuffert 5x 10,0 | il
dNTP nukleotidblandning 10 mM vardera 1,0 | il
PhiX174-F primer 10 ^ M 2,5 | il
PhiX174-R-primer 10 ^ M 2,5 | il
GoTaq DNA-polymeras (5 U / mikroliter) 0,25 mikroliter
Nukleasfritt destillerat vatten - 28.75 | il

Bord 1.

95 ° C = 2 min
Cykel 34 repetitioner av:
95 ° C = 30 s
53 ° C = 30 s
72 ° C = 2 min
72 ° C = 10 min
4 ° C = Hold

Tabell 2.

Komponent Stock Slutvolym för 50 mikroliter reaktion
IVI reaktions DNA-produkt - 5,0 | il
GoTaq reaktionsbuffert 5x 10,0 | il
dNTP nukleotidblandning 10 mM vardera 1,0 | il
LTR-primer 10 ^ M 2,5 | il
PhiX174 primer 10 ^ M 2,5 | il
GoTaq DNA-polymeras (5 U / mikroliter) 0,25 mikroliter
Nukleasfritt destillerat vatten - 28.75 | il

Tabell 3.

95 ° C = 5 min
Cykel 23 repetitioner av:
94 ° C = 30 s
55 ° C = 30 s
72 ° C = 4 min
72 ° C = 10 min
4 ° C = Hold

Tabell 4.

<td> Taqman Probe
Komponent Stock Slutvolym för 30 mikroliter reaktion
1 st runt PCR-produkter - 5,0 | il
LTR-R-primer 10 ^ M 0,9 | il
LTR-U-primer 10 ^ M 0,9 | il
10 ^ M 0,3 | il
iQ Supermix 2x 15,0 | il
Nukleasfritt destillerat vatten - 7,9 | il

Tabell 5.

95 ° C = 3 min
Cykel 39 repetitioner av:
94 ° C = 15 s
58 ° C = 30 s
72 ° C = 30 s
plattan Läs

Tabell 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Biokemiska analyser av retrovirala ansvariga har gett viktiga insikter i mekanismen för retroviral DNA-integration. Mätning av integrationen aktiviteten hos retrovirala PIC kan uppnås genom plackbildningsanalys, Southern blot-analys, och kapslade qPCR. Den experimentella taktik som plackanalysen är arbetskrävande och utnyttjar en indirekt metod för att mäta integration 6, 7, 18. Southern blot-baserade analyser åtgärd integration direkt utan kräver relativt höga mängder av PIC 6, 7, 18.

Denna rapport redovisar en kapslad qPCR strategi för mätning av HIV-1 PIC-associerad integration aktivitet in vitro. Den stora fördelen och betydelsen av denna metod är kravet av relativt låga mängder av PIC preparatet per reaktion 4, 5, 19. De mest kritiska stegen i denna metod är genereringen av en hög-titer-virus för infektion och hantering av PIC preparatet. Det bör noteras att den första omgången av PCR innebär exponentiell förstärkning av övergångarna integration. Följaktligen kopietal av integrerade vDNA bestäms i den andra omgången qPCR är halv kvantitativa och därmed har begränsningen att inte ge ett mått på PIC-associerad vDNA kopior. Emellertid kan PIC-associerade vDNA bestämmas genom qPCR av DNA renat från ansvariga med LTR-specifika primrar. Förhållandet mellan de integrerade vDNA kopiera nummer till motsvarande PIC-associerade vDNA kan ge information om integration effektiviteten av ett in vitro integrationsreaktion. Denna metod kan modifieras genom att inkorporera andra heterolog mål-DNA av val och andra primers för att upptäcka integration på båda riktningarna. I sammanfattning, den metod sombeskrivs här mäter integration aktiviteten hos HIV-1 ansvariga kvantitativt och kan antas för forskning utveckla en förståelse för de biokemiska detaljerna i retroviral integration.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar inga konkurrerande finansiella och icke-finansiella intressen.

Acknowledgments

Detta arbete är delvis finansierats med bidrag DA024558, DA30896, DA033892 och DA021471 från NIDA / NIH till CD. Vi erkänner också RCMI bidraget G12MD007586, Vanderbilt CTSA bevilja UL1RR024975, den Meharry Translational Research Center (MeTRC) CTSA bidrag U54 RR026140 från NCRR / NIH, den U54 bidrags MD007593 från NIMHD / NIH, och Tennessee CFAR bidraget P30 AI110527.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
mätning av<em&gt; In Vitro</em&gt; Integration Aktivitet av HIV-1 Preintegration Anläggningar
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter