Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Definieren von Substratspezifität für Lipase und Phospholipase-Kandidaten

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Mikroorganismen produzieren ein breites Spektrum von (phospho) Lipasen, die um sezerniert werden für den Organismus externe Substrate zur Verfügung zu stellen. Alternativ können andere (phospho) Lipasen physikalisch mit dem produzierenden Organismus verursacht einen Umsatz von intrinsischen Lipiden assoziiert sein können und häufig zu einem Remodeling der Zellmembranen führt. Obwohl Potential (phospho) Lipasen mit einer Anzahl von Algorithmen vorhergesagt werden, wenn das Gen / Protein-Sequenz verfügbar ist, experimentelle Nachweis der Enzymaktivitäten, Substratspezifitäten, und potentielle physiologische Funktionen ist häufig nicht erhalten werden. Dieses Manuskript beschreibt die Optimierung der Testbedingungen für Interessenten (phospho) Lipasen mit unbekannten Substratspezifität und wie diese optimierten Bedingungen bei der Suche nach dem natürlichen Substrat eines jeweiligen (phospho) Lipase zu verwenden. Mit künstlichen chromogene Substrate, wie p - Nitrophenyl - Derivate, kann dazu beitragen , eine kleinere zu erkennenenzymatische Aktivität für eine vorhergesagte (phospho) Lipase unter Standardbedingungen. Eine solche geringfügige enzymatische Aktivität angetroffen wird, können die unterschiedlichen Parameter einer Enzymassay, um einen effizienteren Hydrolyse des künstlichen Substrat zu erhalten, variiert werden. Nachdem die Bedingungen arbeitet ein Enzym gut unter denen sie festgestellt haben, sollte eine Vielzahl von potentiellen natürlichen Substrate für deren Abbau getestet werden, ein Prozess, der verschiedene chromatographische Methoden gefolgt Einsatz werden können. Die Definition von Substratspezifitäten für neue Enzyme, liefert oft Hypothesen für eine mögliche physiologische Rolle dieser Enzyme, die dann experimentell überprüft werden kann. Nach diesen Richtlinien, konnten wir eine Phospholipase C (SMc00171) , die Phosphatidylcholin, für den Umbau von Membranen in dem Bakterium Sinorhizobium meliloti auf phosphor limitierenden Bedingungen des Wachstums in einem entscheidenden Schritt phosphocholin und Diacylglycerin verschlechtert zu identifizieren. Für zwei vorhergesagten patatin-wie Phospholipasen (SMc00930 und SMc01003) des gleichen Organismus, könnten wir ihre Substratspezifität neu zu definieren und zu klären, dass SMc01003 ein Diacylglycerol Lipase ist.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Glycerol-basierten Lipiden wie Triglyceriden und (glycero) Phospholipide sind wichtige und wohl die bekanntesten Lipidklassen 1. Triacylglycerolen (TAGs) sind Fette oder Öle, die üblicherweise als Speicherlipiden funktionieren und daher als potentielle Energie und Kohlenstoffquellen. TAGs können durch Lipasen abgebaut werden, die häufig durch den produzierenden Organismus ausgeschieden werden externe TAGs zu verdauen und sie als Kohlenstoffquellen zur Verfügung zu stellen. Auch wurden Lipasen weit über die Jahre studiert aufgrund ihrer wichtigen biotechnologischen Anwendungen 2.

Auf Grund ihrer amphiphilen Natur und ihrer nahezu zylindrischen Form, (glycero) Phospholipide weisen membranbildenden Eigenschaften und in der Regel die Hauptlipidkomponenten einer doppelschichtigen Membran 3 bilden. In einfachen Mikroorganismen wie dem Bakterium Escherichia coli, nur drei Hauptkopfgruppe Varianten, Phosphatidylglycerin (PG), Cardiolipin (CL) und phosphatidylethanolamine (PE) angetroffen werden , obwohl man sich bewusst sein sollte , dass jeder von ihnen kann 4 mit einer beträchtlichen Anzahl unterschiedlicher Fettacylketten an der sn - 1 oder sn - 2 - Position, die zu einer großen Anzahl von verschiedenen molekularen Spezies ersetzt werden . Andere Bakterien könnten haben andere Phospholipide zusätzlich oder statt. Zum Beispiel Sinorhizobium meliloti, ein Bodenbakterium, das mit der Leguminosen Luzerne (Medicago sativa) , um eine Stickstoff-fixierenden Knöllchen Symbiose zu bilden, enthält zusätzlich zu PE ein zweites zwitterionisches Phospholipid, Phosphatidylcholin (PC) 5 in der Lage ist. Auch Lipide nicht, die Phosphor oder Glycerin können amphiphile und bilden einen Teil der Zellmembran sein. Beispielsweise von Phosphor beschränkende Wachstumsbedingungen in S. meliloti, (glycero) Phospholipide sind weitgehend durch Membranlipide ersetzt , die nicht Phosphor enthalten, dh Sulfolipide, Ornithin Lipide und diacylglyceryl trimethylhomoserine (DGTS) 6. In Bakterien ist DGTS von Diacylglycerin (DAG) in einem zweistufigen Weg gebildet 7 , aber die Quelle für DAG Generation war nicht klar. Pulse-Chase - Experimente vorgeschlagen , dass PC ein Vorläufer für 8 DGTS sein könnte und mit Hilfe der Methodik in diesem Manuskript beschrieben wir eine Phospholipase C identifizieren konnte (PLCP, SMc00171) , die unter Phosphor einschränkenden Bedingungen gebildet wird , und die PC in DAG umwandeln und Phosphocholin 8.

In einer separaten Studie entdeckten wir , dass eine Acyl-CoA - Synthetase (FADD) defizienten Mutante von S. meliloti oder von Escherichia coli freien Fettsäuren akkumuliert , wenn 9 stationären Wachstumsphase eintritt. Obwohl diese Fettsäuren schienen von Membranlipiden abgeleitet werden, die genaue Quelle für die freien Fettsäuren oder die Enzym (e) zu befreien, sie waren nicht bekannt. Auch in diesem Manuskript die Strategie skizziert den Einsatz, zwei Patatin-like 10 (phospho) Lipasen (SMc00930 und SMc01003), die zur Bildung von freien Fettsäuren in S. beigetragen meliloti 11 vorhergesagt wurden. Überraschenderweise verwendet SMc01003 DAG als Substrat Umwandlung in Monoacylglycerin und schließlich 11 Glycerin und freien Fettsäuren. Daher ist SMc01003 eine DAG-Lipase (DGLA).

Obwohl eine Reihe von Algorithmen zur Vorhersage Potential (phospho) sind Lipasen 12,13, deren genaue Funktion und physiologische Rolle ist in der Regel nicht bekannt. Hier beschreiben wir ein Protokoll, zu klonen und überexprimiert vorhergesagt oder Potential (phospho) Lipasen. Diese Handschrift wird erläutert, wie Enzymassays können unter Verwendung von künstlichen chromogene Substrate für die überexprimiert (phospho) Lipase entwickelt und optimiert werden. Wir liefern Beispiele, wie mit einem optimierten Enzymtest die reale (phospho) Lipasesubstrats begegnet werden kann und wie diese Erkenntnisse könnten unser Verständnis der mikrobiellen Physiologie bereichern.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Klon und überexprimiert Strukturgens für Prognostizierte Lipase

  1. Unter Verwendung der Polymerasekettenreaktion (PCR) 14 und spezifischen Oligonukleotiden (Tabelle 1) 15, zu amplifizieren , die das Gen von Interesse (smc01003, smc00930 oder smc00171), vorhergesagt für eine Lipase kodieren oder Phospholipase, aus der genomischen DNA des Wirtsorganismus (dh , S. meliloti).
    1. Einführung spezifischer Restriktionsstellen (mit der entworfenen Sequenz der Oligonukleotide). Digest des amplifizierten DNA - Fragments mit den entsprechenden Restriktionsenzymen und klonieren es in einen Expressionsvektor , wie beispielsweise Plasmide der pET - Serie 16.
    2. Die korrekte DNA - Sequenz für das geklonte Gen, Transformieren des Vektors in eine Expressionsstamm, wie Escherichia coli BL21 (DE3) pLysS 16 , nachdem geprüft.
  2. Bereiten Sie eine Nacht vor der Kultur des Expressionswirt E. coli BL21 (DE3) pLyss, Beherbergung des jeweiligen pET - Vektor mit dem geklonten Gen oder dem leeren Vektor, in 100 ml Kulturflaschen , die 20 ml Luria Bertani - Brühe (LB) 17 sowie den erforderlichen Antibiotika. Kultur die Zellen bei 30 ° C (oder im üblichen Wachstumstemperatur des Bakteriums , von dem die Lipase stammt).
    1. Mit den über Nacht Vorkulturen, impfen 500 ml vorgewärmtem LB - Medium (plus die erforderlichen Antibiotika) in 2 l Kulturflaschen eine anfängliche optische Dichte bei 620 nm (OD 620) = 0,05 zu erhalten. Folgen Wachstum der Kulturen und bei einer OD 620 = 0,3, fügen Isopropyl-β-D-thiogalactosid (IPTG) bis zu einer Endkonzentration von 100 uM, und Inkubieren unter Rühren bei 30 ° C für einen Zeitraum von 4 Stunden.
    2. Am Ende der Inkubationsperiode übertragen jeder Kultur in einen 500 - ml - Zentrifugenröhrchen und zentrifugiere bei 5.000 × g bei 4 ° C für 30 min. Resuspendieren Bakterienzellpellets in 5 ml Suspensionspuffer (zB SMc00930- und SMc01003-exprimierenden Zellen in 50 mM Tris-HCl pH 8,0 und SMc00171-exprimierenden Zellen in 50 mM Diethanolamin-HCl pH 9,8). Speichern der Zellsuspensionen bei -80 ° C bis zur Verwendung.

2. Bereiten Sie die zellfreie Proteinextrakte und Protein-Konzentration bestimmen

  1. Tauen Bakterienzellsuspensionen und lagern auf dem Eis. Passieren Zellsuspensionen dreimal durch eine Kaltdruckzelle bei 20.000 lb pro in 2. Entfernen intakten Zellen und Zelltrümmer durch Zentrifugation bei 5.000 xg für 30 min bei 4 ° C.
  2. Nach Zentrifugation herzustellen Aliquots von 100 und 500 & mgr; l aus dem Überstand für eine nachfolgende Analyse und speichert sie bei -80 ° C bis zur Verwendung.
  3. Verwenden Sie eines der 100 ul aliquoten Proteinkonzentration von verschiedenen zellfreien Extrakten durch ein Verfahren der Wahl , um zu bestimmen oder als 18 beschrieben.

3. Verwenden Sie künstliche Substrate für Optimizing EnzymAktivitäten von (Phospho) Lipasen

  1. Für eine erste Abdeckung der unterschiedlichen Enzymaktivitäten verwenden künstliche Substrate , die ein gefärbtes Produkt bei der Hydrolyse ergeben, wie beispielsweise p - Nitrophenol (p -NP).
    1. Für Enzymassays optimiert bereits mit Kunst p - Nitrophenylester Substrate (umrissenen für Phospholipase C PLCP (SMc00171) sowie für den vorhergesagten Patatin-like Phospholipasen SMc00930 und SMc01003) beschriebenen Verwendung Pipettieren Schemata in Tabelle 2.
    2. Wenn ein neues Potential (phospho) Lipase erforschen, mit einem ersten Standard - Enzym - Assay , das 50 mM Tris-HCl, 8,5, 100 mM NaCl, 0,05% Triton X-100, 0,5 mM p - Nitrophenyl-enthaltende Verbindung (p - Nitrophenylphosphat pH vorzubereiten , Bis p - Nitrophenylphosphat, p - Nitrophenyl- decanoate oder p - Nitrophenyl Palmitat) und zellfreie Proteinextrakt (Check 1, 3, 10, 30, 100, 300 und 1000 ug) in einem Gesamtvolumen von 1 ml in 1 ml Kunststoff cuvettes.
      HINWEIS: Die Verwendung alkalischen pH (Abbildung 1) , wenn folgende p - Nitrophenylester Hydrolyse in einem kontinuierlichen Assay. Alternativ können Sie auch einzelne Zeitpunkt - Assays für einen Bereich von pH - Werten, Zugabe von NaOH am Ende der Inkubationszeit die Enzymreaktion zu beenden und sicherzustellen , dass alle p -NP in der Phenolat Form vorliegt.
    3. Folgen den Zeitverlauf für eine Zunahme der Absorption bei 405 nm aufgrund der Bildung von p -NP, in einem Spektrophotometer bei 30 ° C über einen Zeitraum von 5 min. Quantifizierung der anfänglich linearen Bildung von p -NP durch die anfängliche Steigung der Zunahme der Extinktion pro Zeit bestimmen.
    4. Berechnen Sie die Änderung der Konzentration (& Delta; c) für p -NP mit dem Gesetz von Lambert-Beer (& Delta; A = ε & Delta; c d) 1.
      HINWEIS: & Dgr; A ist die lineare Änderung der Extinktion bestimmt, ε der molare Extinktionskoeffizient bei der jeweiligen Wellenlänge (in Einheiten von M -1 -1) ist , d die Länge des Lichtweges (1 cm), und & Dgr; c ist die Änderung der Konzentration (in Einheiten von M) bestimmt werden.
      1. Bedenkt man, dass die Assay - Volumen von 1 ml ist, berechnen die Menge an p -NP gebildet.
        HINWEIS: Betrag = Konzentration x Volumen.
      2. Berechnung der Enzymaktivität durch die Menge an p -NP durch die Zeit gebildet Aufteilen in dem es gebildet wird. Bestimmung der spezifischen Enzymaktivität von Enzymaktivität durch die Menge an Protein Dividieren (in mg), die zur Erzeugung von diese Aktivität verantwortlich war.
    5. Vergleichen Absorptionsänderungen hervorgerufen durch Proteinextrakte , in denen ein Kandidat - Gen (smc00171, smc00930 oder smc01003) hatte mit Extrakten zum Ausdruck gebracht , die nur einen leeren Vektor enthalten .
      ANMERKUNG: Um mit den folgenden Schritten fortzufahren, die spezifischen Aktivitäten, die durch Proteinextrakte in dem ein Kandidatengen exprimiert worden waren, mindestens zweimal oder m seinErz als die Werte für die spezifischen Aktivitäten, die durch Proteinextrakte gewonnen, die nur einen leeren Vektor enthalten.
    6. Für weitere Experimente, wählen jene Bedingungen , unter denen die Hydrolyse des p - Nitrophenyl-enthaltende Verbindung ist minimal mit zellfreien Extrakten (dh Leervektor) und für die der stärksten Bildung von p -NP und der p -nitrophenolate Anion (Fig 1) beobachtet werden kann , wenn die Proteinextrakte verwendet werden, in denen ein Kandidat - Gen exprimiert worden war.
  2. die anfängliche Enzymaktivität in 3.1, Optimierung der Testbedingungen für das jeweilige Enzym nach der Bestimmung von pH, Puffertyp variierenden Pufferstärke, Konzentrationen von NaCl, Detergenzien, wie Triton X-100, und die Abwesenheit oder Anwesenheit von verschiedenen zweiwertigen Kationen.
    1. Für unterschiedliche Konzentrationen der einzelnen Variablen, die spezifische Enzymaktivität bestimmen (siehe 3.1.4.2) (die höchste Zahl erhalten definiert die Bedingungder maximale Enzymaktivität). Verwenden Sie die Kombination der optimalen Bedingungen für jede Variable angetroffen ein optimiertes Enzymtest zu definieren, in der jede Variable in seiner optimalen Konzentration vorhanden ist.

Abbildung 1
Abbildung 1 p - Nitrophenyl Ester als künstliche Substrate für (phospho) Lipasen in einem spektrophotometrischen Assay. Bei der Hydrolyse von p - Nitrophenyl Ester, eine Säure (R-OH) und p - Nitrophenol (p -NP) gebildet werden . Aufgrund der pK a = 7,2 für die Dissoziation des + phenolischen H aus p -NP, bei einem pH - Wert> 9,2 mehr als 99% in der hellen Form gelb p -nitrophenolate sind und einem molaren Extinktionskoeffizienten von 18.000 M -1 cm - 1 kann bei einer Wellenlänge verwendet werden von 405 nm für die Quantifizierung von freiem p -nitrophenolate 22. Wenn Puffer mit einem pH - Wert von 8,5 verwendet wurden, wurde die Absorption bei 400 nm und einem molaren Extinktionskoeffizienten von 14.500 M -1 cm -1 bestimmt wurde 23 verwendet. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

HINWEIS: Nachdem die optimalen Bedingungen für die Aktivität des Enzyms von Interesse definiert zu haben, begeben sich auf die Suche nach dem real / physiologischen Substrat dieser Lipase. Grundsätzlich nehmen zwei, oft komplementäre Ansätze , dieses Ziel zu erreichen, eine in vivo - Ansatz oder ein in vitro - Ansatz.

4. In vivo Identifizierung des physiologisches Substrat einer Lipase

ove_content "> . ANMERKUNG: In einem In - vivo - Ansatz, die Lipase von Interesse in einem Wirtsorganismus 8,11 um auszudrücken über die Zeit zu registrieren , ob die Expression der Lipase das Profil host's Lipid verändert In einem anderen in vivo Ansatz, erzeugen ein mutanten - defizienten des Gens von Interesse 8,11 und untersuchen , ob seine Lipidprofil von der Wildtyp - Version 6,8,11 unterscheidet. um eine quantitative Beurteilung eines Organismus Lipidprofil, eine einfache Methode besteht darin , die radioaktive Markierung von zellulären Verbindungen zu erhalten , Extrahieren der Lipide, sie durch Chromatographie und die Quantifizierung der radioaktiv markierten Lipiden getrennt trennt.

  1. Die radioaktive Markierung von Lipiden.
    1. Bereiten Sie eine Nacht Vorkultur eines Organismus von Interesse (E. coli oder S. meliloti) in 5 ml des gewünschten Kulturmedium (komplexes Medium oder definierte Minimalmedium) und wachsen bei 30 ° C.
    2. Von der Vorkultur impfen in 20 ml des same frisches Medium in einer 100 ml Kulturflasche eine anfängliche OD 620 = 0,3 für die Kultur zu erhalten.
    3. Einen aliquoten (1 ml) der Kultur unter sterilen Bedingungen und in ein 14 ml sterilen Polystyrol-Rundbodenrohr.
    4. 1 & mgr; Ci von [1- 14 C] Acetat (60 mCi pro mmol) zu der 1 ml Kultur.
    5. Inkubieren der flüssigen Kultur unter Rühren bei 30 ° C für einen Zeitraum von 24 Stunden.
    6. Am Ende der Inkubationsperiode Übertragung der Kultur in ein 1,5 ml Mikrozentrifugenröhrchen und zentrifugiere bei 12.000 xg bei Raumtemperatur für 5 min.
    7. Resuspendieren des Pellets in 100 ul Wasser. An diesem Punkt, speichern Sie die Zellsuspension bei -20 ° C oder unmittelbar mit der Gewinnung von polaren Lipiden (Abschnitt 4.2) fortzusetzen.
  2. Die Extraktion von polaren Lipiden.
    HINWEIS: Die Methode , die hier im Wesentlichen beschrieben folgt dem Verfahren berichtet von Bligh und Dyer 19.
    1. Zu den 100 ul wässriger Zelle suspension, fügen 375 ul Methanol: Chloroform-Lösung (2: 1; vol / vol).
    2. Vortex für 30 Sekunden und 5 Minuten bei Raumtemperatur inkubiert.
    3. Zentrifuge 5 min bei 12.000 xg bei Raumtemperatur.
    4. Den Überstand in ein neues 1,5 ml Mikrozentrifugenröhrchen.
    5. In 125 ul Chloroform und 125 ul Wasser, Wirbel 30 sec.
    6. Zentrifuge 1 min bei 12000 xg bei Raumtemperatur.
    7. Übertragen Sie die untere Chloroform-Phase in ein frisches Röhrchen und trocken mit einem Strom von Stickstoffgas.
    8. Auflösen getrockneten Lipide in 100 ul Chloroform: Methanol-Lösung (1: 1; vol / vol).
      HINWEIS: Zu diesem Zeitpunkt wurde ein Aliquot von 5 & mgr; l der Lipidlösung kann durch Flüssigscintillationszählung quantifiziert werden.
    9. Für dünnschichtchromatographischen (TLC) Analyse, trocknen unten die restlichen 95 & mgr; l mit einem Strom von Stickstoffgas abgeblasen, getrockneten Lipide in 20 ul Chloroform: Methanol-Lösung (1: 1; v / v). Verwenden Sie ein 3-ul-Aliquotfür DC-Analyse.
  3. Trennung von polaren Lipiden durch Dünnschichtchromatographie (TLC).
    HINWEIS: Klassen auf den Lipid Je analysiert werden, verschiedene Kombinationen von festen und mobilen Phasen kann für die Trennung eingesetzt werden. Hier ist eine typische Trennung für geladene polare Lipide und andere, geeignet für neutrale polare Lipide, unter Verwendung von Hochleistungs-Dünnschicht-Chromatographie (HPTLC) Kieselgel Aluminiumbleche als feste Phase, skizziert.
    1. Trennung von geladenen polaren Lipiden durch zweidimensionale Dünnschichtchromatographie (2D-TLC).
      1. Eine 3 & mgr; l Aliquot von Lipidprobe in einer Ecke eines HPTLC Kieselgel Aluminiumblech (10 x 10 cm), 2 cm vom Rand der Platte.
      2. Bereiten Sie und mischen Sie die mobile Phase (140 ml Chloroform, 60 ml Methanol und 10 ml Wasser) für die Trennung in der ersten Dimension.
      3. Mantel eine TLC Entwicklungskammer intern mit Chromatographie-Papier.
        Hinweis: Dies ist, um sicherzustellen, dass die Gasphase der Kammer(Innerhalb von 30 min) wird schnell gesättigt werden, nachdem die mobile Phase für die erste Dimension wurde in die Kammer gegeben, und die Kammer wurde mit einer Glasplatte verschlossen.
      4. Bereiten Sie und mischen Sie die mobile Phase (130 ml Chloroform, 50 ml Methanol und 20 ml Eisessig) für die Trennung in der zweiten Dimension und die Übertragung auf eine zweite TLC Entwicklungskammer intern mit Chromatographie Papier aufgetragen und die Kammer sättigen lassen.
      5. Übertragen sorgfältig die HPTLC Kieselgel Aluminiumblech mit dem getrockneten Lipidprobe in die erste Kammer und zu entwickeln , um die Platte für 60 min in der geschlossenen Kammer in der ersten Dimension 5 (dh Chromatographie durchzuführen).
      6. Entfernen Sie die Platte aus der Kammer und lassen Lösungsmittel für 30 Minuten in einem Flow-Haube trocknen.
      7. Nach dem Drehen auf dem die Platte um 90 Grad in Bezug auf die vorherigen Chromatographie, übertragen die HPTLC Kieselgel Aluminiumblech wurden die Lipide in einer Dimension getrennt wurden, zum SECONd Kammer und entwickeln , um die Platte für 60 Minuten in der zweiten Dimension 5.
      8. Entfernen Sie das Blatt aus der Kammer und lassen die Lösungsmittel für mindestens 2 Stunden in einem Flow-Haube trocknen.
    2. Die Trennung von neutralen polaren Lipiden.
      1. Anwenden 3 ul Aliquots von Lipidproben auf einer HPTLC Kieselgel Aluminiumblech beginnend 2 cm von den Rändern der Platte. Wenn mehrere Proben in einem eindimensionalen Chromatographie analysiert werden, halten Sie einen Abstand von mindestens 1,5 cm zwischen den verschiedenen Beispielanwendung Flecken.
      2. Bereiten Sie und mischen Sie die mobile Phase (140 ml Hexan, 60 ml Diethylether, und 8 ml Essigsäure) aufnehmen und in einem TLC Entwicklungskammer intern beschichtet mit Chromatographiepapiers und bedeckt mit einer Glasplatte in die Kammer sättigen zu lassen (30 min).
      3. Übertragung der HPTLC Kieselgel Aluminiumblech mit den getrockneten Lipidproben in die Kammer und zu entwickeln, um die Platte für 30 min in der geschlossenen Kammer.
      4. Entfernen Sie die Platte aus der Kammerund lassen Sie die Lösungsmittel für 2 Stunden in einem Flow-Haube trocknen.
  4. Die Quantifizierung und Visualisierung von getrennten polaren Lipiden.
    1. Sobald die entwickelte DC-Blatt trocken ist, brüten sie mit einem photostimulierbaren Lumineszenz (PSL) auf dem Bildschirm in einer geschlossenen Kassette für 3 Tage.
    2. Setzen Sie die inkubiert Bildschirm zu einem PSL-Scanner und erwerben ein virtuelles Bild der getrennten radiomarkierten Lipiden.
    3. Führen Sie die Quantifizierung mit PSL - Software 20.
  5. Visualisierung und Isolierung einzelner polaren Lipide Klassen.
    1. Inkubieren entwickelten TLC Blatt für 10 min in einer Chromatographiesäule Kammer in Gegenwart von 1 g Jodkristalle.
      HINWEIS: Getrennt lipidischen Verbindungen wird das Jod und erscheinen als bräunliche Flecken aufzulösen.
    2. Kreisen Sie die Flecken mit einem Bleistift, vergleichen sie mit der relativen Mobilität (R f) von Standard - Verbindungen (dh 1,2-Dipalmitoyl- sn - glycerin, Dipalmitoyl-L-α-phosphatidylcholine, DL-α-Monopalmitin oder Palmitinsäure) und identifizieren, zu der Lipidklasse sie angehören könnten.
    3. In einem Abzug ließ das Jod aus dem DC-Blatt verdunsten.
    4. Mit Hilfe eines Spachtels, kratzen die Kieselgel die Verbindung von Interesse aus der Folie enthält, und extrahieren Sie die Verbindung aus dem Kieselgel mit einem Gemisch aus 100 ul Wasser und 375 ul Methanol: Chloroform-Lösung (2: 1; vol / vol).
    5. Fahren Sie mit der Extraktion nach Bligh und Dyer wie skizziert (4.2.2 ff).
    6. Store gereinigt Lipidklasse in 100 ul Chloroform: Methanol - Lösung (1: 1; vol / vol) bei -20 ° C bis zur Verwendung.

5. In - vitro - Identifizierung des physiologisches Substrat einer Lipase

HINWEIS: In einem in vitro - Ansatz untersuchen , ob die Lipase von Interesse eine Mischung aus isolierten Lipide oder einzelne reine Lipide in die entsprechende hydrol umwandeln kannlyse Produkte unter den als optimal definierten Bedingungen in 3.2.

  1. Verwenden Sie Pipettieren Schemata für Enzymtests gemäß Tabelle 3 für PC-spezifischer Phospholipase C SMc00171 (siehe 5.2), Phospholipase A (siehe 5.3) und DAG - Lipase SMc01003 (siehe 5.4) Aktivität.
  2. Bestimmung von PC-spezifischen Phospholipase - C - Aktivität (Tabelle 3).
    1. In ein 1,5 ml Mikrozentrifugenröhrchen, fügen 5.000 Zählimpulsen pro Minute (cpm) von insgesamt 14 C-markiertem PC und eine Lösung von Triton X-100.
    2. Mischen Sie und trocken unter einem Stickstoffstrom.
    3. Hinzufügen Diethanolamin-HCl, pH 9,8 Puffer, sowie NaCl und MnCl 2 Lösungen und bidestilliertem Wasser auf ein Endvolumen von 99,5 & mgr; l zu erhalten. Vortex für 5 Sekunden.
    4. Mit 0,5 & mgr; l Enzym (5 ug Protein) (dh einen zellfreien Extrakt , bei dem überexprimiert SMc00171 vorhanden ist) , um die Reaktion zu starten. Mischen Sie kurz.
    5. Inkubieren bei 30 ° C für 4 Stunden.
    6. Die Reaktion durch dieZugabe von 250 ul Methanol und 125 ul Chloroform.
    7. Extrahieren Lipide wie zuvor beschrieben (siehe 4.2).
    8. Separate Lipide durch eindimensionale (1D) -TLC (siehe 4.3.2 und 4.4), und analysieren sie durch PSL-Bildgebung.
  3. Bestimmung der Phospholipase A - Aktivität (Tabelle 3).
    1. Zu einem 1,5 ml Mikrozentrifugenröhrchen, fügen Sie 5000 cpm von insgesamt 14 C-markierte Phospholipide und eine Lösung von Triton X-100.
    2. Mischen Sie und trocken unter einem Stickstoffstrom.
    3. Für eine endgültige 100 & mgr; l Assay, fügen Tris-HCl, pH 8,5 Puffer, NaCl-Lösung und Wasser. Vortex für 5 Sekunden.
    4. Zugabe von 5 & mgr; l Enzym (50 ug Protein) (dh einen zellfreien Extrakt , bei dem überexprimiert SMc00930 oder SMc01003 vorhanden ist).
    5. Inkubieren bei 30 ° C für 5 Stunden.
    6. Beenden Sie die Reaktion durch Zugabe von 250 ul Methanol und 125 ul Chloroform.
    7. Extrahieren Sie Lipide, wie zuvor beschrieben (siehe 4.2), separatessie von 1D-TLC unter Verwendung von 130 ml Chloroform, 50 ml Methanol und 20 ml Eisessig als mobile Phase, und analysieren sie durch PSL-Bildgebung.
  4. Bestimmung von Diacylglycerin (DAG) Lipase-Aktivität.
    1. Herstellung von 14 C-markiertem DAG.
      1. Radioaktive Markierung S. meliloti Kulturen (siehe 4.1) und extrahieren polare Lipide (siehe 4.2) , wie beschrieben. Separate S. meliloti Gesamtlipidextrakte von 1D-TLC in Chloroform: Methanol: Essigsäure (130: 50: 20; vol / vol) Bedingungen für die Trennung in 4.3.1 in der zweiten Dimension beschrieben ist .
      2. Visualisieren PC durch Jod-Färbung und mit einem Bleistift die Lokalisierung von Phosphatidylcholin (PC) zu markieren.
      3. Isolieren radiomarkierten PC wie in 4.5 beschrieben.
      4. Quantifizieren extrahierter PC durch Szintillationszählung.
        HINWEIS: Über 320.000 cpm PC wird erwartet.
      5. Behandlung von PC (250.000 cpm) mit 0,1 U von Phospholipase C aus Clostridium perfringens in 50 mM Tris-HCl, pH 7,2, 0,5% Triton X-100 und 10 mM CaCl 2 für 2 Stunden in einem Gesamtvolumen von 100 ul und die Reaktion durch Zugabe von 250 ul Methanol und 125 ul Chloroform stoppen.
      6. Extrahieren Lipide wie zuvor und getrennt von ihnen durch 1D-TLC beschrieben (siehe 4.3.2).
      7. Isolieren Diacylglycerin von der Kieselgelplatte und quantifizieren durch Szintillationszählung (wie in 4.2 beschrieben)
    2. Diacylglycerin - Lipase - Assay (Tabelle 3).
      1. In ein 1,5 ml Mikrozentrifugenröhrchen, fügen 5000 cpm von 14 C-markiertem DAG und eine Lösung von Triton X-100.
      2. Mischen Sie und trocken unter einem Stickstoffstrom.
      3. Für eine endgültige 100 ul Assay, fügen Tris-HCl (pH 9,0) Puffer, eine NaCl-Lösung und bidestilliertes Wasser. Vortex für 5 Sekunden.
      4. Initiieren der Reaktion durch Zugabe von 5 & mgr; l Enzym (50 & mgr; g Protein von zellfreier Extrakt).
      5. Inkubieren bei 30 ° C für 4 Stunden.
      6. Stoppen Sie die Reaktion durch die Zugabe von 250 ul Methanol eind 125 ul Chloroform und Extrakt Lipide wie zuvor beschrieben (siehe 4.2).
      7. Analysieren neutrale polare Lipide von 1D-TLC (siehe 4.1.3.2) und anschließender PSL-Bildgebung.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aktivität von PC-spezifische Phospholipase C SMc00171 mit Bis- p - Nitrophenylphosphat

Zellfreie Extrakte von E. erhalten coli BL21 (DE3) pLysS x, die smc00171 hatte ausgedrückt, wurden auf ihre Fähigkeit untersucht bis- p - Nitrophenylphosphat Ester zu hydrolysieren, eine spektrophotometrische enzymatischen Assay unter Verwendung Messung des p -NP gebildet. Keine hydrolytische Aktivität war in zellfreien Extrakten aus E. erhalten coli BL21 (DE3) pLysS x einen leeren pET9a Vektor (Daten nicht gezeigt) beherbergen , wenn p - Nitrophenylphosphat Bis- wurde als Substrat verwendet.

Zeitverläufe für die p -NP gebildet zeigen an, dass es eine starke Abhängigkeit ist pLysS auf die Menge des zellfreien Extrakts (aus E. coli BL21 (DE3) x, der sm hattenc00171 ausgedrückt) hinzugefügt , um den Assay (2A). Wenn die Menge des Produkts p -NP gebildet würde nur von der Enzymkonzentration abhängig sind , eine lineare Korrelation zwischen Enzym (Protein) Konzentration eingesetzt und nach einer bestimmten Zeit gebildete Produkt zu beachten. Natürlich ist dies nicht der Fall für die zellfreie Extrakte aus E. erhalten coli BL21 (DE3) x pLysS, die smc00171 geäußert hatte (2B). Obwohl es kann mehrere Gründe für eine exponentielle Abhängigkeit der Enzymaktivität auf die Proteinkonzentration 21, ein häufiger Grund ist , dass andere Komponenten in dem Extrakt bei Verdünnung eines enzymhaltigen Proteinextrakt, der für die Enzymaktivität beschränkend kann, dh potentielle Kofaktoren werden auch verdünnt. In solchen Fällen sind unerwartet geringe Enzymaktivitäten mit verdünnter zellfreien Extrakten registriert. Durch die Einbeziehung einer sättigenden Konzentration von 3 mM MnCl 2 in dem Enzym - Assay wird die p -NP Gebildete Produkt nach einer bestimmten Zeit nur von der Menge an Enzym hinzugefügt (Daten nicht gezeigt) , das anzeigt , dass MnCl 2 ein Begrenzungskomponente für SMc00171 Aktivität in zellfreien Extrakten aus E. war coli.

Figur 2
Abbildung 2. Bestimmung der SMc00171 (Phospholipase) Aktivität unter Verwendung des künstlichen Substrat bis- p - Nitrophenylphosphat. Der Zeitverlauf für p -NP Bildung wird gezeigt , unter Verwendung von zellfreien Proteine Extrakte (● 10 ug / ml, ■ 15 ug / ml, ▲ 20 ug / ml) in dem SMc00171 (A ausgedrückt wurde). p -NP nach 40 min Inkubation Extrakte mit unterschiedlichen Mengen an zellfreien Proteinen gebildet , in dem SMc00171 exprimiert worden war (B). Die Fehlerbalken zeigen die Standardabweichung..jove.com / files / ftp_upload / 54613 / 54613fig2large.jpg "target =" _ blank "> Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Aktivitäten von Prognostizierte Patatin artigen Phospholipasen SMc00930 und SMc01003 mit p - Nitrophenyl- Acylester unterschiedlicher Kettenlänge

Nach der Expression von smc00930 oder smc01003 in E. coli BL21 (DE3) pLysS x, zellfreien Extrakte wurden auf ihre Fähigkeit untersucht , erhalten und p - Nitrophenyl Fettacyl Ester zu hydrolysieren. Während der enzymatischen Assay gebildete p -NP wurde in einem Spektrophotometer bestimmt. Minor hydrolytische Aktivitäten waren in zellfreien Extrakten aus E. erhalten coli BL21 (DE3) x pLysS mit einem leeren pET17b - Vektor (Tabelle 4) , wenn p - Nitrophenyl- Acylester von different Kettenlängen wurden als Substrate eingesetzt. Wenn smc01003 exprimiert wurde, erhalten die Extrakte zeigten eine erhöhte Hydrolyse von p - Nitrophenyl- Estern unterschiedlicher Kettenlänge. SMc01003 degradiert die mittlere Kette p - Nitrophenyl- decanoate sowie die langkettige p - Nitrophenyl- Palmitat und p - Nitrophenyl - Stearat (Tabelle 4). Als SMc01003 ist ein wesentlicher Faktor für die Bildung von langkettigen freien Fettsäuren in S. meliloti während der stationären Phase 11, war es überraschend , dass SMc01003 schien ebenso gut auf den Mittelkette zu agieren , als auf langkettige p - Nitrophenyl- Acylester (Tabelle 4). Unerwarteterweise SMc01003 auch kurzkettige Substrate wie p - Nitrophenyl oder p - Nitrophenyl Butyrat octanoat (Daten nicht gezeigt) auf. Jedoch sind diese letzteren Substrate auch durch Maßnahmen , die in zellfreien Extrakten aus E. abgebaut coli (dh beherbergt das leere vectoder pET17b) , ohne zusätzliche Gen exprimiert und mit kurzkettigen Substrate (C4), die Hälfte des Substrats wird bereits von E. abgebaut coli intrinsischen Enzyme (Daten nicht gezeigt). Es muss eindeutig SMc01003 gereinigt, um zu klären, ob SMc01003 funktioniert genauso gut auf kurz-, mittel- und langkettige Substrate. Im Allgemeinen p - Nitrophenyl- Acylester scheinen nicht gute Substrate für SMc01003 zu sein , die verständlich sein könnte , zu wissen , dass SMc01003 in Wirklichkeit eine DAG - Lipase 11. Zellfreie Extrakte, in denen smc00930 ausgedrückt worden war, zeigen deutlich höhere Enzymaktivitäten mit p - Nitrophenyl - Ester (Tabelle 4). Auch ist SMc00930 können p - Nitrophenyl Acylester unterschiedlicher Kettenlänge (C10, C12, C14, C16 und C18), obwohl p - Nitrophenyl - Palmitat zu hydrolysieren (spezifische Aktivität 5,5 mmol NP min - 1 mg Protein - 1) ist eindeutig die beste Substrat für SMc00930. Bis heute hat die Physiologische Substrat für SMc00930 ist nicht bekannt.

Ob Polar Lipids erkunden kann Funktion als Substrate für Prognostizierte (Phospho) Lipasen

Sobald eine (Phospho) Lipase Enzymtest wurde mit künstlichen Substraten, radiomarkierten Lipidgemische oder reine Lipide optimiert wurden, können als potentielle Substrate getestet werden.

Bei Untersuchung SMc00171 enthaltenden zellfreien Extrakten mit 14 C-markiertem PC unter optimierten Bedingungen konnten wir zeigen , dass SMc00171 PC zu DAG abbaut, ein Ergebnis , das 8 durch massenspektrometrische Untersuchungen bestätigt wurde. SMc00171 verschlechtert ebenfalls 32 P-markiertem PC phosphocholin und wirkt daher als eine PC-spezifische Phospholipase C (PLCP) 8, die unter phosphor begrenzende Wachstumsbedingungen induziert wird.

WannTesten SMc00930- oder SMc01003 enthaltenden zellfreien Extrakte mit 14 C- oder 32 P-markierten gesamten polaren Lipiden unter optimierten Bedingungen konnten wir zeigen , dass keine der Phospholipide durch SMc00930 oder SMc01003 unter Bedingungen abgebaut wird , wobei p - Nitrophenyl Acylester funktionierten als Substrate 11. Im Gegensatz dazu war ein handelsübliches Phospholipase A 2 aus Schlangengift der Lage , eine solche Mischung von Phospholipiden 11 abzubauen. Diese Ergebnisse waren überraschend und unerwartet, da beide, SMc00930 und SMc01003 wurden vorhergesagt Patatin-wie Phospholipasen werden.

Bei Untersuchung SMc00930- oder SMc01003 enthaltenden zellfreien Extrakten mit 14 C- markierten Diacylglycerin (DAG) unter optimierten Bedingungen konnten wir zeigen , dass DAG nicht durch SMc00930 abgebaut oder durch zellfreien Extrakten von E. coli, während SMc01003 degradiert DAG und bildet Verbindungen, wie freie Fettsäuren (Abbildung wandern 3). Kürzlich konnten wir zeigen , dass SMc01003 eine DAG - Lipase wirkt wie die DAG abbauen können oder Monoacylglycerin zu Glycerin und freien Fettsäuren 11 (Abbildung 4).

Figur 3
Abbildung 3. SMc01003 verschlechtert Diacylglycerin. Zellfreie Extrakte von E. coli BL21 (DE3) pLysS exprimiert × SMc01003, SMc00930 oder den leeren pET17b - Vektor enthalten, oder Puffer wurden für 24 h mit 14 C-DAG (erhalten von S. meliloti) inkubiert. Am Ende der jeweiligen Inkubationszeiten wurden radiomarkierten Lipide extrahiert und getrennt von 1D-TLC die mobile Phase für neutrale polare Lipide zu trennen (siehe 4.3.2). FA, Fettsäuren; DAG, Diacylglycerin. Diese Zahl wurde von [Sahonero-Canavesi et al. 2015] modifiziert 11.3large.jpg "target =" _ blank "> Bitte hier klicken, um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4. Die enzymatische Funktion von Diacylglycerol Lipase DGLA (SMc01003). Diacylglycerol (DAG) Lipase SMc01003 degradiert DAG Monoacylglycerin und einer Fettsäure, und dann verschlechtert Monoacylglycerin weiter zu Glycerin und anderen Fettsäure. Bitte klicken Sie hier , um eine größere Version davon zu sehen Zahl.

Oligonukleotids
Name
Sequenz
(5'-3 ')
Gen
von Interesse
Enzym Einschränkung
Website hinzugefügt
Vektor
für
den Ausdruck
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 Nde I pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xho I pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 Nde I pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 Bam HALLO pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 Nde I pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 Bam HALLO pET9a
Fettgedruckte Buchstaben zeigen Restriktionsstellen.

Tabelle 1 Oligonukleotide zum Verstärken und Klon vorhergesagt phospho (Lipase) Gene in pET17b oder pET9a Vektor. Primer - Oligonukleotide wurden entwickelt unter Verwendung der beschriebenen Software 15.

Assay für SMc00171 Assay für SMc01003 Assay für SMc00930
Stock Komponente
Tris-HCl, pH 8,5 25 ul
2 M Tris-HCl, pH 9,0 25 ul
1 M Diethanolamin-HCl, pH 9,8 50 ul
1 M NaCl 40 ul 150 ul 150 ul
1% Triton X-100 200 ul 200 ul
50 mM p- Nitrophenyl - Palmitat 12,5 ul 12,5 ul
200 mM Bis p- Nitrophenylphosphat 2,5 ul
zellfreie Extrakt (1 mg protein / ml) mit Kandidaten-Gen exprimiert 20 ul 100 ul 1 ul
zweifach destilliertem Wasser 887,5 ul 512,5 ul 611,5 ul
Schluss Volume 1 ml 1 ml 1 ml

Tabelle 2. Pipettieren Systeme für optimierte Enzymtests mit künstlichen p - Nitrophenylester Substraten.

Assay für smc00171 -encoded Phospholipase C Assay für smc01003 - codiert DAG - Lipase Optimierte Assay für Phospholipase A - Aktivität
Stock Komponente
2 M Tris-HCl pH 8,5 2,5 ul
2 M Tris-HCl pH 9,0 2,5 ul
100 mM MnCl 2 3 ul
1 M Diethanolamin-HCl pH 9,8 5 ul
1 M NaCl 4 ul 15 ul 15 ul
1% Triton X-100 2 ul 20 ul 20 ul 14 C-markiertes Lipid (Phospholipide) 20 ul (5000 cpm)
14 C-markiertes Lipid (PC) 20 ul (5000 cpm)
14 C-markiertes Lipid (DAG) 20 ul (5000 cpm)
10 mg / ml Protein-Extrakt mit ausgedrückt Kandidatengene 0,5 ul 5 ul 5 ul
zweifach destilliertem Wasser 87,5 ul 77,5 ul 77,5 ul
Das endgültige Volumen 100 ul 100 ul 100 ul

Tabelle3. Pipettieren Systeme für optimierte Enzymtests für (phospho) Lipasen mit radiomarkierten Lipidsubstrate.

Aktivität wird in Einheiten (& mgr; mol Nitrophenol / mg Protein x min) gegeben
Die fett gedruckten Zahlen zeigen Acylkettenlänge von p - Nitrophenylester Substrat 10 12 14 16 18
E. coli - Extrakt (Hintergrund) 16 ± 0,3 10 ± 1,1 13 ± 0,3 11 ± 0,8 10 ± 0,6
SMc00930 ausgedrückt in E. coli - Extrakt 1.839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
SMc01003 ausgedrückt in E. coli - Extrakt 43 ± 2,1 29 ± 2 20 ± 0,7 25 ± 1,5 22 ± 0,9
SMc00930 minus Hintergrund 1.823 ± 283 1.829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 minus Hintergrund 27 ± 2,1 18 ± 2 7 ± 0,7 14 ± 1,5 12 ± 0,9

Tabelle 4. p - Nitrophenyl- Acylester als Substrate für Patatin artigen Lipasen SMc00930 und SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In den letzten 20 Jahren haben die Genome vieler Organismen sequenziert worden, und obwohl eine Fülle von Daten Genomsequenz generiert wurde, ist funktionale Auslegung Rückstand und damit behindert unser Verständnis der Genomfunktion. Genfunktionen in Genomen basieren häufig auf Ähnlichkeit mit Genen bekannter Funktion oder Auftreten von konservierten Motive zugeordnet. Jedoch ist die genaue Funktion eines bestimmten Gens häufig nicht bekannt. Insbesondere vorhergesagte strukturelle Gene für Enzyme können nicht leicht durch omic Techniken untersucht werden aufgrund der Tatsache, dass die meisten Enzyme katalysieren komplexen Reaktionen, die zwei Substrate und zwei Produkte. Gegenwärtig scheint es machbarer Substratspezifitäten für Gruppen von Enzymen zu erkunden, wo mindestens ein Substrat befestigt ist, und wo der andere variiert werden kann. Zum Beispiel in Eukaryoten meisten Phosphorylierung Motive in Proteinen sind bekannt und Konsens Peptide für die Kinasen wurden auf festen Trägern, um gesichtet Peptid ar erzeugenStrahlen. Unter Verwendung solcher Arrays und radioaktiv markiertes ATP, Substratspezifität und Aktivität von verschiedenen Kinasen eines Organismus kann ermöglicht die Einrichtung eines Kinoms Profil bestimmt werden und Substrat definieren Spezifitäten 24. Hydrolases komponieren eine weitere große Gruppe von Enzymen, für die ein Substrat, Wasser, festgelegt ist, für die aber die genaue Art der (andere) Substrat hydrolysiert werden soll, wird oft nicht bekannt. Die Tatsache, dass für ein neues Enzym die optimale Assaybedingungen sind entweder nicht bekannt ist, wandelt die Detektion einer neuen Enzymaktivität in einem multivariablen Problem. Es kann daher in der Lage sein helfen, das Substrat zu fixieren, um zu hydrolysierende zu definieren, unter welchen Bedingungen das Enzym am besten funktioniert.

Im vorliegenden Manuskript beschreiben wir die Optimierung der Testbedingungen für Interessenten (phospho) Lipasen mit unbekannten Substratspezifität und erarbeiten, wie diese optimierten Bedingungen bei der Suche nach dem natürlichen Substrat der Wieder zu beschäftigenjeweiligen (phospho) Lipase. Die Bedeutung der vorliegenden Technik besteht darin , dass die Hydrolyse von fluorogenen oder chromogenen, künstliche Substrate, natürliche Substrate , die in einem gewissen Ausmaß nachahmen kann um 25 Spektrophotometrie verfolgt werden , und dass diese Assays in großem Maßstab studiert 26 leicht anwendbar sind. Aufgrund der Empfindlichkeit derartiger Assays und ihre Einfachheit der Reaktion zu überwachen, können sie leicht für ein gegebenes Enzym optimiert werden. Offensichtlich für künstliche Substrate könnte man erwarten , weniger günstige kinetischen Konstanten (dh hohe K M, low - k cat) für ein bestimmtes Enzym als für natürliche Substrate 1,21. jedoch funktioniert die leichte Verfügbarkeit und Nachweisbarkeit von künstlichen Substraten als (sehr schlecht) Substrate für ganze Gruppen von Enzymen in der Praxis oft mehr als die Nachteile kompensieren. Sobald die Bedingungen für ein Enzym begegnet zu arbeiten (mit dem künstlichen Substrat), wird sie so mit der Natural / physiologischen Substrat als auch. Da die Herstellung und Isolierung von potentiellen Lipidsubstrate kann mühsam und zeitaufwendig sein, ist es wichtig, die Gewissheit zu haben, dass ein Enzym bereit ist, zu arbeiten, wenn die Kombination und sie mit wertvollen Substraten inkubiert werden. Wichtig ist, zu arbeiten, das Verfahren der ersten, die Bedingungen für ein Enzym zu optimieren, wird eine schnellere Identifizierung des physiologischen Substrats für eine neue (phospho) Lipase erlauben. Als Beweis des Konzeptes haben wir diese Methode zur Charakterisierung von Substratspezifität von Lipasen SMc00171, SMc00930 erfolgreich eingesetzt, und SMc01003 8,11. Im Gegensatz dazu werden viele traditionelle, alternative Methoden zur Festlegung Assays für (phospho) Lipaseaktivitäten Reaktionen beinhalten, wo Substrat und Produkt bereits bekannt.

Offensichtlich Modifikationen des Assays optimale Enzymaktivität zu erfassen, kann die Verwendung anderer fluorogenen umfassen chromogene oder anderweitig markiert künstlichen Substraten, Variationsder Enzymkonzentration, Typ und Konzentration von Puffern oder anderen Additiven ( das heißt, Detergentien oder zweiwertigen Kationen). Wenn keine Enzymaktivität mit künstlichen Substraten detektiert wird, kann das jeweilige Enzym einfach nicht mit diesem Substrat arbeiten, aber zur Fehlerbehebung in solchen Fällen sollte sicherlich auch die Gewissheit zu haben, dass alle Vorkehrungen getroffen worden, die notwendig gewesen wäre, Enzymaktivität intakt zu halten 27 (dh die Speicherung zellfreien Extrakten bei 4 ° C oder tieferen Temperaturen bis zum Gebrauch und, falls erforderlich, Zugabe von Cocktails von Protease - Inhibitoren zur zellfreien Extrakten , um den proteolytischen Abbau des Enzyms von Interesse zu vermeiden).

Einschränkungen der Technik in diesem Manuskript vorgestellt werden sind auf die Tatsache zurückzuführen , dass die künstliche Substrat und das natürliche Substrat voneinander verschieden sind und in der Folge die Bioenergetik für die katalysierte Reaktion als auch 1 sein wird. Die verschiedenen ParMessern für die optimalen Bedingungen für die Enzymaktivität, sollten auch für das natürliche Substrat hergestellt werden (durch pH-Variation, die Art des Puffers, Puffer Stärke, Konzentrationen von NaCl und Detergenzien, wie Triton X-100, Abwesenheit oder Anwesenheit von verschiedenen zweiwertigen Kationen), da sie leicht von den optimalen Bedingungen für das künstliche Substrat anzutreffen sein könnte ausfallen. Eine weitere wichtige Einschränkung ist, dass wahrscheinlich nicht alle (phospho) Lipasen durch die Verwendung von künstlichen chromogene Substrate nachweisbar sind. Zum Beispiel könnte das künstliche p - Nitrophenyl - Rest der Ester - Substrate einfach zu sperrig sein, oder andere chemische Eigenschaften aufweisen , die verhindern , dass ein solches Substrat Zugang zu der aktiven Stelle eines Enzyms erhalten. Es wurde festgestellt , dass die DAG - Lipase SMc01003 geringe Aktivitäten mit allen p - Nitrophenylester Substraten unterschiedlicher Kettenlänge 11 angezeigt. Mit dem Wissen, dass DAG das natürliche Substrat für SMc01003 ist und dass DAG hat eine reltiv kleinen polaren Kopfgruppe, die aus Glycerin nur 11, ist es leicht vorstellbar , dass die sperrigen p - Nitrophenyl - Rest für einen einfachen Zugang zum aktiven Zentrum von SMc01003 einfach zu groß ist. Allerdings sind die molekularen Details , warum p - Nitrophenyl Ester sind nicht gute Substrate für SMc01003 sind an dieser Stelle nicht bekannt.

Kritischen Schritte in dem Protokoll enthalten alle Bestimmungen getroffen, um sicherzustellen, dass das untersuchte Enzym Zugriff auf das jeweilige Substrat aufweist. Beispielsweise bei der Suche nach der physiologischen Lipid-Substrat, ist es entscheidend, dass das Lipidsubstrat in einer solubilisierten Form vorliegt. Daher wird , wenn eine solche Enzymassays Einrichtung (in 5 des Protokolls beschrieben) lipidischen Substrate, in der Regel in Gemischen aus Methanol: Chloroform, sollte , bevor sie mit einer wässrigen Lösung eines Detergens, das heißt, Triton X-100, gemischt werden Trocknens nach unten das Gemisch wird mit Stickstoffgas. Dieses Verfahren stellt sicher, dass nach der verbleibenden ingre Zugabedients für den Assay wird das Potential Lipidsubstrat in Detergens-Mizellen eingebettet und als solche zugänglich für das Enzym während des Assays.

Grundsätzlich sollte die Technik, die hier vorgestellt werden breit anwendbar in der Zukunft für die Entdeckung neuer (phospho) Lipasen und für die Festlegung ihrer natürlichen Substrate. Die Technik ist leicht erweiterbar für andere Klassen der Hydrolasen, aber es könnte komplizierter sein Assays mit künstlichen Substraten für neue Enzyme zu entwickeln, die zwei erfordern, in der Regel nicht bekannt, Substrate ihrer katalytischen Zyklus zu vervollständigen.

Denn weder vorhergesagt (phospho) Lipasen oder Phosphatasen das richtige Substrat bekannt ist, noch den Testbedingungen, bei denen das Enzym gut funktioniert. Daher könnte es nützlich sein , ob eine Verbindung , die aus einer Batterie von künstlichen Verbindungen zu studieren, wie beispielsweise verschiedene p - Nitrophenyl-enthaltende Verbindungen (p - Nitrophenylphosphat, Phosphat bis- p - Nitrophenyl, p - Nitrophenyl Palmitat), könnte als Substrat funktionieren. Die Entdeckung der anfänglichen Enzymaktivitäten mit künstlichen Substraten hat den Weg geebnet zu lösen , dass SMc00171 ist eine PC-spezifische Phospholipase C 8, dass SMc01003 ist eine DAG - Lipase 11, und dazu beigetragen , die Bedingungen zu definieren , unter denen SMc00930 fungiert als Hydrolase 11. Offensichtlich ist das natürliche Substrat von SMc00930 derzeit noch unbekannt, und die physiologischen Zusammenhänge SMc00930 und SMc01003 werden noch gelöst werden. Daher ist die Aufgabe, eine physiologische Funktion für eine vorhergesagte Lipase vorzuschlagen, ist anspruchsvoll und nicht immer sofort mit Erfolg. Mutanten einen Mangel des vorhergesagten Lipase-Gens und deren Verbindung mit dem jeweiligen Wildtyp-Stamm Vergleich könnte experimentellen Beweis geben, dass die Lipase mit der Spezifität in seiner nativen Stamm Hintergrund wirkt, die in Teil 4) des Protokolls postuliert wurde. Offensichtlich ist die Forderung einer neuen Lipase-Aktivität shOuld durch In - vitro - Nachweis zu erbringen, dass ein bestimmtes Substrat durch Hydrolyse in definierte Produkte umgewandelt wird. Manchmal ist die postulierte physiologische Funktion könnten Lücken in Stoffwechselwege zu füllen oder das physiologische Verhalten des produzierenden Organismus erklären, aber in anderen Fällen gibt es einfach vielleicht noch nicht genug biochemische Kenntnisse sein Gefühl von einigen Aktivitäten zu machen. Im Laufe unserer Studien identifizierten wir mehrere Enzyme, die auf die intrinsische polaren Membranlipide von Bakterien wirken abbau sie und in einigen Fällen, um sie in einem Spieler in komplexeren Lipidzyklen umzuwandeln. Beispielsweise das neue Wissen Kombinieren dass SMc00171 ist eine PC-spezifischer Phospholipase C (PLCP) 8 , die unter phosphor begrenzende Wachstumsbedingungen, mit vorher existierenden Daten induziert wird, kann man eine neue DAG Zyklus postulieren , dass in vielen Umweltproteo existieren könnte und was Anlass zur Bildung von phosphorfreien Membranlipiden, wenn Phosphor wachstums begrenzen. in contrast, wenn Phosphor liefert reichlich vorhanden sind, wird DAG rephosphorylated zu Phosphatidsäure Eingabe de novo Phospholipid - Biosynthese, wodurch dieses Zyklus Lipid zu schließen und sicherzustellen , dass in erster Linie (glycero) Phospholipide in der Membran 8,28 vorhanden sind.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Diese Arbeit wurde durch Zuschüsse aus Consejo Nacional de Ciencias y Tecnología-México (CONACyT-Mexico) (82.614, 153.998, 253.549 und 178.359 in Investigación Científica Básica sowie 118 in Investigación en Fronteras de la Ciencia) und von Dirección General de unterstützt Asuntos de Personal Académico-Universidad Nacional Autónoma de México (UNAM DGAPA-; PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Definieren von Substratspezifität für Lipase und Phospholipase-Kandidaten
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter