Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Definere substratspesifisiteter for lipase og fosfolipase Kandidater

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Mikroorganismer produserer et bredt spekter av (fosfo) lipaser som skilles ut for å foreta eksterne substrater tilgjengelige for organismen. Alternativt kan andre (fosfo) lipaser være fysisk assosiert med den produserende organismen som forårsaker en omsetning på iboende lipider og ofte gir opphav til en ombygging av de cellulære membraner. Selv om potensielle (fosfo) lipaser kan forutsies med en rekke algoritmer når genet / proteinsekvens er tilgjengelig, har ofte ikke blitt oppnådd eksperimentelt bevis på enzymaktiviteter, substratspesifisitet, og mulige fysiologiske funksjoner. Dette manuskriptet beskriver optimalisering av analysebetingelsene for potensielle (phospho) lipaser med ukjente substratspesifisiteter og hvordan du kan bruke disse optimaliserte forhold i søket etter den naturlige substrat av en respektiv (fosfor) lipase. Ved hjelp av kunstige kromogene substrater, slik som p-nitrofenyl-derivater, kan hjelpe til å påvise en mindreenzymatisk aktivitet for en forutsagt (fosfo) lipase under standardbetingelser. Etter å ha møtt en mindre enzymatisk aktivitet, kan de forskjellige parametre for en enzymanalyse bli variert for å oppnå en mer effektiv hydrolyse av det kunstige substrat. Etter å ha bestemt hvilke vilkår et enzym fungerer godt, bør en rekke potensielle natur underlag bli analysert for deres nedbrytning, en prosess som kan følges ansette forskjellige kromatografiske metoder. Definisjonen av substrat-spesifisiteter for nye enzymer, gir ofte hypoteser for en potensiell fysiologiske rollen til disse enzymene, som deretter kan bli testet eksperimentelt. Etter disse retningslinjene, var vi i stand til å identifisere en fosfolipase C (SMc00171) som degraderer fosfatidylkolin til phosphocholine og diacylglycerol, i et viktig skritt for ombygging av membraner i bakterien Sinorhizobium meliloti på fosfor begrensende vilkår for vekst. For to spådd patatin-som fosfolipaser (SMc00930 og SMc01003) av samme organisme, kan vi redefinere sine substratspesifisiteter og avklare at SMc01003 er en diacylglycerol lipase.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Glyserol-baserte lipider som triacylglycerols og (glysero) fosfolipider utgjør viktig og sannsynligvis den mest kjente lipidklasser en. Triacylglycerols (tags) er fett eller oljer, som vanligvis fungerer som oppbevarings lipider, og derfor som potensielle energi- og karbonkilder. Tags kan brytes ned av lipaser, som ofte utskilles av den produserende organisme å fordøye eksterne koder og gjøre dem tilgjengelig som karbonkilder. Også lipaser har vært mye studert i løpet av årene på grunn av sine viktige bioteknologiske applikasjoner 2.

På grunn av deres amfifile natur og deres nær-sylindrisk form, (glysero) fosfolipider oppviser membrandannende egenskaper og vanligvis utgjør hoved lipidic komponentene i en bilayered membran 3. I enkle mikroorganismer, slik som bakterien Escherichia coli, bare tre store hode gruppe varianter, fosfatidylglycerol (PG), kardiolipin (CL), og phosphatidylethanolamine (PE) påtreffes, men man bør være oppmerksom på at hver og en av dem kan være substituert med et betydelig antall forskjellige fettstoffer acylkjeder ved sn -1 eller sn -2 stilling som gir opphav til et stort antall forskjellige molekylarter 4 . Andre bakterier kan ha andre fosfolipider i tillegg eller i stedet. For eksempel, Sinorhizobium meliloti, en jordbakterie som er i stand til å danne en nitrogen-fiksering rot nodul symbiose med belgfrukt alfalfa (Medicago sativa), inneholder i tillegg til PE en andre zwitterionisk fosfolipid, fosfatidylcholin (PC) 5. Også, lipider som ikke inneholder fosfor eller glyserol kan være amfifile og utgjør en del av cellemembranen. For eksempel, ved å fosfor-begrensende vekstbetingelser, i S. meliloti, (glysero) fosfolipider i stor grad erstattet av membran-lipider som ikke inneholder fosfor, dvs. sulfolipids, ornitin lipider, og diacylglyceryl trimethylhomoserine (DGTS) 6. I bakterier, blir DGTS dannet fra diacylglycerol (DAG) i en to-trinns reaksjonsvei 7, men kilden for DAG generasjon var ikke klar. Puls-chase eksperimenter antydet at PC kan være en forløper for DGTS 8 og ved hjelp av metoden beskrevet i dette manuskriptet vi kan identifisere en fosfolipase C (PLCP, SMc00171) som er dannet under fosfor-begrensende betingelser, og som kan konvertere PC til DAG og fosfokolin 8.

I en separat studie har vi oppdaget at en acyl-CoA-syntetase (FadD) -deficient mutant av S. meliloti eller Escherichia coli akkumulert frie fettsyrer ved inngåelse stasjonær vekstfase 9. Selv om disse fettsyrene så ut til å være avledet fra membranlipider, ble den nøyaktige kilde for frie fettsyrer eller enzym (er) og frigjør dem ikke kjent. Igjen, syssels strategien skissert i dette manuskriptet, to patatin-lignende 10 (phospho) lipaser (SMc00930 og SMc01003) som bidro til dannelsen av frie fettsyrer i S. meliloti 11 ble spådd. Overraskende, SMc01003 brukt DAG som substrat konvertere den til monoacylglycerolen og til slutt glyserol og frie fettsyrer 11. Derfor er SMc01003 en DAG lipase (DGLA).

Selv om en rekke algoritmer eksisterer for å forutsi potensiell (fosfo) lipaser 12,13, deres nøyaktige funksjon og fysiologiske rolle er vanligvis ikke kjent. Her skisserer vi en protokoll, å klone og overuttrykker spådd eller potensielle (phospho) lipaser. Dette manuskriptet forklarer hvordan enzymanalyser kan utvikles og optimaliseres for overexpressed (fosfor) lipase ved hjelp kunstige kromogene substrater. Vi gir eksempler hvordan med en optimalisert enzym assay den virkelige (fosfor) lipase underlaget kan oppstå, og hvordan disse funnene kan berike vår forståelse av mikrobiell fysiologi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Clone og overuttrykker Structural Gene for Forut Lipase

  1. Ved å bruke polymerase kjedereaksjon (PCR) 14 og spesifikke oligonukleotider (tabell 1) 15, forsterke genet av interesse (smc01003, smc00930, eller smc00171), forutsagt å kode for en lipase eller fosfolipase, fra det genomiske DNA til vertsorganismen (dvs. S. meliloti).
    1. Introduser spesifikke restriksjonsseter (med designet sekvens av oligonukleotider). Fordøye amplifiserte DNA-fragment med de tilsvarende restriksjonsenzymer, og klone den inn i en ekspresjonsvektor, slik som plasmider i pET-serien 16.
    2. Etter å verifisere den korrekte DNA-sekvens for det klonede gen, transformere vektoren til et uttrykk belastning, slik som Escherichia coli BL21 (DE3) pLysS 16.
  2. Forbered en overnatting pre-kulturen i uttrykket verten E. coli BL21 (DE3) PLYSS, husing den respektive pET vektoren med det klonede gen eller den tomme vektoren, i 100 ml kulturflasker som inneholdt 20 ml av Luria-Bertani-medium (LB) 17 i tillegg til de ønskede antibiotika. Kultur av cellene ved 30 ° C (eller ved den vanlige veksttemperatur av bakterien fra hvilken lipase stammer).
    1. Ved hjelp av de over natten pre-kulturer, inokuler 500 ml forvarmet LB-medium (pluss de nødvendige antibiotika) i 2 l kulturflasker for å oppnå en første optisk tetthet ved 620 nm (OD 620) = 0,05. Følge vekst av kulturer og ved en OD 620 = 0,3, tilsett isopropyl-β-D-tiogalaktosid (IPTG) til en sluttkonsentrasjon på 100 uM, og inkuberes under omrøring ved 30 ° C i en periode på 4 timer.
    2. Ved slutten av inkubasjonsperioden, overfører hver kultur til en 500 ml sentrifugerør og sentrifuger ved 5000 xg ved 4 ° C i 30 minutter. Resuspender bakterielle cellepelletene i 5 ml suspensjonsbuffer (for eksempel SMc00930- og SMc01003-uttrykkende celler i 50 mM Tris-HCl pH 8,0 og SMc00171-uttrykkende celler i 50 mM dietanolamin-HCl pH 9,8). Oppbevar cellesuspensjoner ved -80 ° C inntil bruk.

2. Forbered Cell frie proteinekstrakter og Bestem proteinkonsentrasjonen

  1. Tine bakteriecellesuspensjoner og lagre på is. Passere cellesuspensjoner tre ganger gjennom en kald trykkcelle ved 20.000 pund per i to. Fjerne intakte celler og celleavfall ved sentrifugering ved 5000 xg i 30 min ved 4 ° C.
  2. Etter sentrifugering fremstille porsjoner av 100 og 500 ul av supernatanten for etterfølgende analyse og lagre dem ved -80 ° C inntil bruk.
  3. Bruke en av de 100 ul alikvot for å bestemme proteinkonsentrasjonen av distinkte cellefrie ekstrakter ved en fremgangsmåte for valg eller som beskrevet 18.

3. Bruk Kunstige Underlag for optimalisering EnzymeAktiviteter i (fosfor) lipaser

  1. For en første dekning av forskjellige enzymaktiviteter ved å bruke kunstige substrater som gir et farget produkt ved hydrolyse, slik som p-nitrofenol (s np).
    1. For enzymanalyser optimalisert allerede med kunstige p nitrofenyl ester underlag (som er skissert for fosfolipase C PLCP (SMc00171), så vel som for den anslåtte patatin lignende fosfolipaser SMc00930 og SMc01003), bruk pipetteringsutstyr ordninger beskrevet i Tabell 2.
    2. Ved å utforske en ny potensial (fosfo) lipase, fremstille en første standard enzymanalysen inneholdende 50 mM Tris-HCl, pH 8,5, 100 mM NaCl, 0,05% Triton X-100, 0,5 mM p-nitrofenyl-inneholdende forbindelse (p-nitrofenylfosfat , bis- p-nitrofenylfosfat, p-nitrofenyl dekanoat, eller p-nitrofenyl palmitat), og cellefritt proteinekstrakt (sjekk 1, 3, 10, 30, 100, 300 og 1000 ug) i et totalt volum på 1 ml i 1 ml plast cuvettes.
      MERK: Bruk alkalisk pH (figur 1) når følgende p-nitrofenyl esterhydrolyse i en kontinuerlig analyse. Alternativt kan bruke enkle tidspunkts-analyser for et område av pH-verdier, tilsetning av NaOH ved slutten av inkubasjonsperioden for å avslutte enzymreaksjonen og for å sikre at alt p np er til stede i den phenolate form.
    3. Følge tidsforløpet for en økning i absorbans ved 405 nm, på grunn av dannelsen av p np, i et spektrofotometer ved 30 ° C i løpet av en 5 minutters periode. Kvantifisere den innledningsvis lineære dannelsen av p np ved å bestemme den innledende helling av økningen av absorbans pr tid.
    4. Beregn endring av konsentrasjon (A C) for p np bruke loven om Lambert-Beer (Aa = ε A C d) 1.
      MERK: Aa er en lineær endring av absorbans bestemt, er ε den molare ekstinksjonskoeffisient ved de respektive bølgelengden (i enheter på M -1 cm-1), d er lengden av lysbanen (1 cm), og A C er endringen i konsentrasjonen (i enheter av M) som skal bestemmes.
      1. Tatt i betraktning at analysen volum er 1 ml, beregne mengden av p np dannet.
        MERK: Beløp = konsentrasjon x volum.
      2. Beregn enzymaktiviteten ved å dividere mengden av p np dannet av den tid i hvilken den er dannet. Bestemme den spesifikke enzymaktivitet ved å dividere enzymaktivitet av mengden av protein (i mg) som var ansvarlig for å generere denne aktiviteten.
    5. Sammenligne absorbans endringer provosert av proteinekstrakter som en kandidat genet (smc00171, smc00930, eller smc01003) hadde blitt uttrykt med ekstrakter som havn bare en tom vektor.
      MERK: For å kunne fortsette med følgende trinn, spesifikke aktiviteter, forårsaket av proteinekstrakter som en kandidat genet hadde blitt uttrykt, bør være minst to ganger eller mmalm enn verdiene oppnådd for de spesifikke aktivitetene som forårsakes av proteinekstrakter som havn bare en tom vektor.
    6. For ytterligere forsøk ved å velge de betingelser hvor hydrolyse av p-nitrofenyl-inneholdende forbindelse er minimalt med cellefrie ekstrakter (dvs. tom vektor), og hvor den mest utpreget dannelse av p np og p -nitrophenolate anion (figur 1) kan observeres når proteinekstrakter anvendes, i hvilket en kandidat-gen var blitt uttrykt.
  2. Etter å bestemme den innledende enzymaktivitet på 3,1, optimalisere analysebetingelser i det respektive enzym ved å variere pH, type buffer, buffer styrke, konsentrasjoner av NaCl, detergenter så som Triton X-100, og fravær eller nærvær av forskjellige toverdige kationer.
    1. For forskjellige konsentrasjoner av hver variabel, bestemme den spesifikke enzymaktivitet (se 3.1.4.2) (den høyeste oppnådde nummer definerer tilstandenav maksimal enzymaktivitet). Bruke kombinasjonen av de optimale betingelser som oppstår for hver variabel for å definere en optimal enzymanalyse hvor hver variabel er til stede i sin optimale konsentrasjon.

Figur 1
Figur 1. p-nitrofenyl estere som kunstige substrater for (fosfo) lipaser i en spektrofotometrisk analyse. Ved hydrolyse av p-nitrofenyl-estere, er en syre (R-OH) og p-nitrofenol (p np) dannet. På grunn av den pK a = 7,2 for dissosiasjon av det fenoliske H + fra p np, ved en pH-verdi> 9,2 mer enn 99% er i den lyse gule p -nitrophenolate form og en molar ekstinksjonskoeffisient på 18 000 M -1 cm - 1 kan anvendes ved en bølgelengde av 405 nm for kvantifisering av gratis p -nitrophenolate 22. Når buffere med en pH på 8,5 ble brukt, ble absorbans bestemt ved 400 nm og en molar ekstinksjonskoeffisient på 14500 M -1 cm -1 ble ansatt 23. Klikk her for å se en større versjon av dette tallet.

MERK: Etter å ha definert optimale forhold for aktiviteten til enzymet av interesse, ta fatt på søket etter den virkelige / fysiologiske substrat for dette lipase. I prinsippet ta to, ofte komplementære, tilnærminger for å oppnå dette målet, en in vivo-metode eller en in vitro-metode.

4. In vivo Identifikasjon av fysiologisk substrat av en Lipase

ove_content ">. MERK: I en in vivo tilnærming, uttrykke lipase av interesse i en vertsorganisme 8,11 for å registrere over tid om uttrykk for lipase endrer host's lipidprofil I et annet in vivo tilnærming, generere en mutant mangelfull av genet av interesse 8,11 og studere hvorvidt dets lipid-profil er forskjellig fra villtypeversjonen 6,8,11. for å oppnå en kvantitativ vurdering av en organismes lipid-profil, en enkel metode består i radiomerking av celleforbindelser , ekstrahere lipidene, atskilt ved hjelp av kromatografi, og kvantifisering av de radioaktivt merkede separerte lipider.

  1. Radiomerking av lipider.
    1. Fremstille et natten over pre-kultur av en organisme av interesse (E. coli eller S. meliloti) i 5 ml av den ønskede kulturmedium (komplekst medium eller i et definert minimalt medium) og vokse ved 30 ° C.
    2. Fra pre-kulturen, inokulere inn i 20 ml av sameg friskt medium i en 100 ml kulturflaske for å oppnå en initiell OD 620 = 0,3 for kulturen.
    3. Ta en porsjon (1 ml) av kulturen under sterile betingelser og overføres til et 14 ml sterilt polystyren rundbunnet rør.
    4. Tilsett 1 uCi av [1- 14C] acetat (60 mCi per mmol) i 1 ml kultur.
    5. Inkuber flytende kultur under omrøring ved 30 ° C i en periode på 24 timer.
    6. Ved slutten av inkubasjonsperioden, overføre kulturen til et 1,5 ml mikrosentrifugerør og sentrifuger ved 12.000 xg ved romtemperatur i 5 min.
    7. Resuspender pelleten i 100 pl vann. På dette punktet, lagre cellesuspensjonen ved -20 ° C eller umiddelbart fortsette med utvinning av polare lipider (punkt 4.2).
  2. Utvinning av polare lipider.
    MERK: Metoden som beskrives her i hovedsak følger prosedyren rapportert av Bligh og Dyer 19.
    1. Til 100 ul av vandig celle suspdimensjonerte, tilsett 375 ul av metanol: kloroform-løsning (2: 1, vol / vol).
    2. Vortex i 30 sekunder og inkuberes i 5 minutter ved romtemperatur.
    3. Sentrifuger 5 minutter ved 12.000 xg ved romtemperatur.
    4. Overfør supernatanten til et nytt 1,5 ml mikrosentrifugerør.
    5. Legg 125 ul kloroform og 125 ul vann, vortex 30 sek.
    6. Sentrifuger 1 min ved 12.000 xg ved romtemperatur.
    7. Overfør den nedre kloroformfasen til et nytt rør og tørr med en strøm av nitrogengass.
    8. Oppløs tørkede lipider i 100 ul kloroform: metanol-oppløsning (1: 1, vol / vol).
      MERK: På dette punkt, kan en delmengde av 5 ul av lipidoppløsningen kvantifiseres ved væskescintillasjonstelling.
    9. For tynnsjikts kromatografisk (TLC) analyse, tørk ned de resterende 95 pl med en strøm av nitrogengass og gjenoppløse tørkede lipider i 20 pl kloroform: metanol-oppløsning (1: 1, vol / vol). Bruk en 3 pl prøvefor TLC-analyse.
  3. Separasjon av polare lipider ved tynnskiktskromatografi (TLC).
    MERK: Avhengig av lipidklasser som skal analyseres, kan ulike kombinasjoner av faste og mobile faser benyttes for separasjon. Her en typisk separasjon av ladede polare lipider og en annen, mer egnet for nøytrale polare lipider, ved hjelp av høy ytelse tynnsjiktskromatografi (HPTLC) silikagel aluminiumsplater som den faste fase, er beskrevet.
    1. Separasjon av ladede polare lipider av todimensjonal TLC (2D-TLC).
      1. Anvende en 3 ul aliquot av lipid prøven i et hjørne av en gel aluminiumsplate HPTLC silikagel (10 x 10 cm), 2 cm fra kanten av platen.
      2. Fremstille og blande den mobile fase (140 ml kloroform, 60 ml metanol og 10 ml vann) for separering i det første dimensjon.
      3. Coat en TLC utvikle kammer innvendig med kromatografi papir.
        MERK: Dette er for å sikre at gassfasen av kammeretvil bli mettet hurtig (innen 30 min) etter at den mobile fasen for den første dimensjonen har blitt lagt til kammeret, og kammeret er lukket med en glassplate.
      4. Fremstille og blande den mobile fase (130 ml kloroform, 50 ml metanol og 20 ml iseddik) for separering i den andre dimensjon, og overføring til en andre TLC fremkallingskammeret innvendig belagt med kromatografi papir og la kammeret mettet.
      5. Overføre nøye HPTLC silikagel aluminiumsplate med den tørkede lipidet prøven til det første kammer og utvikle (dvs. utføre kromatografi) på platen i 60 minutter i det lukkede kammer i den første dimensjonen 5.
      6. Fjern platen fra kammeret og la oppløsningsmidler tørk i en strømningshette i 30 minutter.
      7. Etter å snu platen 90 grader med hensyn til den foregående kromatografi, overføre HPTLC silikagel aluminiumplate, på hvilken lipidene er blitt separert i en dimensjon, for å second kammeret og utvikle platen i 60 minutter i den andre dimensjon 5.
      8. Fjern platen fra kammeret og la oppløsningsmidlet tørke ut i et strømningshette i minst 2 timer.
    2. Separasjon av nøytrale polare lipider.
      1. Anvende 3 ul aliquoter av lipid prøvene på en HPTLC silikagel aluminiumsplate utgangs 2 cm fra kantene av platen. Hvis flere prøver er analysert i et endimensjonalt kromatografi, holde en avstand på minst 1,5 cm mellom de ulike prøveapplikasjons flekker.
      2. Forbered og bland den mobile fasen (140 ml heksan, 60 ml dietyleter, og 8 ml eddiksyre) og overføring til en TLC utvikle kammer innvendig belagt med kromatografi papir og dekket med en glassplate for å la kammeret mettet (30 min).
      3. Overfør HPTLC silikagel aluminiumplate med de tørkede lipid prøvene til kammeret og utvikle platen i 30 minutter i det lukkede kammeret.
      4. Fjern platen fra kammeretog la oppløsningsmidlet tørke ut i et strømningshette i 2 timer.
  4. Kvantifisering og visualisering av separerte polare lipider.
    1. Når den utviklede TLC plate er tørr, inkubere den med et photostimulable luminescens (PSL) sikt i en lukket kassett i 3 dager.
    2. Utsett inkuberes skjermen til en PSL skanner og skaffe seg et virtuelt bilde av de utskilte radiomerkede lipider.
    3. Utfør kvantifisering ved hjelp av PSL programvare 20.
  5. Visualisering og isolering av de enkelte polare lipider klasser.
    1. Inkuber utviklet TLC plate i 10 minutter i et kammer kromatografi i nærvær av 1 g jodkrystaller.
      MERK: Separert lipidic forbindelser vil oppløse jod og vises som brune flekker.
    2. Circle flekkene med en blyant, sammenligne dem med relativ mobilitet (Rf) av standard forbindelser (dvs. 1,2-dipalmitoyl- sn -glycerol, dipalmitoyl-L-α-Phosphatidylcholine, DL-α-monopalmitin, eller palmitinsyre), og identifisere som lipidklasse de kan tilhøre.
    3. I en avtrekkshette, la jod fordampe fra TLC arket.
    4. Ved hjelp av en spatel, skrape silikagel inneholdende forbindelsen av interesse fra arket, og ekstrahere forbindelsen fra silikagel med en blanding av 100 ul vann og 375 ul av metanol: kloroform-løsning (2: 1; vol / vol).
    5. Fortsett med utvinning i henhold til Bligh og Dyer som skissert (4.2.2 og utover).
    6. Butikk renset lipidklasse i 100 ul kloroform: metanol-oppløsning (1: 1, vol / vol) ved -20 ° C inntil bruk.

5. In vitro Identifikasjon av fysiologisk substrat av en Lipase

MERK: I en in vitro-metode, undersøke om den lipase av interesse kan omdanne en blanding av isolerte lipider eller individuelle rene lipider til den tilsvarende hydrolysis produkter under de betingelsene som er definert som optimal i 3.2.

  1. Bruk pipettering ordninger for enzymanalyser pr Tabell 3 for PC-spesifikk fosfolipase C SMc00171 (se 5.2), fosfolipase A (se 5.3), og DAG lipase SMc01003 (se 5.4) aktivitet.
  2. Bestemmelse av PC-spesifikk fosfolipase C aktivitet (tabell 3).
    1. Til et 1,5 ml mikrosentrifugerør, tilsett 5000 tellinger per minutt (cpm) av den totale 14 C-merket PC og en oppløsning av Triton X-100.
    2. Bland og tørk under en strøm av nitrogen.
    3. Legg dietanolamin-HCl, pH 9,8 buffer, samt NaCl og MnCl2 løsninger og dobbeltdestillert vann for å oppnå et sluttvolum på 99,5 ul. Vortex i 5 sek.
    4. Tilsett 0,5 ul enzym (5 ug protein) (dvs. en celle-fri ekstrakt hvori overuttrykt SMc00171 er tilstede) for å initiere reaksjonen. Bland kort.
    5. Inkuber ved 30 ° C i 4 timer.
    6. Stopp reaksjonen vedtilsetning av 250 mL metanol og 125 pl kloroform.
    7. Ekstraher lipider som er beskrevet tidligere (se 4.2).
    8. Separate lipider endimensjonale (1D) -TLC (se 4.3.2 og 4.4), og analysere dem ved PSL imaging.
  3. Bestemmelse av fosfolipase A-aktivitet (tabell 3).
    1. Til en 1,5 ml mikro tube, tilsett 5000 cpm av totalt 14 C-merket fosfolipider og en løsning av Triton X-100.
    2. Bland og tørk under en strøm av nitrogen.
    3. For en endelig 100 ul analyse, tilsett Tris-HCl, pH 8,5 buffer, NaCl-oppløsning og vann. Vortex i 5 sek.
    4. Tilsett 5 ul enzym (50 ug protein) (dvs. en celle-fri ekstrakt hvori overuttrykt SMc00930 eller SMc01003 er til stede).
    5. Inkuber ved 30 ° C i 5 timer.
    6. Stopp reaksjonen ved tilsetning av 250 mL metanol og 125 pl kloroform.
    7. Ekstraher lipider som er beskrevet tidligere (se 4.2), separatedem med 1D-TLC under anvendelse av 130 ml kloroform, 50 ml metanol og 20 ml iseddik som den mobile fase, og analysere dem ved PSL avbildning.
  4. Fastsettelse av diacylglycerol (DAG) lipase aktivitet.
    1. Utarbeidelse av 14 C-merket DAG.
      1. Radiomerket S. meliloti kulturer (se 4.1) og pakke polare lipider (se 4.2) som beskrevet. Separat S. meliloti totale lipidekstrakter av 1D-TLC i kloroform: metanol: eddiksyre (130: 50: 20; v / v) ved anvendelse av betingelsene beskrevet for separasjon i andre dimensjonen i 4.3.1.
      2. Visualiser PC med jod flekker og bruke en blyant for å markere lokalisering av phosphatidylcholine (PC).
      3. Isoler radiomerket PC som beskrevet i 4.5.
      4. Kvantifisere utdraget PC ved scintillasjonstelling.
        MERK: Om 320 000 kpm PC er forventet.
      5. Behandle PC (250.000 cpm) med 0,1 U av fosfolipase C fra Clostridium perfringens i 50 mM Tris-HCl, pH 7,2, 0,5% Triton X-100 og 10 mM CaCl2 i 2 timer i et totalvolum på 100 pl og stopp reaksjonen ved å tilsette 250 ul metanol og 125 pl kloroform.
      6. Pakk lipider som tidligere og separat beskrevet av dem ved 1D-TLC (se 4.3.2).
      7. Isolere diacylglycerol fra silikaet platen og kvantifisere ved hjelp av scintillasjonstelling (som beskrevet i 4.2)
    2. Diacylglycerol lipase analysen (tabell 3).
      1. Til en 1,5 ml mikro tube, tilsett 5000 cpm av 14 C-merket DAG og en løsning av Triton X-100.
      2. Bland og tørk under en strøm av nitrogen.
      3. For en endelig 100 ul analyse, tilsett Tris-HCl (pH 9,0) buffer, en NaCl-oppløsning og dobbeltdestillert vann. Vortex i 5 sek.
      4. Initiere reaksjonen ved tilsetning av 5 ul enzym (50 ug protein i cellefritt ekstrakt).
      5. Inkuber ved 30 ° C i 4 timer.
      6. Stopp reaksjonen ved tilsetning av 250 ul av en metanold 125 ul kloroform og ekstrakt lipider som tidligere beskrevet (se 4.2).
      7. Analyser nøytrale polare lipider 1D-TLC (se 4.1.3.2) og påfølgende PSL imaging.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aktivitet av PC-spesifikk fosfolipase C SMc00171 med Bis- p-nitrofenylfosfat

Cellefrie ekstrakter oppnådd fra E. coli BL21 (DE3) pLysS x, som hadde smc00171 uttrykt, ble undersøkt for deres evne til å hydrolysere bis- p-nitrofenyl fosfatestere, ved anvendelse av en spektrofotometrisk enzymatisk assay som måler p np dannet. Ingen hydrolytiske aktivitet var til stede i cellefrie ekstrakter oppnådd fra E. coli BL21 (DE3) pLysS x huse en tom pET9a-vektor (data ikke vist) når bis- p-nitrofenylfosfat ble anvendt som substrat.

Tidsforløp for den p np dannede indikerer at det er en sterk avhengighet av mengden av cellefritt ekstrakt (fra E. coli BL21 (DE3) pLysS x, som hadde smc00171 uttrykt) tilsatt til analysen (figur 2A). Dersom mengden av dannet p np produkt vil avhenge bare av enzymkonsentrasjonen, bør en lineær korrelasjon mellom enzym (protein) konsentrasjon som anvendes og produkt dannet etter en viss tid overholdes. Klart, dette er ikke tilfelle for cellefrie ekstrakter hentet fra E. coli BL21 (DE3) pLysS x, som hadde smc00171 uttrykt (figur 2B). Selv om det kan være flere årsaker til en eksponentiell avhengighet av enzymaktivitet på proteinkonsentrasjonen 21, er en hyppig årsak til at ved fortynning av et enzym-inneholdende proteinekstrakt, andre komponenter i ekstraktet som kan være begrensende for enzymaktivitet, dvs. potensielle kofaktorer , fortynnes i tillegg. I slike tilfeller, blir uventet lav enzymaktivitet registrert med fortynnede cellefrie ekstrakter. Ved å inkludere en mettende konsentrasjon på 3 mM MnCl2 i enzymanalysen, p Np produkt dannet etter en viss tid bare er avhengig av mengden av enzym tilsatt (data ikke vist) indikerer at MnCl2 var en begrensende komponent for SMc00171 aktivitet i cellefrie ekstrakter av E. coli.

Figur 2
Figur 2. Bestemmelse av SMc00171 (fosfolipase) aktivitet ved anvendelse av kunstig substrat bis- p-nitrofenylfosfat. Tidsforløpet for p np dannelsen er vist ved anvendelse av cellefrie ekstrakter proteiner (● 10 ug / ml, ■ 15 ug / ml, ▲ 20 ug / ml) i hvilken SMc00171 hadde blitt uttrykt (A). p np dannet etter 40 min inkubering med forskjellige mengder av cellefrie ekstrakter proteiner hvori SMc00171 hadde blitt uttrykt (B). Feilfelt angir standardavvik..jove.com / filer / ftp_upload / 54613 / 54613fig2large.jpg "target =" _ blank "> Klikk her for å se en større versjon av dette tallet.

Aktiviteter i Spådd patatin lignende fosfolipaser SMc00930 og SMc01003 med p-nitrofenyl acylestere med forskjellig kjedelengde

Etter uttrykk for smc00930 eller smc01003 i E. coli BL21 (DE3) pLysS x, cellefrie ekstrakter ble oppnådd og undersøkt for deres evne til å hydrolysere p-nitrofenyl fettsyreasyl estere. Under den enzymatiske analyse, ble p np dannet bestemt i et spektrofotometer. Mindre hydrolytic aktiviteter var tilstede i cellefrie ekstrakter hentet fra E. coli BL21 (DE3) pLysS x med en tom pET17b vektoren (tabell 4) når p-nitrofenyl acylestere av different kjedelengder ble ansatt som underlag. Når smc01003 ble uttrykt, ekstraktene ble oppnådd, viste en økt hydrolyse av p-nitrofenyl-estere av forskjellige kjedelengder. SMc01003 degradert den middels kjede p-nitrofenyl dekanoat, så vel som langkjedede p-nitrofenyl-palmitat og p-nitrofenyl-stearat (tabell 4). Som SMc01003 er en stor bidragsyter for dannelsen av langkjedede frie fettsyrer i S. meliloti under stasjonære fase 11, var det overraskende at SMc01003 så ut til å virke like godt på medium-chain enn på langkjedede p-nitrofenyl acylestere (tabell 4). Uventet, SMc01003 virker også på kortkjedede substrater, slik som p-nitrofenyl-butyrat eller p-nitrofenyl oktanoat (data ikke vist). Imidlertid er disse sistnevnte substrater også nedbrytes av aktiviteter er tilstede i cellefrie ekstrakter av E. coli (dvs., husing den tomme Vecteller pET17b), uten å ta ekstra gen og med kortkjedede substrater (C4), blir halvparten av substratet som allerede er degradert av E. coli iboende enzymer (data ikke vist). Åpenbart må SMc01003 å bli renset for å avklare om SMc01003 fungerer like godt på kort, mellom, og langkjedede underlag. Generelt p nitrofenyl acylestere synes ikke å være gode substrater for SMc01003 som kan være forståelig vite at SMc01003 er i realiteten en DAG lipase 11. Cellefrie ekstrakter, der smc00930 hadde blitt uttrykt, viser mye høyere enzymaktivitet med p-nitrofenyl estere (tabell 4). Dessuten er SMc00930 i stand til å hydrolysere p-nitrofenyl acylestere med forskjellig kjedelengde (C10, C12, C14, C16 og C18), selv om p-nitrofenyl-palmitat (spesifikk aktivitet 5,5 mmol NP min - 1 mg protein - 1) er det klart beste underlaget for SMc00930. Hittil har physiolokirurgiske substrat for SMc00930 er ikke kjent.

Utforske Enten polare lipider kan fungere som substrat for Forut (fosfor) lipaser

Når en (fosfor) lipase enzymatisk analyse har blitt optimalisert med kunstig underlag, radiomerket lipid blandinger eller rene lipider kan bli testet som potensielle underlag.

Når analysere SMc00171 holdig cellefrie ekstrakter med 14 C-merket PC henhold optimaliserte forhold, kan vi vise at SMc00171 degraderer PC til DAG, et resultat som ble bekreftet ved massespektrometri studier 8. SMc00171 forringer også 32 P-merkede PC til phosphocholine og derfor fungerer som en PC-spesifikk fosfolipase C (PLCP) 8, som induseres under fosfor begrensende vilkår for vekst.

Nåranalysering av SMc00930- eller SMc01003-inneholdende cellefrie ekstrakter med 14 C- eller 32 P-merkede totale polare lipider i henhold optimaliserte betingelser, kan vi vise at ingen av fosfolipider blir degradert av SMc00930 eller SMc01003 under betingelser hvor p-nitrofenyl acylestere fungerte som substrater 11. I motsetning til dette, et kommersielt fosfolipase A2 fra slangegift var i stand til å nedbryte en slik blanding av fosfolipider 11. Disse resultatene var overraskende og uventet som begge, SMc00930 og SMc01003 ble spådd å bli patatin-lignende fosfolipaser.

Når analysere SMc00930- eller SMc01003 holdig cellefrie ekstrakter med 14 C- merket diacylglycerol (DAG) under optimale forhold, kan vi vise at DAG ikke forringes av SMc00930 eller cellefrie ekstrakter av E. coli, mens SMc01003 forringer DAG og danner forbindelser som vandrer som frie fettsyrer (figur 3). Nylig kunne vi vise at SMc01003 fungerer som en DAG lipase som kan forringe DAG eller monoacylglycerolen til glyserol og frie fettsyrer 11 (figur 4).

Figur 3
Figur 3. SMc01003 forringer diacylglycerol. Cellefrie ekstrakter av E. coli BL21 (DE3) pLysS x uttrykker SMc01003, SMc00930 eller inneholder den tomme pET17b vektoren, eller buffer ble inkubert med 14 C-DAG (erholdt fra S. meliloti) i 24 timer. Ved slutten av de respektive inkubasjonsperioder ble det radiomerkede lipider ekstrahert og separert ved 1D-TLC under anvendelse av den mobile fase for separering av nøytrale polare lipider (se 4.3.2). FA, fettsyrer; DAG, diacylglycerol. Dette tallet har blitt forandret fra [Sahonero-Canavesi et al. 2015] 11.3large.jpg "target =" _ blank "> Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. Enzymatisk funksjon av diacylglycerol lipase DGLA (SMc01003). Diacylglycerol (DAG) lipase SMc01003 degraderer DAG til monoacylglycerolen og en fettsyre, og deretter forringer monoacylglycerolen videre til glyserol og en annen fettsyre. Klikk her for å se en større versjon av denne figur.

oligonukleotid
navn
Sekvens
(5'-3 ')
Gene
av interesse
Enzyme begrensning
nettstedet lagt til
Vector
for ekspresjon
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 NdeI pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xhol pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 NdeI pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 Bam HI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 NdeI pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 Bam HI pET9a
Bokstaver i fet skrift indikerer restriksjonsseter.

Tabell 1. Oligonukleotider brukes til å forsterke og klone spådd fosfor (lipase) gener i pET17b eller pET9a vektor. Primer oligonukleotider ble utformet ved hjelp av den beskrevne programvare 15.

Analyse for SMc00171 Analyse for SMc01003 Analyse for SMc00930
Lager Komponent
Tris-HCl, pH 8.5 25 pl
2 M Tris-HCl, pH 9.0 25 pl
1 M dietanolamin-HCl, pH 9.8 50 pl
1 M NaCl 40 ul 150 ul 150 ul
1% Triton X-100 200 ul 200 ul
50 mm p- nitrofenyl palmitate 12,5 mL 12,5 mL
200 mm bis- p- nitrofenylfosfat 2,5 mL
cellefritt ekstrakt (1 mg Proteinkonn / ml) med kandidat genet uttrykkes 20 mL 100 pl 1 mL
dobbeltdestillert vann 887.5 mL 512,5 mL 611.5 mL
endelig Volume 1 ml 1 ml 1 ml

Tabell 2. pipettering ordninger for optimaliserte enzymanalyser med kunstig p nitrofenyl ester underlag.

Analyse for smc00171 -kodet fosfolipase C Assay for smc01003 - kodet DAG lipase Optimalisert analyse for fosfolipase A-aktivitet
Lager Komponent
2 M Tris-HCl pH 8.5 2,5 mL
2 M Tris-HCl pH 9.0 2,5 mL
100 mm MnCI2 3 pl
1 M Diethanolamine-HCl pH 9,8 5 pl
1 M NaCl 4 pl 15 ul 15 ul
1% Triton X-100 2 pl 20 mL 20 mL 14 C-merket lipid (fosfolipider) 20 mL (5000 kpm)
14C-merket lipid (PC) 20 mL (5000 kpm)
14 C-merket lipid (DAG) 20 mL (5000 kpm)
10 mg / ml Protein ekstrakt med uttrykte kandidat gener 0,5 ul 5 pl 5 pl
dobbeltdestillert vann 87,5 mL 77,5 mL 77,5 mL
sluttvolum 100 pl 100 pl 100 pl

Bord3. pipettering ordninger for optimalisert enzymanalyser for (phospho) lipaser med radiomerkede lipid underlag.

aktiviteten er gitt i enheter (umol nitrofenol / mg protein x min)
Fet tall indikerer acylkjedelengde av p-nitrofenyl ester substrat 10 12 14 16 18
E. coli-ekstrakt (bakgrunn) 16 ± 0,3 10 ± 1,1 13 ± 0,3 11 ± 0,8 10 ± 0,6
SMc00930 uttrykt i E. coli ekstrakt 1839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
SMc01003 uttrykt i E. coli ekstrakt 43 ± 2,1 29 ± 2 20 ± 0,7 25 ± 1,5 22 ± 0,9
SMc00930 minus bakgrunn 1823 ± 283 1829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 minus bakgrunn 27 ± 2,1 18 ± 2 7 ± 0,7 14 ± 1,5 12 ± 0,9

Tabell 4. p nitrofenyl acyl estere som substrater for patatin lignende lipaser SMc00930 og SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I løpet av de siste 20 årene, har genomene til mange organismer blitt sekvensert, og selv om et vell av genomsekvens data har blitt generert, er funksjonell tolkning henger etter og vanskeliggjør dermed vår forståelse av genomet funksjon. Gene funksjoner i genomer ofte blir tildelt basert på likhet med gener med kjent funksjon eller forekomst av bevarte motiver. Men den nøyaktige funksjon av et gitt gen er ofte ikke kjent. Spesielt spådd strukturelle gener for enzymer kan ikke være lett utforsket av Omic teknikker på grunn av det faktum at de fleste enzymer katalyserer kompliserte reaksjoner som involverer to substrater og to produkter. For tiden synes det mer mulig å utforske substratspesifisiteter for grupper av enzymer hvor i det minste ett substrat er fast og hvor den andre kan varieres. For eksempel, i eukaryoter fleste fosforylering motivene i proteiner er kjent og konsensus-peptider for kinaser har blitt sett på faste bærere for å generere peptid arstråler. Ved anvendelse av slike matriser og radiomerket ATP, substratspesifisitet og aktivitet av forskjellige kinaser av en organisme kan bestemmes tillater etablering av en kinome profil og avgrenser substratspesifisitet 24. Hydrolaser komponere en annen stor gruppe av enzymer hvor det ene substrat, vann, er fast men hvor den nøyaktige natur av den (andre) substrat som skal hydrolyseres er ofte ikke kjent. Det faktum at for en ny enzym de optimale analysebetingelser er ikke kjent heller, omdanner påvisning av en ny enzymaktivitet i et multivariabel problem. Det kan derfor bidra til å være i stand til å løse substratet som skal hydrolyseres for å definere under hvilke betingelser det enzymet som fungerer best.

I den nåværende manuskriptet, beskriver vi optimalisering av analysebetingelsene for prospektive (fosfor) lipaser med ukjente substratspesifisiteter og utdype hvordan å ansette disse optimaliserte forhold i jakten på det naturlige substratet av reperspektiv (fosfor) lipase. Betydningen av den foreliggende teknikk består i det faktum at hydrolysen av fluorogene eller kromogene, kunstige substrater, som etterligner naturlige substrater til en viss grad, kan etterfølges ved spektrofotometri 25 og at disse analysene er lett anvendelig for storskala studier 26. På grunn av følsomheten av slike analyser og deres enkelhet for å overvåke reaksjonen, kan de lett optimaliseres for et gitt enzym. Selvfølgelig, for kunstig underlag kan man forvente mindre gunstige kinetiske konstanter (dvs. høy K M, lav k katt) for et bestemt enzym enn for naturlig underlag 1,21. I praksis er imidlertid den lette tilgjengelighet og detekterbarhet av kunstige substrater som virker som (dårlig) substrater for hele grupper av enzymer ofte mer enn kompensere ulempene. Når ha oppstått vilkårene for et enzym for å fungere (med kunstig substrat), vil det gjøre det med natural / fysiologiske substrat i tillegg. Som ved fremstilling og isolering av potensielle substrater lipid kan være arbeidskrevende og tidkrevende, er det viktig å ha sikkerhet for at et enzym er klar til å arbeide ved kombinasjon og inkubere den med verdifulle substrater. Viktigere, av fremgangsmåten i første optimalisere betingelsene for et enzym til å arbeide, vil tillate en mer hurtig identifikasjon av den fysiologiske substrat for en ny (fosfo) lipase. Som et bevis på konseptet, har vi lykkes ansatt denne metoden for karakterisering av substratspesifisiteter av lipaser SMc00171, SMc00930, og SMc01003 8,11. I motsetning til mange tradisjonelle, alternative metoder etablere analyser for (fosfor) lipase aktiviteter medfører reaksjoner hvor underlaget og produktet er tidligere kjent.

Selvfølgelig modifikasjoner av metoder for å detektere optimal enzymaktivitet kan inkludere bruk av andre fluorogent, kromogen eller på annen måte merkede kunstige substrater, variasjonav enzymkonsentrasjonen, type og konsentrasjon av buffere, eller andre additiver (dvs. vaskemidler eller bivalente kationer). Hvis ingen enzymaktivitet oppdages med kunstig underlag, den respektive enzym rett og slett ikke kan fungere med dette underlaget, men feilsøking i slike tilfeller absolutt bør inneholde for å ha sikkerhet for at alle forholdsregler var tatt som kanskje har vært nødvendig for å opprettholde enzymaktivitet intakt (dvs. lagring av cellefrie ekstrakter ved 4 ° C eller lavere temperaturer før bruk og, om nødvendig, å tilsette cocktail av proteaseinhibitorer i cellefrie ekstrakter for å unngå proteolytisk nedbrytning for enzymet av interesse) 27.

Begrensninger av den teknikk som presenteres i dette manuskriptet er på grunn av det faktum at den kunstige substratet og det naturlige substratet er forskjellige fra hverandre, og i konsekvens bioenergi for den katalyserte reaksjon vil være så godt 1. De ulike nivåmeterne for de optimale betingelsene for enzymaktivitet bør etableres også for det naturlige substrat (ved å variere pH, type buffer, buffer styrke, konsentrasjoner av NaCl og detergenter så som Triton X-100, fravær eller nærvær av forskjellige toverdige kationer), som de kan vise seg å være litt forskjellig fra de optimale forhold oppstått etter den kunstige underlaget. En annen viktig begrensning er det sannsynligvis ikke alle (fosfo) lipaser er detekterbar ved bruk av kunstige kromogene substrater. For eksempel, den kunstige p-nitrofenyl rest av ester substrater rett og slett kan være for voluminøse, eller oppviser andre kjemiske egenskaper som hindrer at et slikt substrat kan få adgang til det aktive sete av et enzym. Det ble bemerket at den DAG lipase SMc01003 viste lav aktivitet med alle p-nitrofenyl ester-substrater med forskjellig kjedelengde 11. Med vissheten om at DAG er det naturlige underlaget for SMc01003 og at DAG har en relatively liten polar hodegruppe, bestående av glyserol bare 11, er det lett tenkelig at den voluminøse p nitrofenyl resten er rett og slett for stort for en enkel tilgang til det aktive området av SMc01003. Imidlertid er de molekylære detaljer hvorfor p-nitrofenyl-estere ikke er gode substrater for SMc01003 ikke kjent på dette tidspunkt.

Kritiske trinnene i protokollen omfatter alle bestemmelser tatt for å sikre at enzymet studert har tilgang til den respektive substratet. For eksempel, i søket etter den fysiologiske lipidsubstrat, er det viktig at lipidet substratet er tilveiebrakt i en oppløst form. Derfor, når de setter opp slike enzymanalyser (beskrevet i 5 av protokollen), lipidic substrater, vanligvis oppløst i blandinger av metanol: kloroform, skal blandes med en vandig løsning av et vaskemiddel, det vil si, Triton X-100, før tørking ned blandingen med nitrogengass. Denne prosedyren sikrer at, etter å ha lagt de rester Ingredients for analysen, blir den potensielle lipidsubstrat innleiret i vaskemiddel miceller og som sådan er tilgjengelig for enzymet under analysen.

Prinsipielt bør teknikken som presenteres her være allment gjeldende i fremtiden for oppdagelsen av nye (phospho) lipaser og for definisjonen av deres naturlige underlag. Teknikken er lett utvides til andre klasser av hydrolaser, men det kan være mer komplisert å utvikle analyser med kunstige substrater for nye enzymer som krever to, vanligvis ukjente, substrater for å fullføre deres katalytiske syklus.

For forutsagte (fosfo) lipaser eller fosfataser hverken riktig substratet er kjent eller de analysebetingelser i hvilken enzymet fungerer godt. Derfor kan det være nyttig å studere hvorvidt noen forbindelse fra et batteri av kunstige forbindelser, slik som tydelig p-nitrofenyl-inneholdende forbindelser (p-nitrofenylfosfat, bis- p-nitrofenylfosfat, p-nitrofenyl palmitat), kan fungere som substrat. Oppdagelsen av innledende enzymaktiviteter med kunstig underlag har banet vei for å løse det SMc00171 er en PC-spesifikk fosfolipase C 8, som SMc01003 er en DAG lipase 11, og bidratt til å definere hvilke vilkår SMc00930 fungerer som en hydrolase 11. Selvfølgelig er det naturlige substratet av SMc00930 tiden fortsatt ukjent og de fysiologiske sammenhenger SMc00930 og SMc01003 er fortsatt å være løst. Derfor er oppgaven å foreslå en fysiologisk funksjon for en spådd lipase utfordrende og ikke alltid umiddelbart møtt med suksess. Ved hjelp av mutanter som mangler av den forutsagte lipase-genet og sammenligne dem med de respektive villtypestammen kan gi eksperimentelle bevis for at den lipase fungerer med spesifisitet i det opprinnelige stamme bakgrunn som har blitt postulert i del 4) av protokollen. Det er klart at kravet om en ny lipaseaktivitet should understøttes av in vitro bevis for at en viss substratet omdannes ved hydrolyse til definerte produkter. Noen ganger postulerte fysiologiske funksjon kan fylle hullene i metabolske veier eller forklare den fysiologiske atferd for den produserende organisme, men i andre tilfeller er det rett og slett fortsatt ikke kan være nok biokjemisk kunnskap til å få orden på noen aktiviteter. I løpet av våre studier identifiserte vi flere enzymer som virker på indre polare membranlipider av bakterier nedbryter dem og, i noen tilfeller, å konvertere dem til en spiller i mer komplekse lipid sykluser. For eksempel å kombinere ny kunnskap som SMc00171 er en PC-spesifikk fosfolipase C (PLCP) 8 som induseres under fosfor begrensende vilkår for vekst, med eksisterende data, kan man postulere en roman DAG syklus som kan eksistere i mange miljø Proteobacteria og som gir opphav til dannelsen av fosfor-fri membranlipider når fosfor er vekstbegrensende. i kontrast, når fosfor forsyninger er rikelig, er DAG rephosphorylated til fosfatidinsyre å skrive inn de novo biosyntese fosfolipid, for derved å lukke denne lipid syklusen og å sikre at hovedsakelig (glysero) fosfolipider er tilstede i membranen 8,28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noe å avsløre.

Acknowledgments

Dette arbeidet ble støttet med tilskudd fra Consejo Nacional de Ciencias y Tecnología-México (CONACyT-Mexico) (82 614, 153 998, 253 549 og 178 359 i INVESTIGACION Científica Bàsica samt 118 i INVESTIGACION en Fronteras de la Ciencia) og fra Dirección General de asuntos de Personlig Académico-Universidad Nacional Autónoma de México (DGAPA-UNAM, PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Definere substratspesifisiteter for lipase og fosfolipase Kandidater
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter