Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Definindo substrato Especificidades para a lipase e fosfolipase candidatos

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Microorganismos produzem um largo espectro de lipases (fosfo) que são secretadas, a fim de fazer substratos externos disponível para o organismo. Alternativamente, outros (fosfo) lipase pode ser fisicamente associado com o organismo produtor causando uma rotação de lípidos intrínsecas e frequentemente dando origem a uma remodelação das membranas celulares. Embora potenciais (fosfo) lipase pode ser previsto com um certo número de algoritmos quando a sequência do gene / proteína está disponível, não tem frequentemente sido obtida prova experimental das actividades enzimáticas, especificidades de substrato, e funções fisiológicas potenciais. Este manuscrito descreve a optimização das condições de ensaio para a (fosfo) lipase prospectivos com especificidades de substrato desconhecidos e como empregar estas condições optimizadas na pesquisa para o substrato natural de um respectivo (fosfo) lipase. Usando substratos cromogénicos artificiais, tais como derivados de p-nitrofenilo, pode ajudar a detectar uma menoractividade enzimática para um (fosfo) lipase previsto, sob condições padrão. Tendo encontrado uma actividade enzimática, tais menor, os parâmetros distintos de um ensaio de enzima podem ser variados de modo a obter uma hidrólise mais eficiente do substrato artificial. Depois de ter determinado as condições sob as quais uma enzima funciona bem, uma variedade de substratos naturais potenciais devem ser ensaiadas quanto à sua degradação, um processo que pode ser seguido utilizando métodos cromatográficos diferentes. A definição das especificidades de substrato para enzimas novas, frequentemente fornece hipóteses para um potencial papel fisiológico destas enzimas, que podem então ser testados experimentalmente. Seguindo essas orientações, fomos capazes de identificar uma fosfolipase C (SMc00171) que degrada fosfatidilcolina para fosfocolina e diacilglicerol, em um passo crucial para a remodelação das membranas na bactéria Sinorhizobium meliloti das condições de limitação de fósforo de crescimento. Para duas previu patatin-como fosfolipases (SMc00930 e SMc01003) do mesmo organismo, que poderia redefinir suas especificidades de substrato e esclarecer que SMc01003 é uma lipase diacilglicerol.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Lípidos à base de glicerol como triglicerídeos e fosfolipídios (glicero) constituem importante e, provavelmente, as classes de lípidos mais conhecidos 1. Triacilgliceróis (tags) são as gorduras e óleos, que normalmente funcionam como lipídios de armazenamento e, portanto, como potenciais fontes de energia e de carbono. As tags podem ser degradados por lipases, que são frequentemente segregadas pelo organismo produtor de digerir TAGs externas e torná-los disponíveis como fontes de carbono. Além disso, lipases têm sido amplamente estudados ao longo dos anos devido às suas importantes aplicações biotecnológicas 2.

Devido à sua natureza anfifílica e sua forma quase cilíndrica, propriedades de formação de membrana (glicero) fosfolipídios de exposição e normalmente constituem os principais componentes lipídicos de uma membrana de bicamada 3. Em microorganismos simples, tais como a bactéria Escherichia coli, apenas três variantes principais grupo de cabeça, fosfatidilglicerol (PG), a cardiolipina (CL), e phosphatidylethanolamine (PE) são encontrados, embora se deva ter presente que cada um deles pode ser substituído com um número considerável de diferentes cadeias de acilo gordo na posição sn-1 ou sn posição -2 dando origem a um grande número de diferentes espécies moleculares 4 . Outras bactérias pode ter outros fosfolipídios em adição ou em vez disso. Por exemplo, Sinorhizobium meliloti, uma bactéria do solo, que é capaz de formar uma simbiose nódulo da raiz de fixação de azoto, com a alfafa de leguminosas (Medicago sativa), contém, além de um segundo fosfolípido PE zwitteriónico, fosfatidilcolina (PC) 5. Além disso, os lipídios não contendo fósforo ou glicerol pode ser anfifílico e fazem parte da membrana celular. Por exemplo, em condições de crescimento limitativos de fósforo, em S. meliloti, (glicero) fosfolípidos são em grande parte substituído por lípidos da membrana que não contêm fósforo, ou seja, os sulfolípidos, lípidos ornitina, e diacylglyceryl trimethylhomoserine (DGTS) 6. Em bactérias, DGTS é formado a partir de diacilglicerol (DAG) em uma via de duas etapas 7, mas a fonte para geração de DAG não foi claro. Experimentos pulse-chase sugeriu que o PC pode ser um precursor para DGTS 8 e utilizando a metodologia descrita neste manuscrito foi possível identificar uma fosfolipase C (PLCP, SMc00171) que é formado sob condições limitantes de fósforo e que pode converter PC em DAG e fosfocolina 8.

Em um estudo separado, descobrimos que uma sintetase de acil-CoA (FADD) -deficient mutante de S. meliloti ou de Escherichia coli acumulada ácidos graxos livres ao entrar em fase estacionária de crescimento de 9. Embora estes ácidos gordos pareceu ser derivados de lípidos da membrana, a origem exacta para os ácidos gordos livres ou a enzima (s) libertando-os não eram conhecidos. Mais uma vez, empregando a estratégia delineada neste manuscrito, dois 10 (fosfo) lipases patatina-like (SMc00930 e SMc01003) que contribuiu para a formação de ácidos gordos livres em S. meliloti 11 foram previstos. Surpreendentemente, SMc01003 DAG utilizado como substrato para convertê-lo e, finalmente, monoacilglicerol glicerol e ácidos gordos livres 11. Por conseguinte, é uma lipase SMc01003 DAG (DGLA).

Embora um número de algoritmos de previsão do potencial existe (fosfo) lipases 12,13, a sua função precisa e papel fisiológico normalmente não é conhecido. Aqui destacamos um protocolo, clonar e sobre-expressar lipases (fosfo) previstos ou potenciais. Este manuscrito explica como ensaios de enzimas pode ser desenvolvido e optimizado para o (fosfo) lipase sobre-expresso utilizando substratos cromogénicos artificiais. Nós fornecemos exemplos como com um ensaio enzimático otimizado do real (fosfo) lipase substrato podem ser encontradas e como estas descobertas podem enriquecer a nossa compreensão da fisiologia microbiana.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. O clone e gene estrutural para sobre-expressar a lipase Previsto

  1. Usando reacção em cadeia da polimerase (PCR) 14 e oligonucleótidos específicos (Tabela 1) 15, amplificar o gene de interesse (smc01003, smc00930, ou smc00171), previsto para codificar para uma lipase ou fosfolipase, a partir do ADN genómico do organismo hospedeiro (ou seja , S. meliloti).
    1. Introduzir locais específicos de restrição (com a sequência dos oligonucleótidos concebidos). Digerir o fragmento de DNA amplificado com as enzimas de restrição correspondentes e cloná-lo num vector de expressão, tais como plasmídeos da série pET 16.
    2. Após verificar a sequência de DNA correcta para o gene clonado, transformar o vector de uma estirpe de expressão, tais como Escherichia coli BL21 (DE3) pLysS 16.
  2. Preparar uma pré-cultura durante a noite do hospedeiro de expressão E. coli BL21 (DE3) pLYSS, albergando o respectivo vector pET com o gene clonado ou o vector vazio, em 100 ml de frascos de cultura contendo 20 ml de caldo de Luria Bertani (LB) mais os 17 antibióticos necessários. Cultura das células a 30 ° C (ou à temperatura habitual de crescimento da bactéria a partir da qual origina a lipase).
    1. Usando as pré-culturas durante a noite, inocular 500 ml de meio LB pré-aquecido (mais os antibióticos necessários) em balões de 2 L de cultura para se obter uma densidade óptica inicial a 620 nm (OD 620) = 0,05. Seguir o crescimento das culturas e a uma DO 620 = 0,3, adicionar isopropil-β-D-tiogalactósido (IPTG) até uma concentração final de 100 uM, e incuba-se sob agitação a 30 ° C durante um período de 4 h.
    2. No final do período de incubação, cada cultura transferir para um tubo de centrífuga de 500 mL e centrifugação a 5000 xg, a 4 ° C durante 30 min. Ressuspender sedimentos celulares bacterianos em 5 ml de tampão de suspensão (por exemplo, SMc00930- e células que expressam SMc01003 em Tris-HCl 50 mM pH 8,0 e as células que expressam SMc00171-em 50 mM de dietanolamina-HCI pH 9,8). Armazenar as suspensões de células a -80 ° C até à sua utilização.

2. Preparar extractos de proteínas livres de células e determinar a concentração de proteína

  1. Descongelar as suspensões de células bacterianas e armazenar em gelo. Passe suspensões de células três vezes através de uma célula de pressão a frio em 20.000 lb por no 2. Remover as células intactas e os resíduos celulares por centrifugação a 5000 xg durante 30 min a 4 ° C.
  2. Após centrifugação, preparar alíquotas de 100 e 500 ul do sobrenadante para análise subsequente e armazená-las a -80 ° C até à sua utilização.
  3. Utilize uma das alíquota de 100 ul para determinar a concentração de proteínas de extractos livres de células distintas por um método de escolha ou como descrito 18.

3. Use substratos artificiais para otimizar EnzymeAtividades de (Fosfo) lipases

  1. Para uma cobertura inicial de actividades enzimáticas distintas, utilizar substratos artificiais que produzem um produto de cor aquando da hidrólise, tais como p-nitrofenol (p) -np.
    1. Para os ensaios de enzima já otimizada com substratos de éster de p-nitrofenilo (artificiais descritos para a fosfolipase C PLCP (SMc00171), bem como para as fosfolipases-patatina como preditos SMc00930 e SMc01003), utilizar esquemas de pipetagem descrita na Tabela 2.
    2. Ao explorar um novo potencial de lipase (fosfo), preparar um primeiro ensaio padrão de enzima contendo Tris-HCl a 50, pH 8,5, NaCl 100 mM, 0,05% de Triton X-100, p-nitrofenilo composto contendo (p-nitrofenil fosfato 0,5 mM , fosfato de bis-p-nitrofenilo, p-nitrofenilo decanoato, palmitato ou p-nitrofenilo), e extracto proteico livre de células (veja 1, 3, 10, 30, 100, 300, e 1000 ug) num volume total de 1 ml em 1 ml cuve plásticoTTES.
      NOTA: O uso de pH alcalino (Figura 1) quando se segue a hidrólise do éster p-nitrofenilo num ensaio contínuo. Em alternativa, usar ensaios de ponto de utilização única para uma gama de valores de pH, a adição de NaOH no final do período de incubação para terminar a reacção enzimática e para assegurar que todos os p -np está presente na forma de fenolato.
    3. Seguir o curso de tempo para um aumento da absorvância a 405 nm, devido à formação de p -np, num espectrofotómetro a 30 ° C durante um período de 5 min. Quantificar a formação inicialmente linear de p -np por determinação da inclinação inicial do aumento de absorvência por unidade de tempo.
    4. Calcular a variação da concentração (Sc) para p -np usando a lei de Lambert-Beer (Aa = ε Sc d) 1.
      NOTA: Aa representa a alteração linear da absorvância determinada, ε é o coeficiente de extinção molar, no respectivo comprimento de onda (em unidades de M-1 cm-1), d é o comprimento do caminho de luz (1 cm), e Sc é a mudança de concentração (em unidades de M) a ser determinado.
      1. Considerando-se que o volume de ensaio é de 1 ml, calcular a quantidade de p -np formado.
        Observação: o valor = concentração x volume.
      2. Calcula-se a actividade da enzima através da divisão da quantidade de p -np formado pelo tempo em que é formado. Determinar a actividade enzimática específica, dividindo a actividade enzimática pela quantidade de proteína (em mg) que foi responsável pela geração desta actividade.
    5. Comparar as alterações de absorção provocadas por extratos de proteína em que um gene candidato (smc00171, smc00930 ou smc01003) tinham sido expressas com extratos que abrigam única um vetor vazio.
      NOTA: A fim de continuar com as etapas a seguir, as actividades específicas, causadas por extratos de proteína em que um gene candidato tinha sido expressa, deve ser pelo menos duas vezes ou mminério de que os valores obtidos para as actividades específicas causadas por extractos de proteína única que abrigam um vector vazio.
    6. Para novas experiências, selecione essas condições em que a hidrólise do composto p-nitrofenilo contendo é mínima com extratos livres de células (isto é, o vector vazio) e para o qual a formação mais pronunciado da p -np eo ânion p -nitrophenolate (Figura 1) pode ser observado quando são empregues extractos de proteína, em que um gene candidato tinha sido expressa.
  2. Após a determinação da actividade da enzima inicial em 3,1, optimizar as condições de ensaio para a enzima respectiva, fazendo variar o pH, o tipo de tampão, tampão de força, as concentrações de NaCl, detergentes, tais como Triton X-100, e a ausência ou a presença de diferentes catiões bivalentes.
    1. Para diferentes concentrações de cada uma das variáveis, determinar a actividade enzimática específica (ver 3.1.4.2) (o número mais elevado obtido define a condiçãoda actividade enzimática máxima). Utilizar a combinação das condições óptimas encontradas para cada variável para definir um ensaio enzimático optimizado no qual cada uma das variáveis ​​está presente na sua concentração óptima.

figura 1
Figura 1. p-nitrofenilo ésteres como substratos artificiais para (fosfo) lipase em um ensaio espectrofotométrico. Após a hidrólise de ésteres de p-nitrofenilo, um ácido (R-OH) e p-nitrofenol (p -np) são formados. Devido ao pKa = 7,2 para a dissociação do fenólico H + a partir de p -np, a um pH> 9,2 mais do que 99% estão na forma p -nitrophenolate amarelo brilhante e um coeficiente de extinção molar de 18.000 M-1 cm - 1 pode ser utilizado num comprimento de onda de 405 nm para a quantificação do livre p -nitrophenolate 22. Quando foram utilizados buffers com um pH de 8,5, a absorvância foi determinada a 400 nm e um coeficiente de extinção molar de 14.500 M-1cm-1 foi empregado 23. Por favor clique aqui para ver uma versão maior desta figura.

NOTA: Depois de ter definido as condições ideais para a atividade da enzima de interesse, embarcar na busca do substrato reais / fisiológica desta lipase. Em princípio, tomar dois, muitas vezes complementares, abordagens para atingir este objetivo, uma abordagem in vivo ou uma abordagem in vitro.

4. In Vivo Identificação da condição fisiológica do substrato de uma lipase

ove_content "> NOTA:. Em uma abordagem in vivo, expressar a lipase de interesse num organismo hospedeiro 8,11 para registrar ao longo do tempo se a expressão da lipase altera o perfil lipídico host's Em outra abordagem in vivo, gerar um mutante deficiente do gene de interesse e 8,11 estudar se o seu perfil de lípidos é diferente do tipo selvagem versão 6,8,11. a fim de obter uma avaliação quantitativa de perfil lipídico de um organismo, um método simples consiste na radiomarcação de compostos celulares , extracção dos lípidos, separando-os por meio de cromatografia, e quantificar os lípidos separados marcados radioactivamente.

  1. Radiomarcação de lipídios.
    1. Prepara-se uma pré-cultura durante a noite de um organismo de interesse (meliloti E. coli ou S.) em 5 ml de meio de cultura desejada (meio complexo ou meio mínimo definido) e crescer a 30 ° C.
    2. A partir do pré-cultura, inocular em 20 ml do SAme meio fresco num frasco de cultura de 100 ml para se obter uma DO 620 = 0,3 inicial para a cultura.
    3. Tomar uma aliquota (1 ml) da cultura em condições estéreis e transferir para um poliestireno de 14 ml estéril tubo de fundo redondo.
    4. Adicionar 1 uCi de [1- 14 C] acetato de etilo (60 mCi por mmole) para a cultura de 1 ml.
    5. Incubar a cultura líquida sob agitação a 30 ° C durante um período de 24 h.
    6. No final do período de incubação, a transferência da cultura para um tubo de microcentrífuga de 1,5 ml e centrifugar a 12,000 xg à temperatura ambiente durante 5 min.
    7. Ressuspender o sedimento em 100 ul de água. Neste ponto, armazenar a suspensão de células a -20 ° C ou imediatamente continuar com a extracção de lípidos polares (secção 4.2).
  2. Extracção de lipidos polares.
    NOTA: O método descrito aqui segue essencialmente o procedimento descrito por Bligh e Dyer 19.
    1. Para os 100 ul de células aquosa suspension, adicionar 375 ul de solução de metanol: clorofórmio (2: 1; vol / vol).
    2. Vortex durante 30 segundos e incuba-se durante 5 min à temperatura ambiente.
    3. Centrifugar 5 min a 12.000 x g à temperatura ambiente.
    4. Transferir o sobrenadante para um novo tubo de microcentrifugação de 1,5 ml.
    5. Adicionar 125 ul de clorofórmio e 125 ul de água, vortex 30 seg.
    6. Centrifugar 1 min a 12.000 x g à temperatura ambiente.
    7. Transferir a fase inferior de clorofórmio para um tubo fresco e seco com uma corrente de azoto gasoso.
    8. Dissolve-se lípidos secos em 100 ul de clorofórmio: solução de metanol (1: 1; v / v).
      NOTA: neste momento, uma parte alíquota de 5 ul da solução de lípido pode ser quantificada por contagem de cintilação líquida.
    9. Para a análise cromatográfica em camada fina (TLC), secar-se os restantes 95 mL com uma corrente de azoto gasoso e dissolver de novo os lípidos secos em 20 ul de clorofórmio: solução de metanol (1: 1; v / v). Usar uma aliquota de 3 uLpor análise de TLC.
  3. A separação de lípidos polares, por cromatografia em camada fina (TLC).
    NOTA: Dependendo das classes de lípidos a ser analisado, diferentes combinações de fases sólidas e móveis pode ser utilizado para a separação. Aqui uma separação típica de lípidos carregados e polares outro, mais adequados para lípidos polares neutros, utilizando cromatografia em camada fina (HPTLC) folhas de alumínio em gel de sílica de alto desempenho como fase sólida, são descritos.
    1. Separação de lipídios polares cobradas pelo bidimensional TLC (2D-TLC).
      1. Aplicar uma aliquota de 3 uL de amostra de lípido a um canto de uma folha de alumínio em gel de sílica HPTLC (10 x 10 cm), a 2 cm do bordo da placa.
      2. Preparar e misturar a fase móvel (140 ml de clorofórmio, 60 ml de metanol, e 10 ml de água) para a separação na primeira dimensão.
      3. Unte uma câmara de revelação TLC internamente com papel para cromatografia.
        NOTA: Este é garantir que a fase de gás da câmaravai ser saturado rapidamente (dentro de 30 min) após a fase móvel para a primeira dimensão foi adicionado à câmara e a câmara foi fechada com uma placa de vidro.
      4. Preparar e misturar a fase móvel (130 ml de clorofórmio, 50 ml de metanol, e 20 ml de ácido acético glacial) para a separação na segunda dimensão e transferência para uma segunda câmara de CCF internamente revestida com o papel de cromatografia e deixar a câmara de saturar.
      5. Transferir cuidadosamente a folha de alumínio em gel de sílica HPTLC com a amostra de lípido seca para a primeira câmara e desenvolver (ou seja, realizar cromatografia), a placa durante 60 minutos na câmara fechada na primeira dimensão 5.
      6. Remova a placa da câmara e deixa solventes secar numa câmara de fluxo para 30 min.
      7. Depois de ligar a placa por 90 graus no que diz respeito ao anterior cromatografia, transferir a folha de alumínio em gel de sílica HPTLC, em que os lípidos foram separadas em uma dimensão, com o second câmara e o desenvolvimento da placa durante 60 minutos na segunda dimensão 5.
      8. Remover a folha a partir da câmara e permitir que os solventes se secar numa câmara de fluxo durante pelo menos 2 h.
    2. A separação de lípidos polares neutros.
      1. Aplicar 3 mL alíquotas de amostras de lípido sobre uma folha de alumínio de gel de sílica HPTLC começando 2 cm dos bordos da placa. Se várias amostras são analisadas numa cromatografia unidimensional, mantenha uma distância de pelo menos 1,5 cm entre os diferentes pontos de aplicação da amostra.
      2. Preparar e misturar a fase móvel (140 ml de hexano, 60 ml de éter dietílico, e 8 ml de ácido acético) e transferência para uma câmara de desenvolvimento TLC revestidas internamente com papel de cromatografia e cobertos com uma placa de vidro para permitir a saturar câmara (30 min).
      3. Transferir a folha de alumínio de HPTLC de gel de sílica com as amostras de lípido seca para a câmara e desenvolver a placa durante 30 minutos na câmara fechada.
      4. Remova a placa da câmarae deixar que os solventes secar numa câmara de fluxo durante 2 h.
  4. Quantificação e visualização de lípidos polares separadas.
    1. Uma vez que a folha de TLC desenvolvido é seco, incubar isto com uma tela de luminescência fotoestimuláveis ​​(PSL) numa cassete fechado durante 3 dias.
    2. Expor a tela incubadas a um scanner PSL e adquirir uma imagem virtual de lípidos radiomarcadas foram separadas.
    3. Realizar quantificação usando software PSL 20.
  5. Visualização e isolamento de classes de lipídios polares individuais.
    1. Incubar folha CCF desenvolvida durante 10 min numa câmara de cromatografia na presença de 1 g de cristais de iodo.
      NOTA: Separado compostos lipídicos vai dissolver o iodo e aparecem como manchas acastanhadas.
    2. Círculo as manchas com um lápis, compará-los com a mobilidade relativa (Rf) de compostos padrão (ou seja, 1,2-dipalmitoil-sn-glicerol, dipalmitoil-L-α-fosphatidylcholine, DL-α-monopalmitina, ou ácido palmítico), e identificar a classe de lípido que eles possam pertencer.
    3. Numa hotte, deixar que o iodo se evaporar a partir da folha de TLC.
    4. Com a ajuda de uma espátula, raspar o gel de sílica contendo o composto de interesse a partir da folha, e extrair o composto a partir do gel de sílica com uma mistura de 100 ul de água e 375 ul de solução de metanol: clorofórmio (2: 1; vol / vol).
    5. Continue com a extracção de acordo com Bligh e Dyer, conforme descrito (4.2.2 em diante).
    6. Loja classe de lípido purificado em 100 ul de clorofórmio: solução de metanol (1: 1; v / v) à temperatura de -20 ° C até à sua utilização.

5. Identificação In Vitro da condição fisiológica do substrato de uma lipase

NOTA: Em uma abordagem in vitro, estudar se a lipase de interesse pode converter uma mistura de lípidos isolados ou lipídios puros individuais ao hydrol correspondenteprodutos ysis nas condições definidas como ideal em 3.2.

  1. Utilize os esquemas de pipetagem para ensaios de enzima conforme a Tabela 3 para fosfolipase específico para PC C SMc00171 (ver 5.2), fosfolipase A (ver 5.3), e DAG lipase SMc01003 (ver 5.4) atividade.
  2. Determinação da actividade da fosfolipase C específica do PC (Tabela 3).
    1. Para um tubo de microcentrífuga de 1,5 ml, adicionar 5000 contagens por minuto (cpm) de um total de PC 14 marcado com C e uma solução de Triton X-100.
    2. Misture e seco sob uma corrente de azoto.
    3. Adicionar dietanolamina-HCl, tampão de pH 9,8, bem como NaCl e MnCl2 soluções e água bidestilada até se obter um volume final de 99,5 mL. Vortex durante 5 seg.
    4. Adicionar 0,5 uL de enzima (5 ug de proteína) (isto é, um extracto isento de células que sobre-expresso em SMc00171 está presente) para iniciar a reacção. Misture brevemente.
    5. Incubar a 30 ° C durante 4 h.
    6. Parar a reacção pelaadição de 250 ul de metanol e 125 ul de clorofórmio.
    7. Extraia lipídios como descrito anteriormente (ver 4.2).
    8. lipídios separados por unidimensionais (1D) -TLC (ver 4.3.2 e 4.4), e analisá-los por imagem PSL.
  3. Determinação da actividade da fosfolipase A (Tabela 3).
    1. Para um tubo de microcentrífuga de 1,5 ml, adicionar 5000 cpm totais de 14 fosfolípidos marcados com C e uma solução de Triton X-100.
    2. Misture e seco sob uma corrente de azoto.
    3. Para um ensaio final de 100 uL, adicionar Tris-HCl, pH 8,5, solução de NaCl e água. Vortex durante 5 seg.
    4. Adicionam-se 5 ul de enzima (50 ug de proteína) (isto é, um extracto isento de células que sobre-expresso em SMc00930 ou SMc01003 está presente).
    5. Incubar a 30 ° C durante 5 h.
    6. Parar a reacção pela adição de 250 ul de metanol e 125 ul de clorofórmio.
    7. Extraia lipídios como descrito anteriormente (ver 4.2), separadas-los por CCF-1D usando 130 ml de clorofórmio, 50 ml de metanol, e ácido acético glacial, 20 ml como a fase móvel, e analisá-las por imagiologia PSL.
  4. Determinação do diacilglicerol atividade lipase (DAG).
    1. Preparação do DAG 14 C-rotulado.
      1. Radiomarcador S. culturas meliloti (ver 4.1) e extrair os lípidos polares (ver 4.2), como descrito. S. separada meliloti extractos lipidicos totais por CCF-1D em clorofórmio: metanol: ácido acético (130: 50: 20; v / v), utilizando as condições descritas para a separação na segunda dimensão, em 4.3.1.
      2. Visualizar PC por coloração com iodo e usar um lápis para marcar a localização de fosfatidilcolina (PC).
      3. Isolar PC radiomarcado conforme descrito em 4.5.
      4. Quantificar PC extraído por contagem de cintilação.
        NOTA: cerca de 320.000 PC cpm é esperado.
      5. Tratar PC (250.000 cpm) com 0,1 U de fosfolipase C a partir de Clostridium perfringens em mM Tris-HCl, pH 7,2, 0,5 50% De Triton X-100 e 10 mM de CaCl2 durante 2 horas num volume total de 100 ul e parar a reacção pela adição de 250 ul de metanol e 125 ul de clorofórmio.
      6. Extraia lipídios, como descrito anteriormente, e separada por eles por 1D-TLC (ver 4.3.2).
      7. Isolar diacilglicerol a partir da placa de sílica e quantificação por contagem de cintilação (como descrito em 4.2)
    2. Ensaio de lipase de diacilglicerol (Tabela 3).
      1. Para um tubo de microcentrífuga de 1,5 ml, adicionar 5000 cpm de 14 DAG C-rotulado e uma solução de Triton X-100.
      2. Misture e seco sob uma corrente de azoto.
      3. Para um ensaio final de 100 uL, adicionar Tris-HCl (pH 9,0) tampão, uma solução de NaCl e água destilada duas vezes. Vortex durante 5 seg.
      4. Inicia-se a reacção por adição de 5 ul de enzima (50 ug de proteína do extracto isento de células).
      5. Incubar a 30 ° C durante 4 h.
      6. Parar a reacção pela adição de 250 ul de um metanold 125 l de lipídios clorofórmio e extrair como descrito anteriormente (ver 4.2).
      7. Analisar lípidos polares neutros por 1D-TLC (ver 4.1.3.2) e subsequente imaging PSL.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Actividade de Fosfolipase específico para PC C SMc00171 com bis-p-nitrofenil fosfato

Extractos isentos de células obtidos a partir de E. coli BL21 (DE3) pLysS x, que tinha smc00171 expressa, foram estudados quanto à sua capacidade para hidrolisar ésteres de fosfato de bis-p-nitrofenilo, utilizando um ensaio espectrofotométrico enzimático, medindo o p formado -np. Nenhuma actividade hidrolítica estava presente em extractos isentos de células obtidos a partir de E. coli BL21 (DE3) pLysS x abrigando um vector vazio pET9a (dados não mostrados) quando bis- fosfato de p-nitrofenilo foi empregado como substrato.

Cursos de tempo para o p -np formado indicam que há uma forte dependência da quantidade de extracto isento de células (de E. coli BL21 (DE3) pLysS x, que tinha SMc00171 expresso) adicionado ao ensaio (Figura 2A). Se a quantidade de produto formado p -np dependeria apenas de concentração de enzima, deve ser observada uma correlação linear entre a enzima (proteína) concentração empregada e do produto formado depois de um certo tempo. Claramente, isto não é o caso de extractos isentos de células obtidos a partir de E. coli BL21 (DE3) pLysS x, que tinha smc00171 expresso (Figura 2B). Embora possa haver diversas razões para uma dependência exponencial da actividade da enzima na concentração de proteína de 21, um motivo frequente é que após a diluição de um extracto de proteína contendo a enzima, os outros componentes do extracto que pode ser limitativo para a actividade da enzima, isto é, potenciais cofactores , são diluídos bem. Em tais casos, as actividades enzimáticas inesperadamente baixas encontram-se com os extractos livres de células diluídas. Com a inclusão de uma concentração saturante de 3 mM de MnCl2 no ensaio de enzima, a p -np Produto formado depois de um determinado período de tempo depende apenas da quantidade de enzima adicionada (dados não mostrados) indicando que MnCl2 era um componente limitante para a actividade SMc00171 em extractos livres de células de E. coli.

Figura 2
Figura 2. Determinação da actividade SMc00171 (fosfolipase) utilizando o substrato artificial bis- fosfato de p-nitrofenilo. O decurso de tempo para a formação de p -np é mostrado empregando proteínas extractos livres de células (● 10 ug / ml, 15 ug / ■ ml, ▲ 20 ug / ml) em que SMc00171 tinha sido expressa (a). p -np formadas após 40 minutos de incubação com diferentes quantidades de proteínas extractos livres de células em que tinha sido expressa SMc00171 (B). As barras de erro indicam o desvio padrão..jove.com / files / ftp_upload / 54613 / 54613fig2large.jpg "target =" _ blank "> Clique aqui para ver uma versão maior desta figura.

Atividades de patatina-like Previsto Fosfolipases SMc00930 e SMc01003 com p-nitrofenilo acila Ésteres de diferentes comprimentos de cadeia

Após expressão de smc00930 ou smc01003 em E. coli BL21 (DE3) pLysS x, extractos livres de células foram obtidos e estudados quanto à sua capacidade para hidrolisar os ésteres p-nitrofenil acilo gordos. Durante o ensaio enzimático, o p -np formada foi determinada num espectrofotómetro. Actividades hidrolíticas menores estavam presentes em extractos isentos de células obtidos a partir de E. coli BL21 (DE3) pLysS x com um vector pET17b vazia (Tabela 4) quando ésteres de p-nitrofenilo de acilo diferent comprimentos de cadeia foram empregues como substratos. Quando smc01003 foi expressa, os extractos obtidos mostraram um aumento da hidrólise de ésteres de p-nitrofenilo de diferentes comprimentos de cadeia. SMc01003 degradada a forma decanoato nitrofenilo cadeia P, bem como o de cadeia longa palmitato de p-nitrofenilo e p-nitrofenilo estearato (Tabela 4). Como SMc01003 é um dos principais contribuintes para a formação de ácidos gordos livres de cadeia longa em S. meliloti durante a fase estacionária 11, foi surpreendente que SMc01003 parecia actuar igualmente bem em forma de cadeia do que na de cadeia longa ésteres de p-nitrofenilo de acilo (Tabela 4). Inesperadamente, SMc01003 também actua sobre substratos de cadeia curta, tais como butirato de p-nitrofenilo ou o octanoato de p-nitrofenil (dados não mostrados). No entanto, estas últimas também substratos são degradadas por actividades presentes em extractos livres de células de E. coli (ou seja, abrigando o vect vaziaou pET17b) sem expressar qualquer gene adicional e com os substratos de cadeia curta (C4), metade do substrato já é degradado por E. enzimas intrínsecas coli (dados não mostrados). Claramente, SMc01003 precisa de ser purificado, a fim de clarificar se SMc01003 funciona igualmente bem em substratos de curto, médio, e de cadeia longa. Em geral, os ésteres de p-nitrofenilo de acilo não parecem ser bons substratos para SMc01003 que pode ser compreensível sabendo que SMc01003 é, na realidade, uma lipase 11 DAG. Extractos isentos de células, em que smc00930 tinha sido expressas, apresentam actividades de enzima muito mais elevadas, com ésteres de p-nitrofenilo (Tabela 4). Além disso, SMc00930 é capaz de hidrolisar os ésteres p-nitrofenil acilo de diferentes comprimentos de cadeia (C10, C12, C14, C16 e C18), apesar de p-nitrofenil palmitato (actividade específica 5,5 mmol NP min - 1 mg de proteína - 1) é claramente o melhor substrato para SMc00930. Até à data, o physiolosubstrato gico para SMc00930 não é conhecido.

Explorando se Polar Lipids pode funcionar como Substratos para lipases previsto (Fosfo)

Uma vez que o ensaio de lipase enzimática (fosfo) foi optimizado com substratos artificiais, misturas de lípidos radiomarcados ou lípidos puros podem ser testados como substratos potenciais.

Quando se examina SMc00171 contendo extratos livres de células com 14 PC marcado com C sob condições otimizadas, poderíamos mostrar que SMc00171 degrada PC para DAG, um resultado que foi confirmado por estudos de espectrometria de massa 8. SMc00171 também degrada PC 32 marcado com P para fosfocolina e, por conseguinte, actua como um específico para PC fosfolipase C (PLCP) 8, que é induzida sob condições limitantes de fósforo de crescimento.

Quandoensaiar SMc00930- ou SMc01003 contendo extractos isentos de células com 14 C- ou 32 total de lípidos polares marcado com P em condições optimizadas, podemos mostrar que nenhum dos fosfolípidos é degradado por SMc00930 SMc01003 ou sob condições em que os ésteres p-nitrofenil acilo funcionavam como substratos 11. Em contraste, uma fosfolipase comercial A2 de veneno de cobra foi capaz de degradar uma tal mistura de fosfolipidos 11. Estes resultados foram surpreendentes e inesperadas como ambos, e SMc00930 SMc01003, foram previstos para ser fosfolipases-like patatina.

Quando o ensaio SMc00930- ou SMc01003 contendo extractos isentos de células com 14 C- diacilglicerol marcado (DAG) em condições optimizadas, podemos mostrar que DAG não é degradado pela SMc00930 ou por extractos livres de células de E. coli, enquanto que SMc01003 degrada DAG e forma compostos que migram como ácidos graxos livres (Figura 3). Recentemente, poderia mostrar que SMc01003 actua como uma lipase DAG que pode degradar DAG ou monoacilglicerol para glicerol e ácidos gordos livres 11 (Figura 4).

Figura 3
Figura 3. SMc01003 degrada diacilglicerol. Extractos livres de células de E. coli BL21 (DE3) pLysS expressando × SMc01003, SMc00930 ou contendo o vector pET17b vazio, ou tampão foram incubadas com 14 C-DAG (obtido a partir de S. meliloti) durante 24 h. No final dos respectivos períodos de incubação, os lípidos radiomarcados foram extraídos e separados por CCF-1D utilizando a fase móvel para a separação de lípidos polares neutros (ver 4.3.2). FA, ácidos graxos; DAG, diacilglicerol. Esta figura foi modificado a partir de [Sahonero-Canavesi et al. 2015] 11.3large.jpg "target =" _ blank "> Clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4. enzimática função do diacilglicerol lipase DGLA (SMc01003). Diacilglicerol (DAG) lipase SMc01003 degrada DAG para monoacilglicerol e um ácido graxo e, em seguida degrada monoacilglicerol mais para glicerol e outro ácido gordo. Por favor clique aqui para ver uma versão maior desta figura.

oligonucleotídeo
nome
Seqüência
(5'-3 ')
Gene
de interesse
enzima de restrição
site acrescentou
Vetor
para a expressão
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 Ndel pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xhol pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 Ndel pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 BamHI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 Ndel pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 BamHI pET9a
Letras em negrito indicam os locais de restrição.

Tabela 1. Oligonucleótidos utilizados para amplificar e clonar previu genes fosfo (lipase) em pET17b ou pET9a vetor. Oligonucleotídeos Primer foram projetados usando o software descrito 15.

Ensaio para SMc00171 Ensaio para SMc01003 Ensaio para SMc00930
estoque Componente
Tris-HCl, pH 8,5 25 ul
2 M Tris-HCl, pH 9,0 25 ul
1 H dietanolamina-HCI, pH 9,8 50 ul
1 H NaCl 40 ul 150 ul 150 ul
1% Triton X-100 200 ul 200 ul
50 mM p-nitrofenil palmitato 12,5 ul 12,5 ul
200 mM fosfato de p- nitrofenilo bis- 2,5 ul
extrato livre de células (1 mg protein / ml) com o gene candidato expressa 20 ul 100 ul 1 ul
água bidestilada 887.5 ul 512,5 ul 611.5 ul
O volume final 1 mL 1 mL 1 mL

Tabela 2. Os regimes de pipetagem para ensaios enzimáticos otimizados com substratos de éster de nitrofenilo p artificial.

Ensaio para smc00171 codificado pelo fosfolipase C Ensaio para smc01003 - codificado DAG lipase Ensaio otimizado para fosfolipase A atividade
estoque Componente
2 M Tris-HCl pH 8,5 2,5 ul
2 M Tris-HCl pH 9,0 2,5 ul
100 mM MnCl2 3 ul
1 H Dietanolamina-HCI pH 9,8 5 ul
1 H NaCl 4 ul 15 ul 15 ul
1% Triton X-100 2 ul 20 ul 20 ul 14 lípido marcado com C (fosfolípidos) 20 ul (5.000 cpm)
14 lípido marcado com C (PC) 20 ul (5.000 cpm)
14 lípido marcado com C (DAG) 20 ul (5.000 cpm)
10 mg / ml extracto de proteína com os genes candidatos expressos 0,5 ul 5 ul 5 ul
água bidestilada 87,5 ul 77,5 ul 77,5 ul
O volume final 100 ul 100 ul 100 ul

Mesa3. Os sistemas de pipetagem para ensaios enzimáticos otimizadas para (fosfo) lipases com substratos lipídicos radioativos.

atividade é dada em unidades (mol nitrofenol / mg de proteína x min)
Os números em negrito indicam comprimento da cadeia acilo de p substrato éster de nitrofenilo 10 12 14 16 18
Extrato de E. coli (background) 16 ± 0,3 10 ± 1,1 13 ± 0,3 11 ± 0,8 10 ± 0,6
SMc00930 expressa em E. extrato coli 1.839 ± 283 2.873 ± 117 5.517 ± 394 3.402 ± 65
SMc01003 expressa em E. extrato coli 43 ± 2,1 29 ± 2 20 ± 0,7 25 ± 1,5 22 ± 0,9
SMc00930 menos fundo 1.823 ± 283 1.829 ± 283 2.860 ± 117 5.506 ± 394 3.392 ± 65
SMc01003 menos fundo 27 ± 2,1 18 ± 2 7 ± 0,7 14 ± 1,5 12 ± 0,9

Tabela ésteres nitrofenilo acil 4. P como substratos para patatina-like lipases SMc00930 e SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nos últimos 20 anos, os genomas de muitos organismos já foram seqüenciados e, apesar de uma riqueza de dados seqüência do genoma foi gerado, interpretação funcional está ficando para trás e, portanto, dificulta a nossa compreensão da função do genoma. funções dos genes em genomas são frequentemente atribuídos com base na similaridade com genes de função ou a ocorrência de motivos conservados conhecido. No entanto, a função exacta de um determinado gene, muitas vezes não é conhecido. Especialmente, previu genes estruturais para as enzimas não podem ser facilmente explorados por técnicas cas devido ao fato de que a maioria das enzimas catalisam reacções complexas que envolvem dois substratos e dois produtos. Presentemente, parece mais viável para explorar especificidades de substrato para enzimas de grupos em que pelo menos um substrato é fixo e em que o outro pode ser variada. Por exemplo, a maioria dos motivos em eucariotas fosforilação em proteínas e péptidos são conhecidos de consenso para cinases foram manchados em suportes sólidos, a fim de gerar ar peptídeoraios. Usando tais matrizes e ATP radiomarcado, especificidades de substrato e níveis distintos de cinases de um organismo actividade pode ser determinada permitindo a criação de um perfil que define kinome e especificidades de substrato 24. Hidrolases compor outro grande grupo de enzimas para as quais um substrato, de água, é fixa, mas para as quais a natureza exacta da (outras) substrato a ser hidrolisado não é conhecido. O facto de, para uma nova enzima as condições de ensaio óptimas não são conhecidos, quer, converte a detecção de uma nova actividade da enzima em um problema de multi-variável. É, por conseguinte, podem ajudar a ser capaz de fixar o substrato a ser hidrolisado, a fim de definir as condições em que a enzima funciona melhor.

No presente artigo, são apresentadas a optimização das condições de ensaio para a prospectiva (fosfo) lipases com especificidades de substrato desconhecidos e elaborar como empregar essas condições otimizadas na busca para o substrato natural da respective (fosfo) lipase. A importância da presente técnica consiste no facto de a hidrólise de substratos artificiais f luorogénicos ou cromogénicos,, que imitam substratos naturais, em certa medida, pode ser seguido por espectrofotometria 25 e que estes ensaios são facilmente aplicáveis a grande escala estuda 26. Devido à sensibilidade de tais ensaios e a sua simplicidade de controlar a reacção, que pode ser facilmente optimizada para uma dada enzima. Obviamente, para substratos artificiais que se poderia esperar constantes cinéticas menos favoráveis (ou seja, alta K M, baixo cat k) para uma enzima específica do que para substratos naturais 1,21. Na prática, no entanto, a disponibilidade fácil e detectabilidade de substratos artificiais funcionando como (mau) substratos para grupos inteiros de enzimas muitas vezes mais do que compensar as desvantagens. Depois de ter encontrado as condições para uma enzima para trabalhar (com o substrato artificial), ele irá fazê-lo com o naturai / substrato fisiológico bem. À medida que o isolamento e preparação de substratos lipídicos potenciais pode ser trabalhoso e demorado, é importante ter a certeza de que uma enzima está pronto a funcionar, quando combinando e incubando-o com os substratos valiosos. Mais importante, o processo do primeiro optimizar as condições para uma enzima de trabalhar, irá permitir a identificação mais rápida do substrato fisiológico para uma nova (fosfo) lipase. Como prova de conceito, temos empregado com sucesso este método para a caracterização das especificidades de substrato de lipases SMc00171, SMc00930 e SMc01003 8,11. Em contraste, muitas alternativas, os métodos tradicionais que estabelecem os ensaios para as actividades de (fosfo) lipase envolvem reacções onde substrato e produto são conhecidos previamente.

Obviamente, modificações de ensaios para detectar a actividade da enzima óptima pode incluir a utilização de outros fluorogénico, cromogénico, ou de outra forma artificiais substratos marcados, variaçãoda concentração de enzima, tipo e concentração de tampões ou outros aditivos (isto é, detergentes ou catiões bivalentes). Se nenhuma atividade enzimática é detectada com substratos artificiais, a respectiva enzima simplesmente não pode funcionar com este substrato, mas solução de problemas em tais casos, certamente deve incluir a ter a garantia de que todas as precauções foram tomadas que poderia ter sido necessário para manter a atividade da enzima intacta (isto é, armazenamento extractos livres de células a 4 ° C ou temperaturas mais baixas até à sua utilização e, se necessário, a adição de cocktail de inibidores de protease para extractos livres de células, a fim de evitar a degradação proteolítica da enzima de interesse) 27.

Limitações da técnica apresentada neste manuscrito são devidas ao facto de que o substrato artificial e o substrato natural são diferentes uns dos outros e em consequência a bioenergética para a reacção catalisada será assim um. Os vários nominalameters para as condições óptimas de actividade da enzima deve ser estabelecido, também para o substrato natural (por variação de pH, tipo de tampão, tampão de força, as concentrações de NaCl e detergentes tais como Triton X-100, na ausência ou na presença de diferentes catiões bivalentes), como eles podem vir a ser ligeiramente diferente das condições ótimas encontradas para o substrato artificial. Outra limitação importante é que provavelmente não todas (fosfo) lipase são detectáveis ​​pelo uso de substratos cromogénicos artificiais. Por exemplo, o resíduo p-nitrofenil artificial dos substratos de éster pode ser simplesmente demasiado volumoso, ou apresentam mais propriedades químicas que impedem que um tal substrato pode ter acesso ao sítio activo de uma enzima. Notou-se que o DAG lipase SMc01003 exibida actividades baixas com todos os substratos de éster de p-nitrofenilo de diferentes comprimentos de cadeia de 11. Com o conhecimento de que a DAG é o substrato natural para SMc01003 e DAG que tem um reltivamente pequeno grupo de cabeça polar, que consiste em glicerol apenas 11, é facilmente imaginável que o resíduo p-nitrofenilo volumoso é simplesmente grande demais para um fácil acesso ao sítio ativo da SMc01003. No entanto, os detalhes moleculares por ésteres nitrofenilo p não são bons substratos para SMc01003 não são conhecidos neste momento.

As etapas críticas no âmbito do protocolo incluem todas as disposições tomadas para garantir que a enzima estudada tem acesso ao respectivo substrato. Por exemplo, na pesquisa para o substrato lípido fisiológico, é crítico que o substrato lipídico é fornecido numa forma solubilizada. Portanto, quando da criação de tais ensaios de enzima (descrita em 5 do protocolo), substratos lipídicos, geralmente dissolvidos em misturas de metanol: clorofórmio, deve ser misturada com uma solução aquosa de um detergente, ou seja, de Triton X-100, antes de secagem para baixo -se a mistura com azoto gasoso. Este procedimento assegura que, após a adição dos restantes Ingredientes para o ensaio, o substrato lípido potencial é incorporado em micelas detergentes e, como tal, acessível para a enzima durante o ensaio.

Principalmente, a técnica apresentada aqui deve ser amplamente aplicáveis ​​no futuro para a descoberta de novos (fosfo) lipases e para a definição dos seus substratos naturais. A técnica é facilmente expansível para outras classes de hidrolases, mas pode ser mais complicado para desenvolver ensaios com substratos artificiais para novas enzimas que necessitam de dois, normalmente desconhecidos, substratos para completar seu ciclo catalítico.

Para (fosfo) lipase previsto ou fosfatases nem o substrato correcta é conhecido, nem as condições de ensaio em que a enzima funciona bem. Portanto, ele pode ser útil para estudar se algum composto de uma bateria de compostos artificiais, tais como compostos contendo nitrofenilo distinta P (fosfato de nitrofenilo p, fosfato de nitrofenilo p bis, p-nitrofenilo palmitato), pode funcionar como substrato. A descoberta de actividades enzimáticas iniciais com substratos artificiais abriu o caminho para resolver essa SMc00171 é um específico para PC fosfolipase C 8, que SMc01003 é uma lipase DAG 11, e ajudou a definir as condições em que SMc00930 atua como uma hidrolase 11. Obviamente, o substrato natural de SMc00930 é, actualmente, ainda desconhecido e os contextos fisiológicos de SMc00930 e SMc01003 estão ainda por resolver. Portanto, a tarefa de propor uma função fisiológica para uma lipase previsto é um desafio e nem sempre imediatamente reuniu-se com sucesso. Usando mutantes deficientes no gene da lipase prevista e compará-las com a respectiva cepa selvagem pode dar evidência experimental de que a lipase atua com a especificidade de seu fundo estirpe nativa que tem sido postulada na parte 4) do protocolo. Claramente, o pedido de um novo sh atividade da lipaseould ser suportado por evidência in vitro de que um determinado substrato é convertido por hidrólise em produtos definidos. Às vezes, a função fisiológica postulado pode preencher lacunas em vias metabólicas ou explicar o comportamento fisiológico do organismo produtor, mas em outros casos não há simplesmente ainda pode não ser do conhecimento bioquímico o suficiente para fazer o sentido de algumas atividades. No decurso dos nossos estudos, identificámos vários enzimas que actuam sobre os lípidos polares de membrana intrínsecas de bactérias que degradam a eles e, em alguns casos, convertendo-os em um jogador em ciclos mais complexos lipídicos. Por exemplo, combinando o novo conhecimento de que SMc00171 é um específico para PC fosfolipase C (PLCP) 8 que é induzida sob condições limitantes de fósforo de crescimento, com os dados pré-existentes, pode-se postular um novo ciclo de DAG que pode existir em muitos Proteobacteria ambiental e o que dá origem à formação de lípidos da membrana livre de fósforo quando o fósforo é limitativo do crescimento. em contrAST, quando as fontes de fósforo são abundantes, DAG é rephosphorylated ao ácido fosfatídico entrar biossíntese de novo de fosfolípido, fechando assim o ciclo de lípidos e assegurando que principalmente (glicero) fosfolípidos estão presentes na membrana de 8,28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para revelar.

Acknowledgments

Este trabalho foi financiado por doações do Consejo Nacional de Ciencias y Tecnología-México (CONACyT-México) (82614, 153998, 253549 e 178359 em Investigación Científica Básica, bem como 118 em Investigación en Fronteras de la Ciencia) e da Dirección General de Asuntos de pessoal Académico-Universidad Nacional Autónoma de México (UNAM DGAPA-; PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Definindo substrato Especificidades para a lipase e fosfolipase candidatos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter