Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Определение субстрата специфичностью для липазы и фосфолипазы кандидатов

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Микроорганизмы производят широкий спектр (фосфо) липаз, которые секретируются для того, чтобы внешние субстраты для организма. В качестве альтернативы, другие (фосфо-) липазы могут быть физически связаны с продуцирующего организма в результате чего оборот собственных липидов и часто порождая ремоделирование клеточных мембран. Хотя потенциал (фосфо-) липазы может быть предсказано с рядом алгоритмов, когда последовательность гена / белок доступен, экспериментальное доказательство активности ферментов, субстрат специфичностью, а также потенциальных физиологических функций часто не было получено. Эта рукопись описывает оптимизацию условий анализа для потенциальных (фосфо) липазы с неизвестными подложки и специфичностью, как использовать эти оптимизированные условия в поисках природного субстрата соответствующего (фосфо) липазы. Использование искусственных хромогенных субстратов, таких как производные р - нитрофенил, может помочь обнаружить незначительныеферментативная активность для предсказанного (фосфо) липазы в стандартных условиях. Столкнувшись такую ​​незначительную ферментативную активность, особые параметры твердофазного иммуноферментного анализа фермента можно варьировать, чтобы получить более эффективный гидролиз искусственном субстрате. После определения условий, при которых фермент работает хорошо, разнообразие возможных природных субстратов должны быть исследованы на их деградации, процесс, который может сопровождаться использованием различных хроматографических методов. Определение субстратной специфичности в отношении новых ферментов, часто дает гипотезы для потенциальной физиологической роли этих ферментов, которые затем могут быть проверены экспериментально. Следуя этим рекомендациям, мы смогли идентифицировать фосфолипазу С (SMc00171) , который унижает фосфатидилхолин к фосфохолин и диацилглицерол, на решающем этапе для ремоделирования мембран в бактерии Sinorhizobium meliloti при фосфорных ограничивающими условиях роста. Для двух предсказывал patatin-как фосфолипаз (SMc00930 и SMc01003) одного и того же организма, мы могли бы пересмотреть свои субстратную специфичность и уточнить, что SMc01003 является диацилглицеринацилтрансферазы липазы.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Глицерин на основе липидов , такие как триацилглицеринов и (глицеро) фосфолипиды являются важными и , вероятно , наиболее известные классы липидные 1. Триацилглицерины (БИРКАХ) являются жиры или масла, которые обычно функционируют как липиды хранения, и, следовательно, в качестве потенциальных энергетических и углеродных источников. ДВТ может быть понижена липазы, которые часто выделяемыми продуцирующего организма переваривать внешних бирками и сделать их доступными в качестве источников углерода. Кроме того , липазы широко изучались на протяжении многих лет из - за их важных биотехнологического применения 2.

Из - за их амфифильного характера и их почти цилиндрическое форме (глицеро) фосфолипиды экспоната мембранообразующих свойств и , как правило , представляют собой основные липидные компоненты двухслойных мембраны 3. В простых микроорганизмов, таких как бактерии кишечной палочки, только три основных варианта головной группы, фосфатидилглицерина (PG), кардиолипину (CL), и phosphatidylethanolamine (PE) встречаются, хотя следует иметь в виду , что каждый из них может быть заменен с большим количеством различных жирных ацильных цепей в зп -1 или -2 зп ситуация , вызвавшая большое количество различных видов молекул ; 4 , Другие бактерии могут иметь другие фосфолипиды в дополнение или вместо. Например, Sinorhizobium meliloti, бактерия почвы, которая способна образовывать азотфиксирующую клубеньковых симбиозе с бобовой люцерны (Medicago сатива), содержит в дополнение к РЕ а второй цвиттерионная фосфолипид, фосфатидилхолин (PC) 5. Кроме того, липиды, не содержащие фосфор или глицерин могут быть амфифильными и являются составной частью клеточной мембраны. Например, при условиях роста фосфором ограничения, в S. meliloti, (глицеро) фосфолипиды в значительной степени заменены мембранными липидами , которые не содержат фосфор, то есть, сульфолипидов, орнитин липиды, и diacylglyceryl trimethylhomoserine (DGTS) 6. У бактерий DGTS образуется из диацилглицерина (DAG) в двухступенчатом пути 7 , но источник для генерации DAG не было понятно. Пульс-чейз эксперименты показали, что ПК может быть предшественником для DGTS 8 и с использованием методики , описанной в этой рукописи мы могли идентифицировать фосфолипазу С (PLCP, SMc00171) , который формируется под фосфорных ограничивающими условиями и который может преобразовать ПК в DAG и фосфохолина 8.

В отдельном исследовании, мы обнаружили , что ацил-КоА - синтетазы (Fadd) дефицитных мутант S. meliloti или кишечной палочки накопила свободных жирных кислот при входе в стационарной фазе роста 9. Хотя эти жирные кислоты, казалось, быть получены из мембранных липидов, точный источник свободных жирных кислот или фермента (ов), что их высвобождают не были известны. Опять же , применяя стратегию , изложенную в этой рукописи, два пататина типа 10 (фосфо-) липазы (SMc00930 и SMc01003) , что способствовало образованию свободных жирных кислот в S. meliloti 11 были предсказаны. Удивительно, но SMc01003 использовали DAG в качестве субстрата , преобразовав его в monoacylglycerol и , наконец , глицерин и свободные жирные кислоты 11. Поэтому SMc01003 является липаза DAG (DGLA).

Хотя ряд алгоритмов существуют для прогнозирования потенциального (фосфо) липазы 12,13, их точная функция и физиологическая роль, как правило , не известно. Здесь мы приводим протокол, клонировать и гиперэкспрессией предсказанных или потенциальных (фосфо) липазы. Эта рукопись объясняет, как анализы ферментов могут быть разработаны и оптимизированы для суперэкспрессированный (фосфо) липазы с использованием искусственных хромогенных субстратов. Мы приводим примеры, как с оптимизированной ферментного анализа реальной (фосфо) липаза субстрат можно встретить и каким образом эти результаты могут обогатить наше понимание микробной физиологии.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Клонирование и гиперэкспрессией структурный ген для предсказанной липазы

  1. С помощью полимеразной цепной реакции (ПЦР) 14 и специфических олигонуклеотидов (таблица 1) 15, усиливают интерес ген (smc01003, smc00930 или smc00171), согласно прогнозам, кодировать липазы или фосфолипазы, из геномной ДНК организма - хозяина (т.е. , С. meliloti).
    1. Введем специфические сайты рестрикции (запланированной последовательности олигонуклеотидов). Дайджест амплифицированного ДНК - фрагмента с соответствующими ферментами рестрикции , и клонировать его в вектор экспрессии , такой как плазмид серии рЕТ 16.
    2. После проверки правильности последовательности ДНК клонированного гена, преобразование вектора к экспрессии , такой как штамм кишечной палочки BL21 (DE3) pLysS 16.
  2. Приготовьте накануне вечером предварительной культуры экспрессии хозяина E. палочки BL21 (DE3) рлYss, несущее соответствующий рЕТ вектор с клонированного гена или пустым вектором, в 100 мл колбах с культурой , содержащей 20 мл бульона Лурии Бертани (LB) 17 плюс необходимые антибиотики. Культуры клеток при 30 ° С (или при обычной температуре роста бактерии , из которой липаза берет свое начало).
    1. Использование ночных предварительных культур, инокуляции 500 мл среды LB подогретую (плюс необходимые антибиотики) в 2 л колбы с культурой , чтобы получить начальную оптическую плотность при длине волны 620 нм (OD 620) = 0,05. Последующие рост культур и при OD 620 = 0,3, добавляют изопропил-бета-D-тиогалактозида (IPTG) до конечной концентрации 100 мкМ, и инкубировать при перемешивании при 30 ° С в течение 4 часов.
    2. В конце инкубационного периода, передают каждую культуру в центрифужную пробирку емкостью 500 мл и центрифуге при 5000 мкг при 4 ° С в течение 30 мин. Ресуспендируют бактериальных гранул клеток в 5 мл суспензионного буфера (например, SMc00930- и SMc01003-экспрессирующих клеток в 50 мМ Трис-HCl, рН 8,0, и SMc00171-экспрессирующих клеток в 50 мМ диэтаноламин-HCl, рН 9,8). Хранить клеточные суспензии при -80 ° С до использования.

2. Подготовить бесклеточной экстракты белка и Определение концентрации белка

  1. Размораживание бактериальных клеточных суспензий и хранить на льду. Pass клеточные суспензии трижды через ячейку холодного давления при 20000 фунтов на в 2. Удалить интактных клеток и клеточного дебриса центрифугированием при 5000 х г в течение 30 мин при температуре 4 ° С.
  2. После центрифугирования готовят аликвоты 100 и 500 мкл из надосадочной жидкости для последующего анализа и хранить их при температуре -80 ° С до использования.
  3. С помощью одного из 100 мкл аликвоты для определения концентрации белка в различных бесклеточных экстрактов методом выбора или , как описано 18.

3. С помощью искусственных субстратах для оптимизации ЭнзимДеятельность (фосфо) липазы

  1. Для начального охвата различных ферментативных активностей, используют искусственные субстраты , которые дают окрашенный продукт при гидролизе, например, р -nitrophenol (р) -np.
    1. Для получения ферментных анализов уже оптимизированы с искусственными подложками р - нитрофенил сложный эфир (намеченные для фосфолипазу С PLCP (SMc00171), а также для предсказанных пататина типа фосфолипаз SMc00930 и SMc01003), использование схемы пипетирующие описаны в таблице 2.
    2. При изучении нового потенциала (фосфо) липазу, подготовить первый стандартного ферментного анализа , содержащего 50 мМ Трис-HCl, рН 8,5, 100 мМ NaCl, 0,05% Triton X-100, 0,5 мМ п - нитрофенил-содержащего соединения - нитрофенил фосфата , бис- р - нитрофенил фосфата, р - нитрофенил деканоат, или р - нитрофенил - пальмитат) и белковый экстракт без клеток (проверка 1, 3, 10, 30, 100, 300, и 1000 мкг) в общем объеме 1 мл в 1 мл пластиковые CUVEttes.
      Примечание: Используйте щелочной рН (Рисунок 1) , когда после гидролиза сложного эфира п - нитрофенил в непрерывном анализе. В качестве альтернативы, использовать одинарные анализы отсчете для диапазона значений рН, добавление NaOH в конце инкубационного периода , чтобы прекратить реакцию фермента , и , чтобы гарантировать , что во всех случаях р -np присутствует в виде фенолята.
    3. Выполните изменение во времени для увеличения поглощения при 405 нм, в связи с формированием р -np, в спектрофотометре при 30 ° С в течение 5 мин. Количественная первоначально линейное формирование р -np путем определения начальный наклон увеличения оптической плотности в единицу времени.
    4. Вычислить изменение концентрации ( & delta ; C) при р -np используя закон Ламберта-Бера (ΔA = ε & delta ; C d) 1.
      Примечание: ΔA является линейное изменение оптической плотности определяется, ε является молярный коэффициент поглощения при соответствующей длине волны (в единицах М -1 -1), d является длина светового пути (1 см), и является delta ; C изменение концентрации (в единицах М) , которые будут определены.
      1. Учитывая , что объем пробы составляет 1 мл, рассчитать количество р -np сформированную.
        Примечание: Сумма = концентрация х объем.
      2. Рассчитывают активность фермента путем деления количества р -np образованного к тому времени , в котором она формируется. Определить удельную активность фермента путем деления активности фермента на количество белка (в мг), который отвечает за формирование этой деятельности.
    5. Сравните изменения оптической плотности , спровоцированные белковых экстрактов , в которых были высказаны кандидатом гена (smc00171, smc00930 или smc01003) с экстрактами , которые укрывают только пустой вектор.
      Примечание: Для того, чтобы продолжить следующие шаги, конкретные виды деятельности, вызванные белковых экстрактов, в которых был высказан ген-кандидат, должен быть по крайней мере в два раза или мруды, чем значения, полученные для конкретных видов деятельности, вызванных белковых экстрактов, которые укрывают только пустой вектор.
    6. Для дальнейших экспериментов, выбрать те условия , в которых гидролиз р нитрофенил соединение представляет собой минимально с бесклеточных экстрактов (т.е. пустой вектор) и для которых наиболее выраженное образование р -np и р -nitrophenolate анион (рис 1) можно наблюдать , когда белковые экстракты используются, в которых был высказан ген - кандидат.
  2. После определения активности первоначального фермента в 3.1, оптимизации условий анализа для соответствующего фермента путем изменения рН, тип буфера, буферной силы, концентрации NaCl, детергенты, такие как Тритон Х-100, а также отсутствие или присутствие различных двухвалентных катионов.
    1. Для различных концентраций каждой переменной, определяют удельную активность фермента (см 3.1.4.2) (наибольшее число получено определяет условиеактивности фермента максимальной). Используйте сочетание оптимальных условий, возникающих для каждой переменной, чтобы определить оптимальную ферментного анализа, в котором каждая переменная присутствует в оптимальной концентрации.

Рисунок 1
После гидролиза сложных эфиров п - нитрофенил, образуются Рисунок 1. р - нитрофенил эфиры в качестве искусственных субстратов для (фосфо) липазы в спектрофотометрического анализа. Кислотное (R-OH) и р -nitrophenol -np). В связи с рК а = 7.2 для диссоциации фенольного Н + от р -np, при рН> 9,2 более 99% находятся в ярко - желтой форме р -nitrophenolate и молярного коэффициента экстинкции 18,000 М -1 см - 1 может быть использован при длине волны 405 нм для количественного определения свободного р -nitrophenolate 22. Когда были использованы буферы с рН 8,5, оптическая плотность определяли при 400 нм и молярным коэффициентом экстинкции 14500 М -1 см -1 был использован 23. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Примечание: После того, как были определены оптимальные условия для активности фермента интерес, приступить к поискам реальной / физиологической субстрат этой липазы. В принципе, взять два, часто дополняют друг друга, подходы к достижению этой цели, в естественных условиях подход или подход в лабораторных условиях .

4. В естественных условиях Идентификация физиологического субстрата липазы

ove_content "> . Примечание: В подходе в естественных условиях, выражают липазы интерес в организме хозяина 8,11 для того , чтобы зарегистрировать в течение долгого времени , изменяет ли выражение липазы профиль host's липидный В другом подходе в естественных условиях, генерировать мутант , дефицитный представляющего интерес гена 8,11 и изучить ли ее липидный профиль отличается от дикого типа версии 6,8,11. для того , чтобы получить количественную оценку профиля липидов организма, простой способ состоит в радиоактивной клеточных соединений , извлечение липидов, отделяя их с помощью хроматографии, и количественной оценки радиоактивно меченных отделенных липиды.

  1. Радиоактивной липидов.
    1. Готовят на ночь предварительной культуры организма интерес (E.coli или S. meliloti) в 5 мл желаемой культуральной среды (комплекс среднего или определенный минимальный средний) и расти при 30 ° С.
    2. Из предварительной культуры, прививают в 20 мл самне свежую среду в колбе для культивирования емкостью 100 мл для получения начальной OD 620 = 0,3 для культуры.
    3. Берут аликвоту (1 мл) культуры в стерильных условиях и переносят в 14 мл стерильного полистирола с круглым дном трубки.
    4. Добавляют 1 мкКи [1- 14 С] ацетата (60 мКи на ммоль) в 1 мл культуры.
    5. Выдержите в жидкой культуре при перемешивании при 30 ° С в течение 24 часов.
    6. В конце инкубационного периода, передать культуру в микроцентрифужных трубки 1,5 мл и центрифугируют при 12000 х г при комнатной температуре в течение 5 мин.
    7. Ресуспендируют осадок в 100 мкл воды. На данный момент, хранить суспензии клеток при -20 ° С или сразу же продолжать с извлечением полярных липидов (раздел 4.2).
  2. Добыча полярных липидов.
    Примечание: Метод , описанный здесь , по существу , следует процедуре , описанной на Блай и Дайер 19.
    1. К 100 мкл водного клеток SUSPension, добавить 375 мкл метанола в хлороформе раствор (2: 1; об / об).
    2. Вихревые в течение 30 сек и инкубировать в течение 5 мин при комнатной температуре.
    3. Центрифуга 5 мин при 12000 х г при комнатной температуре.
    4. Передача супернатант в новую 1,5 мл микроцентрифужных трубки.
    5. Добавить 125 мкл хлороформа и 125 мкл воды, вихревые 30 сек.
    6. Центрифуга 1 мин при 12000 х г при комнатной температуре.
    7. Перенести Нижнюю фазу хлороформа в чистую пробирку и сухой с потоком газообразного азота.
    8. Растворение высушенных липидов в 100 мкл смеси хлороформ: метанол (раствор 1: 1; об / об).
      Примечание: В этот момент аликвоту 5 мкл раствора липида может быть определена количественно с помощью жидкостного сцинтилляционного счетчика.
    9. Для анализа тонкослойной хроматографии (ТСХ), сухой вниз оставшиеся 95 мкл с потоком газообразного азота и растворяться высушенные липиды в 20 мкл смеси хлороформ: метанол (раствор 1: 1; объем / объем). Используйте 3 мкл аликвотыдля ТСХ-анализа.
  3. Разделение полярных липидов с помощью тонкослойной хроматографии (ТСХ).
    Примечание: В зависимости от классов липидов, которые будут проанализированы различные комбинации твердых и подвижных фаз могут быть использованы для разделения. Здесь типичное разделение для заряженных полярных липидов и другой, больше подходит для нейтральных полярных липидов, с использованием высокоэффективной тонкослойной хроматографии (ВЭТСХ) силикагель алюминиевых листов в качестве твердой фазы, изложены.
    1. Разделение заряженных полярных липидов двумерными ТСХ (2D-ТСХ).
      1. Нанесите 3 мкл аликвоты липидного образца в одном углу геля алюминиевого листа ВЭТСХ с силикагелем (10 х 10 см), 2 см от края пластины.
      2. Подготовьте и смешайте подвижной фазы (140 мл хлороформа, 60 мл метанола и 10 мл воды) для разделения в первом измерении.
      3. Покройте ТСХ разработки камеры с внутренней стороны хроматографической бумаги.
        Примечание: Это должно гарантировать, что газовая фаза из камерыбудет быстро насыщается (в течение 30 мин) после того, как подвижной фазы для первого измерение было добавлено в камеру и камера была закрыта со стеклянной пластиной.
      4. Подготовьте и смешайте подвижной фазы (130 мл хлороформа, 50 мл метанола и 20 мл ледяной уксусной кислоты) для разделения во втором измерении и передаче второй TLC развивающейся камере внутри покрытую хроматографическую бумагу, и пусть камеру насыщают.
      5. Тщательно передачи гель алюминиевый лист ВЭТСХ кремнезем с высушенного образца липида в первой камере и развивать (т.е. выполнять хроматографии) пластины в течение 60 мин в закрытой камере в первом измерении 5.
      6. Удалите пластину из камеры и дайте обсохнуть растворителей в капюшоне потока в течение 30 мин.
      7. После поворота пластины на 90 градусов по отношению к предыдущей хроматографии, перенесите силикагель алюминиевый лист HPTLC, на которых липиды были разделены в одном измерении, в SECONd камера и развивать пластины в течение 60 мин во втором измерении 5.
      8. Извлеките лист из камеры и дать растворителю высохнуть в ламинарном проточном в течение по меньшей мере 2 ч.
    2. Разделение нейтральных полярных липидов.
      1. Нанесите 3 мкл аликвоты образцов липида на гель алюминиевого листа ВЭТСХ кремнезема начиная 2 см от края пластины. Если несколько образцов анализируются в одномерной хроматографии, держать на расстоянии не менее 1,5 см между различными пятнами приложения.
      2. Подготовьте и смешайте подвижной фазы (140 мл гексана, 60 мл диэтилового эфира и 8 мл уксусной кислоты) и переноса в развивающейся камере ТСХ внутренне покрытые хроматографическую бумагу и покрытые стеклянной пластиной, чтобы позволить камерную насыщают (30 мин).
      3. Перенести силикагель алюминиевый лист HPTLC с высушенными образцами липидов в камеру и развивать пластины в течение 30 мин в закрытой камере.
      4. Удалите пластину из камерыи дать растворителю высохнуть в ламинарном проточном в течение 2 часов.
  4. Количественное и визуализация разделенных полярных липидов.
    1. После того, как разработанный ТСХ лист высохнет, инкубировать ее с экраном photostimulable люминесценцию (PSL) в закрытой кассете в течение 3-х дней.
    2. Expose инкубированных экран сканера PSL и приобрести виртуальный образ разделенных меченных липидов.
    3. Выполнение количественной оценки с использованием PSL программного обеспечения 20.
  5. Визуализация и выделение отдельных классов полярных липидов.
    1. Выдержите развитую ТСХ-лист в течение 10 мин в камере хроматографии в присутствии 1 г кристаллов йода.
      Примечание: Отдельно липидные соединения растворяет йод и появляются в виде коричневатых пятен.
    2. Круг пятна с карандашом, сравнить их относительной подвижности (R е) стандартных соединений (т.е. 1,2-dipalmitoyl- зп -глицерол, дипалмитоил-L-альфа-фосphatidylcholine, DL-α-monopalmitin, или пальмитиновой кислоты), а также определить, к которым липид класс они могут принадлежать.
    3. В вытяжном шкафу, пусть йод испаряется из листа ТСХ.
    4. С помощью шпателя, скрести силикагель, содержащий соединение, интерес со стороны листа, и извлечь соединение из силикагеля со смесью 100 мкл воды и 375 мкл метанола: раствор хлороформа (2: 1; ИЗД / об).
    5. Продолжить с извлечением согласно Блай и Дайер, как описано (4.2.2 и выше).
    6. Хранить очищенный класс липидов в 100 мкл хлороформа: метанола раствор (1: 1; объем / объем) при температуре от -20 ° С до использования.

5. In Vitro Идентификация физиологического субстрата липазы

Примечание: В подходе в пробирке, изучать ли липаза интерес может преобразовывать смесь отдельных липидов или отдельных чистых липидов к соответствующему HYDROLлиза продуктов в условиях, определенных в качестве оптимальной в 3.2.

  1. Используйте схемы пипетирования для анализов фермента согласно таблице 3 для PC конкретных фосфолипазы C SMc00171 (см 5.2), фосфолипазы А (см 5.3), и DAG липазы SMc01003 (см 5.4) активность.
  2. Определение фосфолипазы C активности PC специфические (Таблица 3).
    1. К 1,5 мл трубки микроцентрифужных, добавить 5000 импульсов в минуту (СРМ) из общего 14 С-меченого PC и раствор Тритона Х-100.
    2. Смешать и сушат в токе азота.
    3. Добавить диэтаноламин-HCl, рН 9,8 буфера, а также NaCl и MnCl 2 растворов и бидистиллированной воды для получения конечного объема 99,5 мкл. Vortex в течение 5 сек.
    4. Добавить 0,5 мкл фермента (5 мкг белка) (то есть, свободный от клеток экстракт , в котором избыточно экспрессируется SMc00171 присутствует) , чтобы инициировать реакцию. Кратко перемешать.
    5. Инкубируют при 30 ° С в течение 4 часов.
    6. Остановить реакцию с помощьюдобавление 250 мкл метанола и 125 мкл хлороформа.
    7. Экстракт липидов, как было описано ранее (см 4.2).
    8. Отдельные липиды одномерными (1D) -TLC (см 4.3.2 и 4.4), и анализировать их с помощью визуализации PSL.
  3. Определение активности фосфолипазы А (таблица 3).
    1. К 1,5 мл трубки микроцентрифужных, добавить 5000 СРМ всего 14 С-меченых фосфолипидов и раствор Triton X-100.
    2. Смешать и сушат в токе азота.
    3. Для окончательного анализа 100 мкл, добавляют Трис-HCl, рН 8,5, буфер раствором поваренной соли и воды. Vortex в течение 5 сек.
    4. Добавьте 5 мкл фермента (50 мкг белка) (то есть, свободный от клеток экстракт , в котором избыточно экспрессируется SMc00930 или SMc01003 присутствует).
    5. Инкубируют при 30 ° С в течение 5 часов.
    6. Остановить реакцию добавлением 250 мкл метанола и 125 мкл хлороформа.
    7. Экстракт липидов, как описано ранее (см 4.2), отдельныеих с помощью 1D-ТСХ с использованием 130 мл хлороформа, 50 мл метанола и 20 мл ледяной уксусной кислоты в качестве подвижной фазы, и анализировать их с помощью визуализации PSL.
  4. Определение диацилглицеринацилтрансферазы (DAG) активность липазы.
    1. Получение 14 С-меченного DAG.
      1. Радиоактивной С. meliloti культуры (см 4.1) и извлечь полярные липиды (см 4.2) , как описано. Отдельный S. meliloti Всего экстракты липидов по 1D-TLC в хлороформ: метанол: уксусная кислота (130: 50: 20; об / об) с использованием условий , описанных для разделения во втором измерении в 4.3.1.
      2. Визуализируйте PC йодом окрашивания и использовать карандаш, чтобы отметить локализацию фосфатидилхолин (PC).
      3. Изолировать радиоактивно ПК, как описано в 4.5.
      4. Количественно, извлеченной ПК с помощью сцинтилляционного счетчика.
        Примечание: О 320000 имп PC ожидается.
      5. Treat PC (250000 СРМ) с 0,1 U фосфолипазы С из Clostridium перфрингенс в 50 мМ Трис-HCl, рН 7,2, 0,5% Тритона Х-100 и 10 мМ CaCl 2 в течение 2 часов в общем объеме 100 мкл , и реакцию останавливают добавлением 250 мкл метанола и 125 мкл хлороформа.
      6. Экстракт липидов, как описано выше и отдельно от них 1D-ТСХ (см 4.3.2).
      7. Изолировать диацилглицерина из диоксида кремния пластины и количественно с помощью сцинтилляционного счетчика (как описано в разделе 4.2)
    2. Анализ липазы диацилглицеринацилтрансферазы (таблица 3).
      1. К 1,5 мл трубки микроцентрифужных, добавить 5000 КПМ 14 С-меченного DAG и раствор Triton X-100.
      2. Смешать и сушат в токе азота.
      3. Для окончательного анализа 100 мкл, добавляют Трис-HCl (рН 9,0), буфер, раствором хлорида натри и дважды дистиллированной воды. Vortex в течение 5 сек.
      4. Инициировать реакцию добавлением 5 мкл фермента (50 мкг белка клеточного экстракта бесплатно).
      5. Инкубируют при 30 ° С в течение 4 часов.
      6. Остановить реакцию добавлением 250 мкл метанола А.Н.D 125 мкл хлороформа и экстракт липидов, как было описано ранее (см 4.2).
      7. Анализировать нейтральные полярные липиды от 1D-TLC (см 4.1.3.2) и последующего PSL визуализации.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Активность PC конкретных фосфолипазы C SMc00171 с Бис р нитрофенил фосфатом

Бесклеточные экстракты , полученные из E. палочка BL21 (DE3) pLysS х, у которого было smc00171 выражены, были изучены на предмет их способности гидролизовать бис- р - нитрофенил эфиры фосфорной кислоты, с использованием спектрофотометрического анализа ферментативной, измеряя р -np сформированную. Ни один гидролитическая активность не присутствовал в бесклеточных экстрактах , полученных из Е. палочка BL21 (DE3) pLysS х укрывает пустой вектор pET9a (данные не показаны) , когда Бис р - нитрофенил фосфата использовали в качестве субстрата.

Временные кривые р -np сформированной показывают , что существует сильная зависимость от количества экстракта бесклеточной (из E.coli BL21 (DE3) х pLysS, имевшая смc00171 выражены) добавляли к пробе (фиг.2А). Если количество р -np продукта , образуемого будет зависеть только от концентрации фермента, должна наблюдаться линейная зависимость между ферментом (белком) концентрация занятых и продукт , полученный по истечении определенного времени. Ясно, что это не так для бесклеточных экстрактов , полученных из E. палочка BL21 (DE3) х pLysS, который smc00171 выраженную (рис 2B). Несмотря на то, что может быть несколько причин для экспоненциальной зависимости активности фермента от концентрации белка 21, частая причина заключается в том , что при разбавлении фермента экстракта , содержащего белок, другие компоненты экстракта , которые могут быть предельными для ферментативной активности, то есть потенциальных кофакторов , разводят также. В таких случаях, неожиданно низкой активности ферментов регистрируются разбавленными бесклеточных экстрактах. Включением концентрацию насыщающего не менее 3 мм MnCl 2 в ферментном анализе, р -np Продукт формируется после того, как определенное время зависит только от количества добавленного фермента (данные не показаны) , указывающие , что MnCl 2 была лимитирующим компонентом для активности SMc00171 в бесклеточных экстрактах Е. палочки.

фигура 2
Рисунок 2. Определение SMc00171 (фосфолипазы) деятельности с использованием искусственного субстрата бис- р - нитрофенил фосфата. Временной ход для формирования р -np, показана с использованием бесклеточных экстрактов белков (● 10 мкг / мл, ■ 15 мкг / мл, ▲ 20 мкг / мл) , в котором была выражена SMc00171 (А). р -np сформированную после 40 мин инкубации с различными количествами бесклеточных экстрактов белков , в которых были высказаны SMc00171 (в). Столбики ошибок указывают стандартное отклонение..jove.com / файлы / ftp_upload / 54613 / 54613fig2large.jpg "целевых =" _blank "> Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Деятельность Прогнозируемая пататина типа Фосфолипазы SMc00930 и SMc01003 с р нитрофенил ацил Эфиры различных длиной цепи

После экспрессии smc00930 или smc01003 в E. палочка BL21 (DE3) pLysS х, свободные от клеток экстракты были получены и изучены на предмет их способности гидролизовать р - нитрофенил жирных ацильных эфиров. В ходе ферментативного анализа, р -np образована определяли в спектрофотометре. Незначительные гидролитические мероприятия присутствовали в бесклеточных экстрактов , полученных из E. палочка BL21 (DE3) pLysS х с пустым вектором pET17b (таблица 4) , когда р - нитрофенил ацильных эфиров differeдлины нт цепи были использованы в качестве субстратов. Когда smc01003 выразилась, экстракты , полученные показали повышенный гидролиз р нитрофенил эфиров с различной длиной цепи. SMc01003 ухудшило со средней длиной цепи р нитрофенил деканоат, а также с длинной цепью р нитрофенил пальмитата и р стеарат нитрофенил (таблица 4). Как SMc01003 является основным фактором для формирования длинной цепью свободных жирных кислот в S. meliloti во время стационарной фазы 11, было удивительно , что SMc01003 казалось действовать одинаково хорошо на средней цепи , чем на длинной цепью р - нитрофенил ацильных эфиров (таблица 4). Неожиданно было обнаружено, SMc01003 также действует на короткоцепочечных субстратов , таких как п - нитрофенил бутират или р - нитрофенил октановой (данные не показаны). Тем не менее, эти последние субстраты также ухудшены в результате деятельности , присутствующих в бесклеточных экстрактах Е. палочки (то есть, укрывательство пустой Vectили pET17b) без выражения каких - либо дополнительных гена и с короткой цепью субстратов (C4), половина субстрата уже понижена Е. палочки собственные ферменты (данные не показаны). Очевидно, что SMc01003 должен быть очищен для того, чтобы выяснить, работает ли SMc01003 одинаково хорошо на кратко-, средне- и длинноцепочечных субстратов. В общем, р - нитрофенил ацильные сложные эфиры , кажется , не быть хорошими субстратами для SMc01003 , которые можно было бы понять , зная , что SMc01003 в действительности липазы DAG 11. Бесклеточные экстракты, в которых были высказаны smc00930, показывают значительно более высокие активности ферментов с р - нитрофенил эфиров (таблица 4). Кроме того , SMc00930 способен гидролизовать р нитрофенил ацильных эфиров с различной длиной цепи (С10, С12, С14, С16 и С18), хотя р нитрофенил пальмитат (удельная активность 5,5 ммоль NP мин - 1 мг белка - 1) явно лучший субстрат для SMc00930. На сегодняшний день physioloгическое субстрат для SMc00930 не известно.

Изучение идёт ли речь полярным липидам может функционировать как субстраты для прогнозируемыми (фосфо) липазы

После того, как (фосфо) анализа липазы ферментативный оптимизировано с искусственными подложками, радиоактивно меченных липидных смесей или чистых липидов могут быть испытаны в качестве потенциальных субстратов.

Когда опробование SMc00171 содержащих бесклеточных экстрактов с 14 С-меченого ПК при оптимальных условиях, мы могли бы показать , что SMc00171 деградирует ПК для обеспечения доступности баз данных, в результате чего было подтверждено исследованиями масс - спектрометрических 8. SMc00171 также деградирует 32 P-меченых ПК к фосфохолин и , следовательно , действует как PC-специфический фосфолипазы С (PLCP) 8, который индуцируется под фосфорными ограничивающими условиями роста.

когдаопробование SMc00930- или SMc01003 содержащих бесклеточных экстрактов с 14 C- или 32 Р-меченного общего количества полярных липидов в оптимальных условиях, мы могли бы показать , что ни один из фосфолипидов не разрушается под действием SMc00930 или SMc01003 в условиях , где функционировали р - нитрофенил ацильных эфиров в качестве подложек 11. В отличие от этого , коммерческий фосфолипазы А 2 из змеиного яда был в состоянии деградировать такую смесь фосфолипидов 11. Эти результаты были удивительными и неожиданными, как и, SMc00930 и SMc01003, было предсказано, чтобы быть пататина-как фосфолипаз.

Когда опробование SMc00930- или SMc01003 содержащих бесклеточных экстрактов с 14 C- меченого диацилглицерина (DAG) в оптимальных условиях, мы могли бы показать , что DAG не разлагаются SMc00930 либо бесклеточных экстрактов E. палочка, в то время как SMc01003 деградирует DAG и образует соединения , которые мигрируют как свободные жирные кислоты (рис 3). Недавно мы могли бы показать , что SMc01003 действует как липаза DAG , которые могут ухудшать DAG или monoacylglycerol до глицерина и свободных жирных кислот 11 (рисунок 4).

Рисунок 3
Рисунок 3. SMc01003 деградирует диацилглицерол. Бесклеточные экстракты E. палочка BL21 (DE3) × pLysS выражающий SMc01003, SMc00930 или содержащий пустой вектор pET17b, или буфер, инкубировали с 14 С-DAG (полученной из S. meliloti) в течение 24 часов. В конце соответствующих периодов инкубации радиоактивно меченные липиды экстрагировали и разделенные 1D-ТСХ с использованием подвижной фазы для разделения нейтральных полярных липидов (см 4.3.2). ФА, жирные кислоты; DAG, диацилглицеринацилтрансферазы. Эта цифра была изменена с [Sahonero-Canavesi и др. 2015] 11.3large.jpg "целевых =" _blank "> Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 4
Рисунок 4. Ферментативная функция диацилглицеринацилтрансферазы липазы DGLA (SMc01003). Диацилглицеринацилтрансферазы (DAG) липаза SMc01003 деградирует DAG к monoacylglycerol и одной жирной кислоты, а затем деградирует monoacylglycerol далее глицерин и другой жирной кислоты. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этого цифра.

Олигонуклеотид
имя
Последовательность
(5'-3 ')
Ген
представляет интерес
Фермент рестрикции
добавлен сайт
Вектор
для выражения
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 Nde I pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xho I pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 Nde I pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 Bam HI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 Nde I pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 Bam HI pET9a
Буквы, выделенные жирным шрифтом указывают на сайты рестрикции.

Таблица 1. Олигонуклеотиды , используемые для амплификации и клон предсказывал фосфо (липаза) генов в pET17b или pET9a вектора. Грунтовка олигонуклеотиды были разработаны с использованием описанного программного обеспечения 15.

Анализ на SMc00171 Анализ на SMc01003 Анализ на SMc00930
Акции Компонент
Трис-HCl, рН 8,5 25 мкл
2 М Трис-HCl, рН 9,0 25 мкл
1 М диэтаноламин-HCl, рН 9,8 50 мкл
1 М NaCl 40 мкл 150 мкл 150 мкл
1% Тритон Х-100 200 мкл 200 мкл
50 мМ п - нитрофенил пальмитат 12.5 мкл 12.5 мкл
200 мМ бис p- нитрофенилфосфат 2,5 мкл
клеток экстракт (1 мг PROTEIн / мл) с ген-кандидат выразил 20 мкл 100 мкл 1 мкл
бидистиллированная вода 887,5 мкл 512.5 мкл 611,5 мкл
Окончательный объем 1 мл 1 мл 1 мл

Таблица 2. Схемы пипетирования для оптимизированных ферментативных анализов с искусственными р подложках нитрофенил сложный эфир.

Анализ на smc00171 закодирована фосфолипазы C Анализ на smc01003 - зашифрованное DAG липазы Оптимизированный для анализа активности фосфолипазы
Акции Компонент
2 М Трис-HCl, рН 8,5 2,5 мкл
2 М Трис-HCl, рН 9,0 2,5 мкл
100 мМ MnCl 2 3 мкл
1 М Диэтаноламина-HCl рН 9,8 5 мкл
1 М NaCl 4 мкл 15 мкл 15 мкл
1% Тритон Х-100 2 мкл 20 мкл 20 мкл 14 C-меченых липидов (фосфолипидов) 20 мкл (5000 имп)
14 С-меченного липида (ПК) 20 мкл (5000 имп)
14 С-меченного липида (ДАГ) 20 мкл (5000 имп)
10 мг / мл белковый экстракт с выраженными генов-кандидатов 0,5 мкл 5 мкл 5 мкл
бидистиллированная вода 87,5 мкл 77,5 мкл 77,5 мкл
Конечный объем 100 мкл 100 мкл 100 мкл

Таблица3. Схемы пипетирования для оптимизированных ферментативных анализах (фосфо) липазы с меченных липидных субстратов.

активность в единицах (мкмоль нитрофенола / мг белка х мин)
Жирным шрифтом выделены цифры обозначают ацил длину цепи р нитрофенил эфира субстрата 10 12 14 16 18
Палочка экстракта E. (фон) 16 ± 0,3 10 ± 1,1 13 ± 0,3 11 ± 0,8 10 ± 0,6
SMc00930 выражается в Е. экстракт палочки 1839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
SMc01003 выражается в Е. экстракт палочки 43 ± 2,1 29 ± 2 20 ± 0,7 25 ± 1,5 22 ± 0,9
SMc00930 минус фон 1823 ± 283 1829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 минус фон 27 ± 2,1 18 ± 2 7 ± 0,7 14 ± 1,5 12 ± 0,9

Таблица 4. р нитрофенил ацильных эфиров в качестве субстратов для пататина типа липазы SMc00930 и SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

За последние 20 лет, геномы многих организмов были секвенированы и хотя множество данных последовательностей генома была сформирована, функциональная интерпретация отстает и, следовательно, затрудняет наше понимание функции генома. функции генов в геномах часто присваиваются на основе сходства с генами известной функции или возникновения законсервированных мотивов. Тем не менее, точная функция данного гена часто не известна. Особенно, предсказанный структурные гены ферментов, не могут быть легко изучены с помощью OMIC методами из-за того, что большинство ферментов катализировать сложных реакций с участием двух субстратов и двух продуктов. В настоящее время представляется более реальным для изучения субстрат специфичностью в отношении групп ферментов, где по меньшей мере один субстрат фиксирована и где другой может изменяться. Например, в эукариот большинство фосфорилирования мотивов в белках, известны и консенсусные пептиды для киназ были замечены на твердых подложках с целью получения пептидного арлучей. Использование таких массивов и радиоактивно АТФ, субстрата особенности и уровни активности различных киназ организма могут быть определены разрешения создания профиля kinome и определение субстрат специфичностью 24. Гидролазы составляют еще одну большую группу ферментов, для которых один субстрат, вода, фиксировано, но для которых точный характер (другого) субстрата, подлежащего гидролизу часто не известна. Тот факт, что для нового фермента оптимальные условия анализа не известны либо, преобразует обнаружение новой активности фермента в многопараметрического проблемы. Следовательно, оно может помочь, чтобы иметь возможность закрепить субстрат подвергнуть гидролизу с целью определения, при каких условиях фермент работает лучше всего.

В настоящей рукописи мы опишем оптимизацию условий анализа для перспективного (фосфо) липазы с неизвестными специфичностью субстрата и разработать, как использовать эти оптимизированные условия в поисках естественного субстрата повторнопроспективное (фосфо) липазы. Значимость данного метода состоит в том , что гидролиз флуорогенными или хромогенных, искусственных субстратов, которые имитируют природные субстраты до некоторой степени, может сопровождаться спектрофотометрии 25 и что эти анализы легко применимы к большому объему исследования 26. Из-за чувствительности таких анализов и их простоте, чтобы следить за реакцией, они легко могут быть оптимизированы для данного фермента. Очевидно, что для искусственных субстратов можно было бы ожидать менее благоприятных кинетических констант (то есть, высокая K M, низкий к кошки) для конкретного фермента , чем для природных субстратов 1,21. На практике, однако, снисходительный доступность и выявляемость искусственных субстратов функционировать в качестве (плохой) субстратов для целых групп ферментов часто более чем компенсирует недостатки. После того, как встретив условия для фермента, чтобы работать (с искусственным субстратом), он будет делать это с Натураль / физиологический субстрат, а также. По мере того как подготовка и выделение потенциальных субстратов липидов может быть трудоемким и занимает много времени, важно, чтобы иметь уверенность в том, что фермент готов к работе при совмещении и инкубацию ее с ценными субстратами. Важно отметить, что процедура первой оптимизации условий фермента для работы, позволит более быструю идентификацию физиологического субстрата для нового (фосфо) липазы. Как доказательство концепции, мы успешно использовали этот метод для характеристики субстрата специфичности липаз SMc00171, SMc00930 и SMc01003 8,11. В отличие от этого, многие традиционные, альтернативные методы, устанавливающие анализы для (фосфо) липазы деятельности включают реакции, где субстрат и продукт известных ранее.

Очевидно, что модификации анализов для определения оптимальной активности фермента может включать в себя использование другого флуорогенными, хромогенный или иным образом помеченных искусственных субстратах, вариацииот концентрации фермента, типа и концентрации буфера или других добавок (например, моющие средства или двухвалентных катионов). Если никакой активности фермента не обнаруживается с помощью искусственных субстратов, соответствующий фермент просто не может работать с этим субстратом, но поиск и устранение неисправностей в таких случаях, безусловно, должна включать в себя, чтобы иметь уверенность в том, что были приняты все меры предосторожности, которые могли быть необходимы для поддержания активности фермента неповрежденными (то есть, хранение бесклеточных экстрактов при температуре 4 ° с или более низких температур до использования и, при необходимости, добавляя коктейли ингибиторов протеазы в бесклеточных экстрактах , с тем , чтобы избежать протеолитического деградации интерес фермента) 27.

Ограничения методике , представленной в этой рукописи в связи с тем , что искусственный субстрат и естественный субстрат отличаются друг от друга , и в результате биоэнергетике для каталитической реакции будет а 1. Различных парameters для оптимальных условий активности фермента должна быть установлена ​​также для природного субстрата (путем изменения рН, тип буфера, буферной силы, концентрации NaCl и детергенты, такие как Тритон Х-100, в отсутствие или в присутствии различных двухвалентных катионов), так как они могут оказаться немного отличаться от оптимальных условиях, встречающихся на искусственном субстрате. Другим важным ограничением является то, что, вероятно, не все (фосфо-) липазы могут быть обнаружены путем применения искусственных хромогенных субстратов. Например, искусственный р - нитрофенил остаток сложноэфирных субстратов просто может быть слишком громоздким, или проявляют другие химические свойства , которые предотвращают , что такой субстрат может получить доступ к активному сайту фермента. Было отмечено , что DAG липаза SMc01003 отображается низкую активность со всеми р нитрофенил эфирных субстратов с различной длиной цепи 11. С осознанием того, что DAG является естественным субстратом для SMc01003 и что DAG имеет отннебольшой нительно полярную головную группу, состоящую из глицерина только 11, то легко можно себе представить , что громоздкие остаток р - нитрофенил просто слишком большой для легкого доступа к активному сайту SMc01003. Однако молекулярные детали , почему р - нитрофенил эфиры не являются хорошими субстратами для SMc01003 не известны в этой точке.

Критические шаги в рамках протокола включают все положения, принятые для обеспечения того, чтобы фермент изучали имеет доступ к соответствующей подложке. Например, в поисках физиологической липидного субстрата, критически важно, что липидный субстрат содержится в растворенном виде. Таким образом, при создании таких ферментных анализов (описанный в 5 протокола), липидные субстраты, обычно растворенные в смеси метанол: хлороформ, должен быть смешан с водянистой раствором моющего средства, то есть, тритон Х-100, перед сушкой вниз смесь газообразным азотом. Эта процедура гарантирует, что после добавления оставшихся Ingreредиентов для анализа, потенциал подложки липидный встраивается в моющих мицелл и, таким образом доступным для фермента в процессе анализа.

В принципе, техника, представленная здесь должны быть широко применяться в будущем для открытия новых (фосфо) липазы и для определения их природных субстратов. Методика легко расширяемой для других классов гидролаз, но это может быть более сложным для разработки анализов с искусственными подложками для новых ферментов, которые требуют два, как правило, неизвестны, субстраты для завершения их каталитический цикл.

Для предсказаны (фосфо) липаз или фосфатаз ни правильный субстрат известно, ни условий анализа, в которых фермент работает наилучшим образом. Поэтому, возможно , было бы полезно изучить , являются ли некоторые соединения из батареи искусственных соединений, таких как отдельный р - нитрофенил-содержащих соединений - нитрофенил фосфата, бис- р - нитрофенил фосфата, р - нитрофенил пальмитат), может функционировать в качестве субстрата. Открытие исходных ферментативных активностей с искусственными подложками проложила путь для решения , что SMc00171 является PC конкретных фосфолипазы C 8, что SMc01003 является DAG липазы 11, и помог определить условия , при которых SMc00930 действует как гидролазы 11. Очевидно, что естественный субстрат SMc00930 в настоящее время до сих пор неизвестно и физиологические контексты SMc00930 и SMc01003 все еще предстоит решить. Поэтому задача предлагает физиологическую функцию прогнозируемой липазы является сложной задачей и не всегда сразу увенчались успехом. Использование мутантов с дефицитом предсказанного гена липазы и сравнивая их с соответствующим штамма дикого типа может дать экспериментальные доказательства того, что липаза действует со спецификой в ​​своем родном фоне штамма, который был постулируется в части 4) протокола. Очевидно, что утверждение новой активности липазы шульд быть подкреплено доказательствами в пробирке , что определенный субстрат превращается путем гидролиза в определенных продуктах. Иногда постулировал физиологические функции может заполнить пробелы в метаболических путях или объяснить физиологическую поведение продуцирующего организма, но и в других случаях, там просто до сих пор не может быть достаточно биохимические знания, чтобы иметь смысл некоторых видов деятельности. В ходе наших исследований мы выявили несколько ферментов, которые действуют на собственных полярных липидов мембран бактерий, разрушающих их и, в некоторых случаях, превращая их в плеер в более сложных циклах липидов. Например, объединение новых знаний , которые SMc00171 является PC конкретных фосфолипазы C (PLCP) 8 , который индуцируется под фосфорных ограничивающими условиями роста, с уже существующими данными, можно постулировать новый DAG цикл , который может существовать во многих экологической протеобактерий и что приводит к образованию содержащих фосфора липидов мембран при фосфор является ограничивающим рост. В ContrAST, когда поставки фосфора в изобилии, доступности баз rephosphorylated к фосфатидной кислоты ввод De Novo фосфолипидный биосинтез, тем самым закрывая этот липидный цикл и обеспечение того , чтобы в основном (глицеро) фосфолипиды присутствуют в мембране 8,28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgments

Эта работа была поддержана грантами от Consejo Nacional де Ciencias у Tecnología-México (КОНАСИТ-Мексика) (82614, 153998, 253549 и 178359 в Investigación Cientifica BASICA, а также 118 в Investigación ан Fronteras-де-ла-Ciencia) и от Dirección генерала де Asuntos де Личный Academico-Autónoma Universidad Nacional де Мехико (DGAPA-НАУ; PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Определение субстрата специфичностью для липазы и фосфолипазы кандидатов
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter