Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

La definición de Sustrato especificidades para la lipasa y la fosfolipasa candidatos

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Los microorganismos producen un amplio espectro de lipasas (fosfo) que son secretadas en el fin de hacer los sustratos externos disponibles para el organismo. Alternativamente, otros (fosfo) lipasas pueden estar asociadas físicamente con el organismo productor causando una facturación de lípidos intrínsecos y con frecuencia dando lugar a una remodelación de las membranas celulares. Aunque potenciales (fosfo) lipasas se pueden predecir con un número de algoritmos cuando la secuencia de gen / proteína está disponible, no ha sido obtenido con frecuencia prueba experimental de las actividades enzimáticas, especificidades de sustrato, y posibles funciones fisiológicas. Este manuscrito describe la optimización de las condiciones de ensayo de (fosfo) lipasas prospectivos con especificidades de sustrato desconocidos y cómo emplear estas condiciones optimizadas en la búsqueda para el sustrato natural de un respectivo lipasa (fosfo). El uso de sustratos cromogénicos artificiales, tales como derivados de p-nitrofenil, puede ayudar a detectar un menorla actividad enzimática de una lipasa predicho (fosfo) en condiciones estándar. Después de haber encontrado una actividad enzimática tal menor, los parámetros distintos de un ensayo enzimático se pueden variar con el fin de obtener una hidrólisis más eficiente del sustrato artificial. Después de haber determinado las condiciones en las que una enzima funciona bien, una variedad de posibles sustratos naturales deben ser analizadas para su degradación, un proceso que puede ser seguido empleando métodos cromatográficos diferentes. La definición de especificidades de sustrato de nuevas enzimas, a menudo proporciona hipótesis para un posible papel fisiológico de estos enzimas, que a continuación pueden ser probados experimentalmente. Siguiendo estas directrices, hemos sido capaces de identificar una fosfolipasa C (SMc00171) que degrada la fosfatidilcolina a fosfocolina y diacilglicerol, en un paso crucial para la remodelación de las membranas en la bacteria Sinorhizobium meliloti de las condiciones de fósforo limitante del crecimiento. Para dos predijo patatin-como fosfolipasas (SMc00930 y SMc01003) del mismo organismo, podríamos redefinir sus especificidades de sustrato y aclarar que SMc01003 es una lipasa diacilglicerol.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Lípidos basados en glicerol tales como triglicéridos y fosfolípidos (glicero) constituyen importantes y probablemente las clases de lípidos más conocidos 1. Triglicéridos (TG) son grasas o aceites, que por lo general funcionan como lípidos de almacenamiento, y por lo tanto, como posibles fuentes de energía y de carbono. Las etiquetas pueden ser degradadas por las lipasas, que con frecuencia son secretadas por el organismo productor de digerir variables externas y ponerlos a disposición como fuentes de carbono. Además, las lipasas se han estudiado ampliamente en los últimos años debido a sus importantes aplicaciones biotecnológicas 2.

Debido a su naturaleza anfifílica y su forma casi cilíndrica, (glicero fosfolípidos) exhiben propiedades de formación de membrana y por lo general constituyen los principales componentes lipídicos de la membrana de dos capas 3. En los microorganismos simples, tales como la bacteria Escherichia coli, sólo tres variantes principales del grupo de cabeza, fosfatidilglicerol (PG), cardiolipina (CL), y phosphatidylethanolamine (PE) se encontró, aunque se debe tener en cuenta que cada uno de ellos puede estar sustituido con un número considerable de diferentes cadenas de acilo graso en la posición sn -1 o sn -2 posición que da lugar a un gran número de diferentes especies moleculares de 4 . Otras bacterias podrían tener otros fosfolípidos, además o en lugar. Por ejemplo, Sinorhizobium meliloti, una bacteria del suelo, que es capaz de formar una raíz simbiosis nódulo de fijación de nitrógeno con la alfalfa leguminosas (Medicago sativa), contiene, además de PE un segundo fosfolípido zwitteriónico, la fosfatidilcolina (PC) 5. Además, los lípidos no contiene fósforo o glicerol pueden ser anfífilo y forma parte de la membrana celular. Por ejemplo, de las condiciones de crecimiento de fósforo limitativo, en S. meliloti, (glicero fosfolípidos) se sustituyen en gran medida por los lípidos de membrana que no contienen fósforo, es decir, sulfolípidos, lípidos ornitina, y diacylglyceryl trimethylhomoserine (DGTS) 6. En las bacterias, DGTS se forma a partir de diacilglicerol (DAG) en una vía de dos pasos 7, pero la fuente para la generación de DAG no estaba claro. Experimentos de pulso-caza sugirieron que PC puede ser un precursor para DGTS 8 y usando la metodología descrita en este manuscrito podríamos identificar una fosfolipasa C (PLCP, SMc00171) que se forma en condiciones de fósforo limitativo y que puede convertir PC en DAG y fosfocolina 8.

En un estudio separado, descubrimos que un acil-CoA sintetasa (FADD) mutante deficiente en S. meliloti o de Escherichia coli acumula ácidos grasos libres al entrar en la fase estacionaria de crecimiento 9. Aunque estos ácidos grasos parecían ser derivados de lípidos de la membrana, no se sabe que la fuente precisa de los ácidos grasos libres o la enzima (s) liberándolos. Una vez más, empleando la estrategia descrita en este manuscrito, dos 10 (fosfo) lipasas patatina-como (SMc00930 y SMc01003) que contribuyó a la formación de ácidos grasos libres en S. meliloti 11 estaba previsto. Sorprendentemente, SMc01003 utiliza DAG como sustrato la conversión a monoacilglicerol y, finalmente, glicerol y ácidos grasos libres 11. Por lo tanto, es una lipasa SMc01003 DAG (DGLA).

A pesar de que existe una serie de algoritmos de predicción del potencial (fosfo) 12,13 lipasas, su función precisa y papel fisiológico por lo general no se conoce. Aquí describimos un protocolo, para clonar y sobreexpresan lipasas (fosfo) predichos o potenciales. Este manuscrito se explica cómo los ensayos enzimáticos pueden ser desarrollados y optimizados para la lipasa sobreexpresa (fosfo) mediante el uso de sustratos cromogénicos artificiales. Proporcionamos ejemplos de cómo en un ensayo enzimático optimizado el (fosfo) sustrato de la lipasa real puede ser encontrado y cómo estos hallazgos podrían enriquecer nuestra comprensión de la fisiología microbiana.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Clon y sobreexpresan gen estructural de la lipasa predicha

  1. El uso de la reacción en cadena de la polimerasa (PCR) 14 y oligonucleótidos específicos (Tabla 1) 15, amplificar el gen de interés (smc01003, smc00930, o smc00171), predijo para codificar una lipasa o fosfolipasa, a partir del ADN genómico del organismo huésped (es decir, , S. meliloti).
    1. Introducir sitios de restricción específicos (con la secuencia diseñada de los oligonucleótidos). Digerir el fragmento de ADN amplificado con las enzimas de restricción correspondientes y clonar en un vector de expresión tales como plásmidos de la serie pET 16.
    2. Después de verificar la secuencia de ADN correcta para el gen clonado, transformar el vector en una cepa de expresión, tales como Escherichia coli BL21 (DE3) pLysS 16.
  2. Preparar un pre-cultivo durante la noche del huésped de expresión E. coli BL21 (DE3) pLYSS, que alberga el vector pET respectivo con el gen clonado o el vector vacío, en matraces de 100 ml de cultivo que contenían 20 ml de caldo Luria Bertani (LB) 17 además de los antibióticos requeridos. Cultivar las células a 30 ° C (o a la temperatura de crecimiento normal de la bacteria de la que se origina la lipasa).
    1. El uso de los pre-cultivos de una noche, inocular 500 ml de medio LB precalentado (además de los antibióticos requeridos) en matraces de 2 L de cultivo para obtener una densidad óptica inicial a 620 nm (OD 620) = 0,05. Siga crecimiento de cultivos y a una DO 620 = 0,3, añadir isopropil-β-D-tiogalactósido (IPTG) a una concentración final de 100 mM, y se incuba con agitación a 30 ° C durante un período de 4 horas.
    2. Al final del período de incubación, la transferencia de cada cultivo a un tubo de centrífuga de 500 ml y centrifugar a 5000 xga 4 ° C durante 30 min. Resuspender los sedimentos celulares bacterianas en 5 ml de tampón de suspensión (por ejemplo, SMc00930- y las células que expresan SMc01003 en Tris-HCl 50 mM pH 8,0 y las células SMc00171 expresan en 50 mM dietanolamina-HCl pH 9,8). Almacenar las suspensiones de células a -80 ° C hasta su uso.

2. Preparar los extractos de proteínas libres de células y determinar la concentración de proteínas

  1. Descongelar las suspensiones de células bacterianas y almacenar en hielo. Pasar las suspensiones de células tres veces a través de una célula de presión en frío a 20.000 libras por 2 en. Eliminar las células intactas y restos celulares por centrifugación a 5000 xg durante 30 min a 4 ° C.
  2. Después de la centrifugación, se preparan partes alícuotas de 100 y 500 l del sobrenadante para su posterior análisis y almacenar a -80 ° C hasta su uso.
  3. Utilice una de la parte alícuota de 100 l para determinar la concentración de proteína de los extractos libres de células distintas por un método de elección o como se describe 18.

3. Utilizar sustratos artificiales para la optimización de la enzimaActividades de lipasas (fosfo)

  1. Para una cobertura inicial de las actividades enzimáticas distintas, utilizar sustratos artificiales que producen un producto coloreado tras la hidrólisis, tales como p-nitrofenol (p -NP).
    1. Para los ensayos de la enzima ya optimizados con sustratos de éster de p-nitrofenil artificiales (descritos para la fosfolipasa C PLCP (SMc00171), así como para las fosfolipasas patatina-como predichos SMc00930 y SMc01003), esquemas de pipeteado de uso descritas en la Tabla 2.
    2. Al explorar un nuevo lipasa (fosfo) potencial, preparar una primera ensayo de la enzima estándar que contiene 50 mM Tris-HCl, pH 8,5, NaCl 100 mM, 0,05% de Triton X-100, 0,5 mM p-nitrofenil-compuesto que contiene (p-nitrofenil fosfato , fosfato de bis- p -nitrofenilo, p-nitrofenil decanoato, o p-nitrofenil palmitato), y el extracto de proteínas libre de células (de verificación 1, 3, 10, 30, 100, 300, y 1000 g) en un volumen total de 1 ml en 1 ml de plástico cuveTTES.
      NOTA: El uso de pH alcalino (Figura 1) cuando después de p-nitrofenil hidrólisis del éster en un ensayo continuo. Alternativamente, utilizar los ensayos de tiempo de un solo punto para una gama de valores de pH, la adición de NaOH al final del período de incubación para terminar la reacción de la enzima y para asegurar que todos p -NP está presente en la forma fenolato.
    3. Sigue el curso de tiempo para un aumento de la absorbancia a 405 nm, debido a la formación de p -NP, en un espectrofotómetro a 30 ° C durante un período de 5 min. Cuantificar la formación inicialmente lineal de p -NP mediante la determinación de la pendiente inicial de aumento de la absorbancia por unidad de tiempo.
    4. Calcular la variación de la concentración (? C) para p -NP usando la ley de Lambert-Beer (? A = ε? C d) 1.
      NOTA:? A es el cambio lineal de absorbancia determinado, ε es el coeficiente de extinción molar a la longitud de onda respectiva (en unidades de M -1 cm-1), d es la longitud de la trayectoria de la luz (1 cm), y? c es el cambio de la concentración (en unidades de M) que se determine.
      1. Teniendo en cuenta que el volumen de ensayo es de 1 ml, se calcula la cantidad de p -NP formado.
        NOTA: La cantidad x = concentración de volumen.
      2. Calcular la actividad de la enzima dividiendo la cantidad de p -NP formado por el tiempo en el que se forma. Determinar la actividad de la enzima específica dividiendo actividad de la enzima por la cantidad de proteína (en mg), que fue responsable de la generación de esta actividad.
    5. Comparar los cambios de absorbancia provocados por los extractos de proteína en la que un gen candidato (smc00171, smc00930, o smc01003) había sido expresadas con extractos que albergan solamente un vector vacío.
      NOTA: Con el fin de continuar con los pasos siguientes, las actividades específicas, causadas por los extractos de proteína en la que se habían expresado un gen candidato, deben ser por lo menos dos veces o más de los valores obtenidos para las actividades específicas causadas por extractos de proteínas que albergan solamente un vector vacío.
    6. Para experimentos adicionales, seleccionar aquellas condiciones en las que la hidrólisis del compuesto p-nitrofenil-que contiene es mínima con extractos libres de células (es decir, el vector vacío) y para el que la formación más pronunciada de p -NP y el anión p -nitrophenolate (Figura 1) se puede observar cuando se emplean extractos de proteínas, en el que un gen candidato se ha expresado.
  2. Después de determinar la actividad de la enzima inicial en 3.1, optimizar las condiciones de ensayo para la enzima respectiva mediante la variación de pH, tipo de tampón, tampón de fuerza, las concentraciones de NaCl, detergentes tales como Triton X-100, y la ausencia o presencia de diferentes cationes bivalentes.
    1. Para diferentes concentraciones de cada variable, a determinar la actividad enzimática específica (véase 3.1.4.2) (el número más alto obtenido define la condiciónde la actividad enzimática máxima). Utilice la combinación de las condiciones óptimas encontradas para cada variable para definir un ensayo enzimático optimizado en la que cada variable está presente en su concentración óptima.

Figura 1
Figura 1. p-nitrofenil ésteres como sustratos artificiales para lipasas (fosfo) en un ensayo espectrofotométrico. Con la hidrólisis de los ésteres de p-nitrofenil, se forman un ácido (R-OH) y p-nitrofenol (p -NP). Debido a la pK a = 7,2 para la disociación de la fenólico H + a partir de p -NP, a un pH> 9,2 más de 99% está en la forma p -nitrophenolate de color amarillo brillante y un coeficiente de extinción molar de 18.000 M -1 cm - 1 puede ser utilizado en una longitud de onda de 405 nm para la cuantificación de la libre p -nitrophenolate 22. Cuando se utilizaron tampones con un pH de 8,5, se determinó la absorbancia a 400 nm y un coeficiente de extinción molar de 14.500 M-1 cm-1 fue empleado 23. Haga clic aquí para ver una versión más grande de esta figura.

NOTA: Después de haber definido las condiciones óptimas para la actividad de la enzima de interés, se embarcan en la búsqueda de la verdadera sustrato / fisiológica de esta lipasa. En principio, tomar dos, a menudo complementaria, los enfoques para lograr este objetivo, un enfoque in vivo o un enfoque in vitro.

4. En Vivo Identificación de la Physiological sustrato de una lipasa

ove_content "> NOTA:. En un enfoque in vivo, expresar la lipasa de interés en un organismo huésped 8,11 con el fin de registrar el paso del tiempo si la expresión de la lipasa altera el perfil de lípidos host's En otro enfoque in vivo, generar una mutante deficiente del gen de interés 8,11 y estudiar si su perfil de lípidos es distinta de la versión de tipo salvaje 6,8,11. con el fin de obtener una evaluación cuantitativa de perfil de lípidos de un organismo, un método simple consiste en radiomarcar compuestos celulares , la extracción de los lípidos, separándolos por cromatografía, y cuantificar los lípidos separadas marcadas radiactivamente.

  1. El radiomarcado de los lípidos.
    1. Preparar un pre-cultivo de una noche de un organismo de interés (E. coli o S. meliloti) en 5 ml del medio de cultivo deseado (medio complejo o medio mínimo definido) y crecer a 30 ° C.
    2. Desde el pre-cultivo, inocular en 20 ml de la saen un matraz de cultivo de 100 ml me medio fresco para obtener una DO inicial 620 = 0,3 para el cultivo.
    3. Tomar una alícuota (1 ml) del cultivo en condiciones estériles y transferir a un tubo de fondo redondo de poliestireno de 14 ml estéril.
    4. Añadir 1 Ci de acetato de [1- 14 C] (60 mCi por mmol) al cultivo 1 ml.
    5. Incubar el cultivo líquido con agitación a 30 ° C durante un período de 24 horas.
    6. Al final del período de incubación, la transferencia de la cultura a un tubo de microcentrífuga de 1,5 ml y centrifugar a 12.000 xg a temperatura ambiente durante 5 min.
    7. Resuspender el precipitado en 100 l de agua. En este punto, almacenar la suspensión celular a -20 ° C o inmediatamente continuar con la extracción de los lípidos polares (sección 4.2).
  2. La extracción de lípidos polares.
    NOTA: El método descrito aquí esencialmente sigue el procedimiento descrito por Bligh y Dyer 19.
    1. A los 100 l de susp celular acuosaensión, añadir 375 l de metanol: solución de cloroformo (2: 1; vol / vol).
    2. Vortex durante 30 segundos e incubar durante 5 min a temperatura ambiente.
    3. Centrifugar 5 min a 12.000 xg a la temperatura ambiente.
    4. Transferir el sobrenadante a un nuevo tubo de microcentrífuga de 1,5 ml.
    5. Añadir 125 l de cloroformo y 125 l de agua, vórtice 30 seg.
    6. Centrifugar 1 min a 12.000 xg a la temperatura ambiente.
    7. Pasar la fase inferior de cloroformo a un tubo nuevo y se seca con una corriente de gas nitrógeno.
    8. Disolver los lípidos secos en 100 l de cloroformo: solución de metanol (1: 1; vol / vol).
      NOTA: En este punto, una parte alícuota de 5 l de la solución de lípidos se puede cuantificar mediante recuento de centelleo líquido.
    9. Para el análisis de cromatografía en capa fina (TLC), se seca por los 95 l restantes con una corriente de gas nitrógeno y volver a disolver los lípidos secos en 20 l de cloroformo: solución de metanol (1: 1; vol / vol). Utilice una alícuota de 3 lpara el análisis de TLC.
  3. La separación de los lípidos polares por cromatografía en capa fina (TLC).
    NOTA: En función de las clases de lípidos a analizar, diferentes combinaciones de fases sólidas y móviles podrían emplearse para la separación. Aquí una separación típica de lípidos cargados polares y otro, más adecuado para los lípidos polares neutros, utilizando cromatografía en capa fina (HPTLC) láminas de aluminio de gel de sílice de alto rendimiento como la fase sólida, se describen.
    1. La separación de los lípidos polares cargados por TLC bidimensional (2D-TLC).
      1. Aplicar una alícuota de 3 l de muestra de lípidos en una esquina de una hoja de sílice HPTLC de aluminio en gel (10 x 10 cm), 2 cm del borde de la placa.
      2. Preparar y mezclar la fase móvil (140 ml de cloroformo, 60 ml de metanol, y 10 ml de agua) para la separación en la primera dimensión.
      3. Rociar una cámara de revelado TLC internamente con papel de cromatografía.
        NOTA: Esto es para asegurar que la fase de gas de la cámara deserá saturada rápidamente (dentro de 30 min) después de la fase móvil para la primera dimensión se ha agregado a la cámara y la cámara se ha cerrado con una placa de vidrio.
      4. Preparar y mezclar la fase móvil (130 ml de cloroformo, 50 ml de metanol, y 20 ml de ácido acético glacial) para la separación en la segunda dimensión y la transferencia a una segunda cámara de revelado TLC internamente recubierto con papel de cromatografía y dejar que la cámara de saturar.
      5. Transferir con cuidado la lámina de aluminio de gel de sílice HPTLC con la muestra de lípido seco a la primera cámara y desarrollar (es decir, realiza una cromatografía) la placa durante 60 min en la cámara cerrada en la primera dimensión 5.
      6. Retire la placa de la cámara y dejar que los disolventes se secan en una campana de flujo durante 30 minutos.
      7. Después de girar la placa de 90 grados con respecto a la cromatografía anterior, la transferencia de la lámina de aluminio de gel de sílice HPTLC, en el que los lípidos han sido separados en una dimensión, a la segundala cámara D y el desarrollo de la placa durante 60 minutos en la segunda dimensión 5.
      8. Retire la hoja de la cámara y dejar que los disolventes se secan en una campana de flujo durante al menos 2 horas.
    2. La separación de los lípidos polares neutros.
      1. Aplicar 3 ml de alícuotas de las muestras de lípidos en una hoja de aluminio de gel de sílice HPTLC de partida 2 cm de los bordes de la placa. Si se analizan múltiples muestras de una cromatografía unidimensional, mantenga una distancia de al menos 1,5 cm entre los diferentes puntos de aplicación de ejemplo.
      2. Preparar y mezclar la fase móvil (140 ml de hexano, 60 ml de éter dietílico, y 8 ml de ácido acético) y la transferencia a una cámara de revelado internamente TLC recubiertas con papel de cromatografía y cubiertas con una placa de vidrio para permitir que el saturar cámara (30 min).
      3. La transferencia de la hoja de aluminio de gel de sílice HPTLC con las muestras de lípidos secos a la cámara y desarrollar la placa durante 30 min en la cámara cerrada.
      4. Retire la placa de la cámaray dejar que los disolventes se secan en una campana de flujo durante 2 horas.
  4. La cuantificación y visualización de los lípidos polares separadas.
    1. Una vez que la hoja de TLC desarrollado es seco, se incuban con una pantalla de luminiscencia fotoestimulable (PSL) en un casete cerrado durante 3 días.
    2. Exponga la pantalla se incuba a un escáner PSL y adquirir una imagen virtual de los lípidos radiomarcados separadas.
    3. Realizar la cuantificación usando software PSL 20.
  5. La visualización y el aislamiento de las clases de lípidos polares individuales.
    1. Incubar hoja TLC desarrollada durante 10 minutos en una cámara de cromatografía en presencia de 1 g de cristales de yodo.
      NOTA: Separado compuestos lipídicos se disolverán el yodo y aparecen como manchas de color marrón.
    2. Círculo de los puntos con un lápiz, compararlos con la movilidad relativa (Rf) de compuestos estándar (es decir, 1,2-sn-glicerol dipalmitoyl-, dipalmitoil-L-α-Phosphatidylcholine, DL-α-monopalmitina, o ácido palmítico), e identificar a qué clase de lípidos que podrían pertenecer.
    3. En una campana de extracción, dejar que el yodo se evapore de la hoja de TLC.
    4. Con la ayuda de una espátula, raspar el gel de sílice que contiene el compuesto de interés de la hoja, y extraer el compuesto del gel de sílice con una mezcla de 100 l de agua y 375 l de metanol: solución de cloroformo (2: 1; vol / vol).
    5. Continuar con la extracción de acuerdo con Bligh y Dyer como se indica (4.2.2 en adelante).
    6. Tienda clase de lípidos purificado en 100 l de cloroformo: solución de metanol (1: 1; vol / vol) a -20 ° C hasta su uso.

5. En Vitro Identificación de la Physiological sustrato de una lipasa

NOTA: En un enfoque in vitro, estudiar si la lipasa de interés puede convertir una mezcla de lípidos aislados o lípidos puros individuales a la hidrol correspondienteproductos analysis en las condiciones definidas como óptimo en 3.2.

  1. Utilizar esquemas de pipeteado para ensayos enzimáticos según la Tabla 3 para la fosfolipasa C específica de PC-SMc00171 (véase 5.2), la fosfolipasa A (véase 5.3), y DAG lipasa SMc01003 (véase 5.4) la actividad.
  2. Determinación de la actividad de la fosfolipasa C-PC específica (Tabla 3).
    1. A un tubo de microcentrífuga de 1,5 ml, añadir 5.000 recuentos por minuto (cpm) del total de 14 PC marcado con C y una solución de Triton X-100.
    2. Mezclar y seco bajo una corriente de nitrógeno.
    3. Añadir dietanolamina-HCl, tampón de pH 9,8, así como NaCl y MnCl2 soluciones y agua bidestilada para obtener un volumen final de 99,5 l. Vortex durante 5 seg.
    4. Añadir 0,5 l de enzima (5 mg de proteína) (es decir, un extracto libre de células en las que sobreexpresa SMc00171 está presente) para iniciar la reacción. Mezclar brevemente.
    5. Incubar a 30 ° C durante 4 h.
    6. Detener la reacción por eladición de 250 l de metanol y 125 l de cloroformo.
    7. Extracto de lípidos como se describió anteriormente (véase 4.2).
    8. lípidos separados por una sola dimensión--TLC (1D) (ver 4.3.2 y 4.4), y analizarlos mediante imágenes de PSL.
  3. Determinación de la actividad de la fosfolipasa A (Tabla 3).
    1. A un tubo de microcentrífuga de 1,5 ml, añadir 5.000 cpm de 14 Total de fosfolípidos marcado con C y una solución de Triton X-100.
    2. Mezclar y seco bajo una corriente de nitrógeno.
    3. Para un ensayo final de 100 l, añadir Tris-HCl, 8,5 tampón de pH, solución de NaCl y agua. Vortex durante 5 seg.
    4. Añadir 5 l de enzima (50 mg de proteína) (es decir, un extracto libre de células en el que sobreexpresa SMc00930 o SMc01003 está presente).
    5. Incubar a 30 ° C durante 5 hr.
    6. Detener la reacción mediante la adición de 250 l de metanol y 125 l de cloroformo.
    7. Extraer los lípidos como se describió anteriormente (véase el punto 4.2), separadosellos por 1D-TLC usando 130 ml de cloroformo, 50 ml de metanol y ácido acético glacial 20 ml como la fase móvil, y analizarlos por imágenes de PSL.
  4. Determinación de la actividad de la lipasa diacilglicerol (DAG).
    1. Preparación de DAG marcado con C 14.
      1. Radiomarcador S. culturas meliloti (ver 4.1) y extraer los lípidos polares (véase el punto 4.2) como se ha descrito. Separada S. meliloti extractos lípidos totales por 1D-TLC en cloroformo: metanol: ácido acético (130: 50: 20; vol / vol) utilizando condiciones descritas para la separación en segunda dimensión en 4.3.1.
      2. Visualizar PC mediante tinción con yodo y usar un lápiz para marcar la localización de fosfatidilcolina (PC).
      3. Aislar PC radiomarcado como se describe en 4.5.
      4. Cuantificar PC extraído por recuento de centelleo.
        NOTA: Se espera que alrededor de 320.000 cpm PC.
      5. Tratar PC (250.000 cpm) con 0,1 U de la fosfolipasa C de Clostridium perfringens en 50 mM Tris-HCl, pH 7,2, 0,5% De Triton X-100 y CaCl mM 10 2 durante 2 horas en un volumen total de 100 l y detener la reacción mediante la adición de 250 l de metanol y 125 l de cloroformo.
      6. Extraer los lípidos como se ha descrito anteriormente y separados por ellos por 1D-TLC (ver 4.3.2).
      7. Aislar diacilglicerol de la placa de sílice y cuantificar mediante recuento de centelleo (como se describe en 4.2)
    2. Ensayo de lipasa diacilglicerol (Tabla 3).
      1. A un tubo de microcentrífuga de 1,5 ml, añadir 5.000 cpm de 14 DAG marcado con C y una solución de Triton X-100.
      2. Mezclar y seco bajo una corriente de nitrógeno.
      3. Para un ensayo final de 100 l, añadir Tris-HCl (pH 9,0) tampón, una solución de NaCl y agua bidestilada. Vortex durante 5 seg.
      4. Iniciar la reacción mediante la adición de 5 l de enzima (50 mg de proteína de extracto libre de células).
      5. Incubar a 30 ° C durante 4 h.
      6. Detener la reacción mediante la adición de 250 l de metanol unad 125 l de lípidos en cloroformo y el extracto como se describió anteriormente (véase el punto 4.2).
      7. Analizar los lípidos polares neutros por 1D-TLC (véase 4.1.3.2) y las imágenes PSL posterior.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Actividad de la fosfolipasa-PC específico C SMc00171 con Bis- fosfato de p-nitrofenil

Extractos libres de células obtenidas a partir de E. coli BL21 (DE3) pLysS x, que tenían smc00171 expresaron, fueron estudiados por su capacidad para hidrolizar ésteres de fosfato-nitrofenil bis- p, utilizando un ensayo enzimático espectrofotométrico, midiendo la -NP p formado. No hay actividad hidrolítica estaba presente en extractos libres de células obtenidas a partir de E. coli BL21 (DE3) pLysS que alberga x un vector de pET9a vacío (datos no mostrados) cuando bis- fosfato de p-nitrofenil fue empleado como sustrato.

Cursos de tiempo para la -NP p formado indican que existe una fuerte dependencia de la cantidad de extracto libre de células (de E. coli BL21 (DE3) pLysS x, que tenía smc00171 expresó) añadido al ensayo (Figura 2A). Si la cantidad de producto formado p -NP dependería únicamente de la concentración de enzima, debe observarse una correlación lineal entre la enzima (proteína) concentración empleada y producto formado después de un cierto tiempo. Claramente, esto no es el caso de los extractos libres de células obtenidos a partir de E. coli BL21 (DE3) pLysS x, que había smc00171 expresado (Figura 2B). Aunque puede haber varias razones para una dependencia exponencial de la actividad enzimática de la concentración de proteína de 21, un motivo frecuente es que tras la dilución de un extracto de proteína que contiene la enzima, otros componentes en el extracto que pueden ser limitante para la actividad enzimática, es decir, potenciales cofactores , se diluyen también. En tales casos, las actividades inesperadamente bajos de enzimas están registrados con extractos libres de células diluidas. Mediante la inclusión de una concentración de saturación de 3 mM MnCl 2 en el ensayo de enzima, el p Producto -NP formó después de un cierto tiempo solamente depende de la cantidad de enzima añadido (datos no mostrados) lo que indica que MnCl 2 era un componente limitante de la actividad SMc00171 en extractos libres de células de E. coli.

Figura 2
Figura 2. Determinación de la actividad SMc00171 (fosfolipasa) usando el sustrato artificial bis- fosfato de p-nitrofenil. El curso temporal para la formación de p -NP se muestran empleando extractos de proteínas libres de células (● 10 mg / ml, n 15 mg / ml, ▲ 20 mg / ml) en el que se había expresado SMc00171 (a). -NP p formado después de 40 min de incubación con diferentes cantidades de extractos de proteínas libres de células en el que se habían expresado SMc00171 (B). Las barras de error indican la desviación estándar..jove.com / archivos / ftp_upload / 54613 / 54613fig2large.jpg "target =" _ blank "> Haga clic aquí para ver una versión más grande de esta figura.

Actividades del predicho patatin como fosfolipasas SMc00930 y SMc01003 con p-nitrofenil acil ésteres de diferentes longitudes de cadena

Después de la expresión de smc00930 o smc01003 en E. coli BL21 (DE3) pLysS x, extractos libres de células se obtuvieron y estudiados por su capacidad para hidrolizar ésteres de acilo graso p -nitrofenilo. Durante el ensayo enzimático, la -NP p formada se determina en un espectrofotómetro. Actividades hidrolíticas menores estaban presentes en los extractos libres de células obtenidas a partir de E. coli BL21 (DE3) pLysS x con un vector pET17b vacío (Tabla 4), cuando los ésteres de p-nitrofenil acilo de differelongitudes de cadena nt se emplearon como sustratos. Cuando smc01003 se expresó, los extractos obtenidos mostraron un aumento de la hidrólisis de los ésteres de p-nitrofenil de diferentes longitudes de cadena. SMc01003 degrada el decanoato de medio-nitrofenil cadena P, así como el de cadena larga p-nitrofenil palmitato y estearato de p-nitrofenil (Tabla 4). Como SMc01003 es un contribuyente importante para la formación de ácidos grasos libres de cadena larga en S. meliloti durante la fase estacionaria 11, fue sorprendente que SMc01003 parecía actuar igualmente bien en de cadena media que en los ésteres de p-nitrofenil acilo de cadena larga (Tabla 4). Inesperadamente, SMc01003 actúa también sobre sustratos de cadena corta, tales como butirato de p-nitrofenil o octanoato de p-nitrofenil (datos no mostrados). Sin embargo, estos últimos sustratos también son degradados por actividades presentes en extractos libres de células de E. coli (es decir, que alberga el vect vacíao pET17b) sin expresar cualquier gen adicional y con sustratos de cadena corta (C4), un medio del sustrato ya se degrada por E. enzimas intrínsecas de E. coli (datos no mostrados). Claramente, SMc01003 necesita ser purificado con el fin de aclarar si SMc01003 funciona igual de bien en sustratos a corto, mediano, y de cadena larga. En general, los ésteres de p-nitrofenil acilo no parecen ser buenos sustratos para SMc01003 que podrían ser comprensible sabiendo que SMc01003 es en realidad una lipasa DAG 11. Extractos libres de células, en el que se habían expresado smc00930, muestran actividades enzimáticas mucho más altas con ésteres de p-nitrofenil (Tabla 4). También, SMc00930 es capaz de hidrolizar los ésteres de p-nitrofenil acilo de diferentes longitudes de cadena (C10, C12, C14, C16 y C18), aunque p-nitrofenil palmitato (actividad específica 5,5 mmol NP min - 1 mg de proteína - 1) es claramente el mejor sustrato para SMc00930. Hasta la fecha, la physiolológica sustrato para SMc00930 no se conoce.

Explorar si Polar Lipids puede funcionar como sustratos para las lipasas predichos (fosfo)

Una vez que un (fosfo) lipasa ensayo enzimático ha sido optimizado con sustratos artificiales, mezclas de lípidos radiomarcados o lípidos puros pueden ser probados como posibles sustratos.

Cuando el ensayo SMc00171 y que contiene extractos libres de células con 14 PC marcado con C en condiciones optimizadas, podríamos demostrar que SMc00171 degrada PC a DAG, un resultado que fue confirmado por estudios de espectrometría de masas 8. SMc00171 también degrada 32 PC P-marcado a fosfocolina y por lo tanto actúa como una fosfolipasa C-PC específico (PLCP) 8, que se induce en condiciones de fósforo limitantes de crecimiento.

CuandoSMc00930- ensayar o SMc01003 y que contiene extractos libres de células con 14 C o 32 lípidos polares totales P-etiquetados bajo condiciones óptimas, se podría demostrar que ninguno de los fosfolípidos se degrada por SMc00930 o SMc01003 en condiciones en ésteres de p-nitrofenil acilo funcionaban como sustratos 11. Por el contrario, una fosfolipasa comercial A 2 de veneno de serpiente era capaz de degradar una mezcla de fosfolípidos 11 tales. Estos resultados fueron sorprendentes e inesperados ya que ambos, SMc00930 y SMc01003, se prevé que ser fosfolipasas-como patatina.

Cuando el ensayo SMc00930- o SMc01003 y que contiene extractos libres de células con 14 C- diacilglicerol marcado (DAG) en condiciones optimizadas, se pudo demostrar que el DAG no es degradada por SMc00930 o extractos libres de células de E. coli, mientras que SMc01003 degrada DAG y forma compuestos que migran como los ácidos grasos libres (Figura 3). Recientemente hemos podido demostrar que SMc01003 actúa como una lipasa DAG que puede degradar DAG o monoacilglicerol a glicerol y ácidos grasos libres 11 (Figura 4).

figura 3
Figura 3. SMc01003 degrada diacilglicerol. Extractos libres de células de E. coli BL21 (DE3) pLysS que expresa × SMc01003, SMc00930 o que contiene el vector pET17b vacío, o tampón se incubaron con 14 C-DAG (obtenido de S. meliloti) durante 24 horas. Al final de los períodos de incubación respectivos, lípidos radiomarcados se extrajeron y se separaron por 1D-TLC utilizando la fase móvil para la separación de lípidos polares neutros (véase 4.3.2). FA, ácidos grasos; DAG, diacilglicerol. Esta cifra ha sido modificado a partir de [Sahonero-Canavesi et al. 2015] 11.3large.jpg "target =" _ blank "> Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4. enzimática en función de diacilglicerol lipasa DGLA (SMc01003). Diacilglicerol (DAG) SMc01003 lipasa degrada DAG para monoacilglicerol y un ácido graso, y luego se degrada aún más monoacilglicerol de glicerol y otro ácido graso. Haga clic aquí para ver una versión más grande de esta figura.

oligonucleótido
nombre
Secuencia
(5'-3 ')
Gene
de interés
enzima de restricción
El sitio agregó
Vector
para la expresión
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 Nde I pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xho I pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 Nde I pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 Bam HI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 Nde I pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 Bam HI pET9a
Las letras en negrita indican los sitios de restricción.

Tabla 1. Los oligonucleótidos usados para amplificar y clonar genes predichos fosfo (lipasa) en pET17b o pET9a vectorial. Oligonucleótidos cebadores fueron diseñados utilizando el software descrito 15.

Ensayo para SMc00171 Ensayo para SMc01003 Ensayo para SMc00930
Valores Componente
Tris-HCl, pH 8,5 25 l
2 M Tris-HCl, pH 9,0 25 l
1 M dietanolamina-HCl, pH 9,8 50 l
1 M NaCl 40 l 150 ml 150 ml
1% Triton X-100 200 l 200 l
50 mM p-nitrofenil palmitato 12,5 l 12,5 l
200 mM bis- nitrofenil fosfato p- 2,5 l
extracto libre de células (1 mg protein / ml) con el gen candidato expresó 20 l 100 l 1 l
agua bidestilada 887,5 l 512,5 l 611,5 l
volumen final 1 ml 1 ml 1 ml

Tabla 2. Sistemas de pipeteo para ensayos de enzimas optimizadas con sustratos artificiales p-nitrofenil éster.

Ensayo para smc00171 codificados en fosfolipasa C Ensayo para smc01003 - codificada lipasa DAG Ensayo optimizado para la actividad fosfolipasa
Valores Componente
2 M Tris-HCl pH 8,5 2,5 l
2 M Tris-HCl pH 9,0 2,5 l
100 mM MnCl 2 3 l
1 M Dietanolamina-HCl pH 9,8 5 l
1 M NaCl 4 l 15 l 15 l
1% Triton X-100 2 l 20 l 20 l 14 C-etiquetados de lípidos (fosfolípidos) 20 l (5.000 cpm)
14 lípido marcado con C (PC) 20 l (5.000 cpm)
14 lípido marcado con C (DAG) 20 l (5.000 cpm)
10 mg / ml extracto de proteínas con genes candidatos expresadas 0,5 l 5 l 5 l
agua bidestilada 87,5 l 77,5 l 77,5 l
El volumen final 100 l 100 l 100 l

Mesa3. esquemas de pipeteado para ensayos enzimáticos optimizados para (fosfo) lipasas con sustratos de lípidos radiomarcados.

la actividad se da en unidades (mol nitrofenol / mg de proteína x min)
Los números en negrita indican acilo longitud de cadena de sustrato éster p-nitrofenil 10 12 14 dieciséis 18
Extracto de E. coli (fondo) 16 ± 0,3 10 ± 1,1 13 ± 0,3 11 ± 0,8 10 ± 0,6
SMc00930 expresa en E. extracto de E. coli 1.839 ± 283 2.873 ± 117 5.517 ± 394 3.402 ± 65
SMc01003 expresa en E. extracto de E. coli 43 ± 2,1 29 ± 2 20 ± 0,7 25 ± 1,5 22 ± 0,9
SMc00930 menos el fondo 1.823 ± 283 1.829 ± 283 2.860 ± 117 5.506 ± 394 3.392 ± 65
SMc01003 menos el fondo 27 ± 2,1 18 ± 2 7 ± 0,7 14 ± 1,5 12 ± 0,9

Tabla 4. p-nitrofenil ésteres de acilo como sustratos para las lipasas patatina-como SMc00930 y SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Durante los últimos 20 años, los genomas de muchos organismos se han secuenciado y aunque una gran cantidad de datos de secuencia del genoma se ha generado, la interpretación funcional es la zaga, y por consiguiente, dificulta nuestra comprensión de la función del genoma. las funciones de genes en los genomas son a menudo asignados basándose en la similitud de los genes de función o la aparición de motivos conservados conocido. Sin embargo, la función exacta de un gen dado es a menudo no se conoce. Especialmente, predijeron genes estructurales para las enzimas no pueden ser fácilmente exploradas por técnicas ómicas debido al hecho de que la mayoría de enzimas catalizan reacciones complejas que implican dos sustratos y dos productos. Actualmente, parece más factible para explorar especificidades de sustrato para grupos de enzimas en la que al menos un sustrato es fija y donde el otro se puede variar. Por ejemplo, en la mayoría de los eucariotas motivos de fosforilación en las proteínas son conocidos y péptidos consenso para quinasas han sido vistos sobre soportes sólidos con el fin de generar ar péptidorayos. El uso de tales matrices y ATP radiomarcado, especificidades de sustrato y niveles de actividad de quinasas distintas de un organismo se puede determinar que permite el establecimiento de un perfil kinome y la definición de sustrato especificidades 24. Hidrolasas componen otro gran grupo de enzimas para las que un sustrato, el agua, es fijo, sino para los que a menudo no se conoce la naturaleza exacta de la (otra) sustrato a ser hidrolizados. El hecho de que para una nueva enzima las condiciones de ensayo óptimas no se conocen bien, convierte la detección de una nueva actividad de la enzima en un problema de múltiples variables. Por lo tanto, puede ayudar a ser capaz de fijar el sustrato a ser hidrolizado con el fin de definir las condiciones en que la enzima funciona mejor.

En el presente manuscrito, se describe la optimización de las condiciones de ensayo para prospectivo (fosfo) lipasas con especificidades de sustrato desconocidos y elaborar cómo emplear estas condiciones optimizadas en la búsqueda para el sustrato natural de la reperspectiva (fosfo) lipasa. La importancia de la presente técnica consiste en el hecho de que la hidrólisis de sustratos artificiales fluorogénicos o cromogénicos,, que imitan los substratos naturales, en cierta medida, puede ser seguido por espectrofotometría 25 y que estos ensayos son fácilmente aplicables a gran escala estudia 26. Debido a la sensibilidad de tales ensayos y su simplicidad para controlar la reacción, que se pueden optimizar fácilmente para una enzima dada. Obviamente, para sustratos artificiales que uno podría esperar constantes cinéticas menos favorables (es decir, alta K M, baja kcat) para una enzima específica que para los sustratos naturales 1,21. En la práctica, sin embargo, la disponibilidad fácil y detectabilidad de sustratos artificiales que funcionan como (malo) sustratos para todo un grupo de enzimas a menudo más que compensar las desventajas. Una vez de haber encontrado las condiciones para una enzima para trabajar (con el sustrato artificial), lo hará con la naturAl / sustrato fisiológico también. A medida que la preparación y aislamiento de los posibles sustratos de lípidos puede ser laborioso y consume mucho tiempo, es importante tener la seguridad de que una enzima está listo para trabajar al combinar e incubación con sustratos valiosos. Es importante destacar que el procedimiento de la primera optimización de las condiciones para una enzima funcione, permitirá una identificación más rápida del sustrato fisiológico para una nueva lipasa (fosfo). Como una prueba de concepto, hemos empleado con éxito este método para la caracterización de las especificidades de sustrato de las lipasas SMc00171, SMc00930, y SMc01003 8,11. Por el contrario, muchos métodos tradicionales, alternativos que establecen ensayos para actividades (fosfo) lipasa implican reacciones en las que el sustrato y el producto se conocen previamente.

Obviamente, las modificaciones de ensayos para detectar la actividad enzimática óptima puede incluir el uso de otro fluorogénico, cromogénico, o de otra manera marcados sustratos artificiales, la variaciónde la concentración de enzima, el tipo y concentración de tampones, u otros aditivos (es decir, detergentes o cationes bivalentes). Si no se detecta ninguna actividad de la enzima con sustratos artificiales, la enzima respectiva simplemente no podría funcionar con este sustrato, pero la resolución de problemas en estos casos, sin duda debe incluir para tener la seguridad de que se hubieran tomado todas las precauciones que podrían haber sido necesario para mantener la actividad de la enzima intacta (es decir, el almacenamiento de los extractos libres de células a 4 ° C o más bajas temperaturas hasta su uso y, si es necesario, la adición de un cóctel de inhibidores de proteasas a extractos libres de células con el fin de evitar la degradación proteolítica de la enzima de interés) 27.

Limitaciones de la técnica presentada en este manuscrito son debido al hecho de que el sustrato artificial y el sustrato natural son diferentes unos de otros y, en consecuencia, la bioenergética para la reacción catalizada será así 1. Los diversos parameters para las condiciones óptimas de actividad enzimática deben establecerse también para el sustrato natural (mediante la variación de pH, tipo de tampón, tampón de fuerza, las concentraciones de NaCl y detergentes tales como Triton X-100, la ausencia o presencia de diferentes cationes bivalentes), ya que podrían llegar a ser un poco diferente de las condiciones óptimas encontradas para el sustrato artificial. Otra limitación importante es que probablemente no todos (fosfo) lipasas son detectables por el uso de sustratos cromogénicos artificiales. Por ejemplo, el residuo p-nitrofenil artificial de los sustratos de ésteres simplemente podría ser demasiado voluminosos, o exhibir otras propiedades químicas que impiden que un sustrato tal puede tener acceso al sitio activo de una enzima. Se observó que el DAG lipasa SMc01003 muestra las actividades de bajo con todos los sustratos de éster de p-nitrofenil de diferentes longitudes de cadena 11. Con el conocimiento de que DAG es el sustrato natural para SMc01003 y que tiene un DAG reltivamente pequeño grupo de cabeza polar, que consiste en glicerol solamente 11, es fácilmente imaginable que el residuo de p-nitrofenil voluminoso es simplemente demasiado grande para un fácil acceso al sitio activo de SMc01003. Sin embargo, los detalles moleculares por qué ésteres de nitrofenil p no son buenos sustratos para SMc01003 no se conocen en este momento.

Los pasos críticos en el protocolo incluyen todas las disposiciones adoptadas para garantizar que la enzima estudiada tiene acceso al sustrato respectiva. Por ejemplo, en la búsqueda del sustrato lipídico fisiológico, es crítico que el sustrato lipídico se proporciona en una forma solubilizada. Por lo tanto, cuando la creación de tales ensayos de enzima (descrito en 5 del protocolo), sustratos lipídicos, normalmente disueltos en mezclas de metanol: cloroformo, se deben mezclar con una solución acuosa de un detergente, es decir, Triton X-100, antes de secar abajo la mezcla con gas nitrógeno. Este procedimiento garantiza que, después de añadir los ingre restantesdients para el ensayo, el sustrato potencial de lípidos está incrustado en micelas de detergente y, como tal, accesible para la enzima durante el ensayo.

Principalmente, la técnica presentada aquí debería ser ampliamente aplicable en el futuro para el descubrimiento de nuevas lipasas (fosfo) y para la definición de sus sustratos naturales. La técnica es fácilmente ampliable para otras clases de las hidrolasas, pero podría ser más complicado para desarrollar ensayos con sustratos artificiales para nuevas enzimas que requieren dos desconocidos, por lo general, sustratos para completar su ciclo catalítico.

Para lipasas predichos (fosfo) o fosfatasas ni el sustrato correcto se conoce ni las condiciones de ensayo en el que la enzima funciona bien. Por lo tanto, podría ser útil para estudiar si algún compuesto de una batería de compuestos artificiales, tales como compuestos que contienen-nitrofenil-p distinto (p-nitrofenil fosfato, bis- p-nitrofenil fosfato, p-nitrofenil palmitato), podrían funcionar como sustrato. El descubrimiento de las actividades enzimáticas iniciales con sustratos artificiales ha allanado el camino para resolver SMc00171 que es una fosfolipasa C-PC específico 8, que es una lipasa SMc01003 DAG 11, y ayudó a definir las condiciones bajo las cuales SMc00930 actúa como una hidrolasa 11. Obviamente, el sustrato natural de SMc00930 es actualmente aún se desconoce y los contextos fisiológicos de SMc00930 y SMc01003 están todavía por resolver. Por lo tanto, la tarea de proponer una función fisiológica para una lipasa predicho es difícil y no siempre de inmediato se reunió con éxito. El uso de mutantes deficientes del gen de lipasa predicho y comparándolas a la respectiva cepa de tipo salvaje podría dar evidencia experimental de que la lipasa actúa con la especificidad en su fondo cepa nativa que ha sido postulado en la parte 4) del protocolo. Es evidente que la demanda de una nueva actividad de la lipasa shOuld estar respaldada por pruebas in vitro que un determinado sustrato es convertido por hidrólisis en productos definidos. A veces, la función fisiológica postulado podría llenar los vacíos en las vías metabólicas o explicar el comportamiento fisiológico del organismo productor, pero en otros casos simplemente todavía podría no ser suficiente el conocimiento bioquímico para dar sentido a algunas actividades. En el curso de nuestros estudios, hemos identificado varias enzimas que actúan sobre los lípidos de membrana intrínsecas polares de bacterias degradantes de ellas y, en algunos casos, convirtiéndolos en un jugador en ciclos de lípidos más complejos. Por ejemplo, la combinación de los nuevos conocimientos que SMc00171 es una fosfolipasa C-PC específico (PLCP) 8 que se induce en condiciones de fósforo limitantes de crecimiento, con los datos preexistentes, se puede postular una novela ciclo de DAG que pudiera existir en muchos proteobacteria ambiental y lo que da lugar a la formación de lípidos de la membrana libre de fósforo cuando el fósforo es que limita el crecimiento. en contrast, cuando los suministros de fósforo son abundantes, DAG se rephosphorylated a ácido fosfatídico de entrar en la biosíntesis de novo de fosfolípidos, cerrando así el ciclo de lípidos y asegurar que principalmente (glicero fosfolípidos) están presentes en la membrana de 8,28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue apoyado por becas de Consejo Nacional de Ciencias y Tecnología-México (CONACyT-México) (82614, 153998, 253549 y 178359 de Investigación Científica Básica, así como 118 en Investigación en Fronteras de la Ciencia) y de la Dirección General de Asuntos de Personal Académico-Universidad Nacional Autónoma de México (UNAM-DGAPA; PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
La definición de Sustrato especificidades para la lipasa y la fosfolipasa candidatos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter