Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Lipaz ve Fosfolipaz Adayları için substrat özellikleri tanımlama

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Mikroorganizmalar organizma için dış yüzeyler kullanılabilir hale getirmek için salgılanan (fosfo) lipaz çok geniş bir yelpaze oluşturur. Alternatif olarak, diğer (fosfo) lipazlar fiziksel üreten organizma iç lipidlerin ciro sebep olması ve sıklıkla, hücre membranlarının bir biçimlenme sebebiyet veren ile ilişkili olabilir. potansiyeli (fosfor) lipazlar gen / protein dizisi mevcuttur algoritmaları bir dizi ile tahmin edilebilir, ancak, enzim aktiviteleri, alt-tabaka özgüllükleri ve potansiyel fizyolojik fonksiyonları deneysel kanıtı sıklıkla elde edilmemiştir. Bu yazıda bilinmiyor alt-tabaka özgüllükleri ve nasıl bir ilgili (fosfo) lipaz doğal alt-tabaka için arama, bu optimum koşulların kullanılması ile potansiyel (fosfo) lipazlar için Tayin koşullarının optimize edilmesi açıklanmaktadır. Küçük tespit etmek için yardımcı, p-nitrofenil türevleri gibi yapay kromojenik substratlar, olabilir kullanmaStandart koşullar altında bir tahmin (fosfo) lipaz için enzimatik aktivite. Böyle küçük bir enzimatik aktivite karşılaşmıştır, bir enzim tahlili ayrı parametre ile yapay alt tabaka daha verimli bir hidrolizi elde etmek için değiştiirlebilir. bir enzim çalışır koşulları tespit ettikten sonra, potansiyel, doğal substratlar, çeşitli tenzillerinden tat kromatografik yöntemler kullanılarak takip edilebilir bir işlem test edilmelidir. Yeni enzimler için alt-tabaka özgüllükleri tanımı, genellikle daha sonra deneysel olarak test edilebilir, bu enzimlerin, potansiyel bir fizyolojik rolü için hipotez içerir. Bu yönergeleri izleyerek, biz büyüme fosfor sınırlayıcı koşullara bağlı bakteri Sinorhizobium meliloti membranların remodeling için önemli bir adım olarak, fosfokoline ve diaçilgliserol için fosfatidilkolin bozan bir fosfolipaz C (SMc00171) tespit başardık. İki patatin- tahmin içinAynı organizmanın fosfolipaz (SMc00930 ve SMc01003) gibi, biz onların alt tabaka özgüllükleri yeniden tanımlamak ve SMc01003 bir diaçilgliserol lipaz olduğunu açıklamak olabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu tür triaçilgliserol ve (glisero) fosfolipidler gibi gliserol tabanlı lipidler önemli oluşturmaktadır ve muhtemelen en iyi bilinen lipit sınıfları 1. Triaçilgliseroller (TAG) yağlar ya da genellikle depolama lipidler olarak işlev yağlar, ve bu nedenle potansiyel enerji ve karbon kaynağı olarak bulunmaktadır. TAG'lar sık ​​sık dış TAG sindirmek ve karbon kaynağı olarak kullanılabilir hale getirmek için üreten organizma tarafından salgılanan lipaz tarafından bozulmuş olabilir. Ayrıca, lipazlar yaygın nedeniyle önemli biyo teknolojik uygulamalarda 2 yıl içinde incelenmiştir.

Nedeniyle amfifilik doğası ve onların yakın silindirik şekil, (glisero) fosfolipidler sergi zar oluşturan özellikleri ve genellikle iki katmanlı membranın 3 ana lipidik bileşenlerini teşkil edecek. Bu bakteri Escherichia coli, sadece üç ana kafa grubu varyantları, fosfatidilgliserol (PG), kardiyolipin (CL) ve phosphatid basit mikroorganizmalardabunlardan biri, her biri farklı moleküler türler 4 çok sayıda bir sn farklı yağlı asil zincirleri önemli sayıda -1 ya da sn -2 pozisyonu veren artış ile ikame edilebilir bilmelidir, ancak ylethanolamine (PE), karşılaşılan . Diğer bakteriler diğer fosfolipidler ek olarak veya bunun yerine sahip olabilir. Örneğin, Sinorhizobium meliloti, baklagil yonca (Medicago sativa), bir azot bağlayıcı kök nodül simbiyoz oluşturmak için güçlü bir toprak bakterisi, ikinci bir zitteriyonik fosfolipid, fosfatidilkolin (PC), PE ilave olarak ihtiva eden 5 ile. Ayrıca, lipit içermeyen, fosfor veya gliserol, hücre zarının amfifilik ve form parçası olabilir. Örneğin, fosfor sınırlayıcı büyüme koşullarına bağlı olarak, S. meliloti (glisero) Fosfolipidler, büyük ölçüde, yani sulfolipidlerin, ornitin lipidler ve diacylglyceryl trimethylho fosfor içermeyen membran lipidleri ile ikame edilmektedirmoserine (DGTS) 6. Bakterilerde DGTS iki aşamalı yolun 7 diasilgliserole (DAG) teşekkül eden, fakat DAG üretimi için bir kaynak belli değildi edilir. Darbe kovalayıcı deneyler bilgisayar fosfor sınırlayıcı koşullar altında meydana geldiği ve DAG ve fosfokolin haline PC dönüştürmek olan DGTS 8 için bir ön-madde olarak ve bir fosfolipaz C (PLCP, SMc00171) tanımlayabilir Bu yazıda tarif edilen metodoloji kullanılarak düşündürmektedir 8.

Ayrı bir çalışmada, biz keşfettik bir açil-KoA sentetaz (fadd) S. -açıklı mutant büyüme 9 sabit faz girerken melılotı veya Escherichia coli serbest yağ asitleri birikmiş. Bu yağlı asitler, membran lipitleri elde edilecek gibi görünse de, serbest yağ asitleri ya da bunların serbest bırakılması enzim (ler) için kesin bir kaynak bilinmemektedir. Yine, bu stratejiyi uygulayan bu yazının ana hatlarıyla, iki patatin gibi 10 (fosfo) lipazlar (S. serbest yağ asitleri oluşmasına katkıda SMc00930 ve SMc01003) meliloti 11 tahmin edildi. Şaşırtıcı bir şekilde, SMc01003 o gliserol ve serbest yağ asitleri 11 nihayet monoaçilgliserol ve dönüştürme substrat olarak DAG kullanıldı. Bu nedenle, SMc01003 DAG lipazı (DGLA) 'dir.

Algoritmaları bir dizi potansiyel (fosforo) tahmin etmek için mevcut olmakla beraber 12,13, lipazlar onların hassas fonksiyon ve fizyolojik rolü genellikle bilinmemektedir. Burada klonlamak, bir protokol anahat ve tahmin veya potansiyel (fosfo) lipazlar aşın. Bu el yazması enzim tahlilleri geliştirilmiş ve yapay kromojenik maddeleri kullanarak aşırı (fosfo) lipaz için optimize edilebilir açıklar. Bu bulguların mikrobiyal fizyoloji anlayışımızı zenginleştirecek nasıl optimize edilmiş bir enzim testi ile gerçek (fosfo) lipaz substrat karşılaştı olabilir ve nasıl örnekler sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Öngörülen lipaz 1. Klonlama ve aşın Yapısal gen

  1. Polimeraz zincir reaksiyonu (PCR) 14 ve özel oligonükleotidler (Tablo 1) 15 kullanarak, ilgi (smc01003, smc00930 veya smc00171) geni amplifiye konakçı organizmanın genomik DNA'dan, bir lipaz için kodlama veya fosfolipaz tahmin (örn S. meliloti).
    1. (Oligonükleotid tasarlanmıştır dizisi ile birlikte) bir kısıtlama yerleri sokacak. Karşılık gelen kısıtlama enzimleri ile büyütülmüş DNA fragmanı sindirmek ve pET serisi 16 plazmid gibi bir ifade vektörü içine klonlamak.
    2. Klonlanmış genin doğru DNA dizisinin doğrulanması sonra Escherichia coli BL21 (DE3) pLysS, 16 gibi bir ifade suşu vektörü dönüşümü.
  2. Ifadesi ev sahibi E. bir gecede öncesi kültür hazırlayın E. coli BL21 (DE3) 'e uLYss, 100 ml kültür Luria Bertani etsuyu (LB) 17 20 ihtiva eden şişelere, artı gerekli antibiyotikler, klonlanmış genin veya boş vektör ile ilgili pET vektörü barındıran. Kültür, 30 ° C'de hücreler (veya bir lipaz kaynaklandığı bakterinin normal büyüme sıcaklıkta).
    1. Gece boyunca ön kültürleri kullanılarak, 620 nm (OD 620) = 0.05 başlangıçtaki optik yoğunluk elde etmek için 2 L'lik kültür şişelerinde 500 önceden ısıtılmış LB ortamı ml (artı gerekli antibiyotik) inoküle. Kültürlerin ve OD 620 = 0.3, büyümeyi takip 100 uM nihai konsantrasyona kadar izopropil-β-D-tiyogalaktozid (IPTG) ekleyin ve 4 saatlik bir süre için 30 ° C'de çalkalama altında inkübe edilir.
    2. İnkübasyon süresinin sonunda, 30 dakika boyunca 4 ° C'de 5,000 x g'de 500 ml'lik bir santrifüj tüpüne ve santrifüj her kültür aktarın. Süspansiyon tamponu, 5 ml (ör S bakteriyel hücre pelletleri yeniden süspanseMc00930- ve 50 mM dietanolamin-HCI pH 9.8), 50 mM Tris-HCI, pH 8.0 ve SMc00171-ifade eden hücrelerde hücre SMc01003-sentezleyen. Kullanılana kadar -80 ° C'de hücre süspansiyonları saklayın.

2. Hücre içermeyen protein ekstreleri hazırlamak ve protein konsantrasyonu belirlemek

  1. Bakteriyel hücre süspansiyonları Defrost ve buz üzerinde saklayın. 2'de 20.000 lb hücre süspansiyonları soğuk basınç hücresi ile üç kez geçmektedir. 4 ° C'de 30 dakika boyunca 5000 x g'de santrifüj ile sağlam hücreler ve hücre kalıntıları uzaklaştırılmıştır.
  2. Santrifüj işleminden sonra, bir sonraki analiz için süpernatanından 100 ve 500 ul alikotları hazırlamak ve kullanılana kadar -80 ° C'de saklayın.
  3. Tercih edilen bir yöntem ile ya da 18 tarif edildiği gibi farklı hücre içermeyen ekstreler protein konsantrasyonunu belirlemek için, 100 ul bölüntüde birini kullanabilirsiniz.

Optimize enzimini 3. Yapay Elyaf(Fosfo) lipaz aktiviteleri

  1. Tat enzim faaliyetlerinin bir başlangıç içerisinde için, p-nitrofenolu (s -np) halinde hidroliz üzerine, renkli bir ürün elde yapay substratlar kullanır.
    1. Yapay p-nitrofenil ester, alt-tabakalar ile zaten optimize Enzim tahlilleri için (fosfolipaz C PLCP (SMc00171) tarif edilen, hem de tahmin edilen patatin benzeri fosfolipazlar SMc00930 ve SMc01003 için) kullanımı pipetleme şeması Tablo 2'de tarif edilen.
    2. Yeni bir potansiyel (fosfo) lipaz gezinirken 50 mM Tris-HCl, pH 8.5, 100 mM NaCl,% 0.05 Triton X-100, 0.5 mM p-nitrofenil-içeren bileşik (p-nitrofenil fosfat içeren bir birinci standart enzim deneyi hazırlanması , bis- p-nitrofenil fosfat, p-nitrofenil dekanoat, ya da p-nitrofenil palmitat) ve hücresiz protein ekstresi (kontrol 1, 3, 10, 30, 100, 300 ve 1 toplam hacim içinde 1000 ug) ml 1 ml'lik plastik CUVETTES.
      Not: sürekli bir deneyde p-nitrofenil ester hidrolizi, aşağıdaki kullanımlar alkali pH (Şekil 1). Alternatif olarak, enzim reaksiyonu sonlandırmak için tüm p -np fenolat şeklinde mevcut olduğundan emin olmak için kuluçka süresi sonunda NaOH eklenerek, bir pH değerleri aralığı için tek bir zaman noktası tahlilleri kullanabilir.
    3. 5 dakikalık bir süre boyunca 30 ° C'de bir spektrofotometre p -np oluşumuna bağlı 405 nm'de absorbans bir artış, zaman takip edin. Zaman başına absorbans artışı, ilk eğrisinin eğimi P -np başlangıçtaki düz oluşumunu ölçmek.
    4. Lambert-Beer yasası (ΔA = ε Δc d) 1 kullanılarak p -np için konsantrasyon (Δc) değişimi hesaplayın.
      NOT: ΔA belirlenen absorbans doğrusal değişim, ε M birimlerinde ilgili dalga boyunda molar tükenme katsayısı (-1 cm-1), d ışık yolu (1 cm) uzunluğu ve Δc belirlenecek M birimleri konsantrasyon değişim () yukarı.
      1. Deney hacmi 1 ml olduğu göz önüne alındığında, oluşan p -np miktarını hesaplayın.
        NOT: Tutar = konsantrasyon x hacim.
      2. Bu oluşturulduğu zaman oluşturduğu s -np miktarını bölerek enzim aktivitesinin hesaplanması. Bu aktiviteyi üretilmesi için sorumlu olduğu (mg olarak) protein miktarına göre, enzim aktivitesi bölünmesiyle özel enzim aktivitesi belirlenir.
    5. Bir aday gen (smc00171, smc00930 veya smc01003) Sadece boş bir vektör liman özleri ile ifade edilmişti protein özleri kışkırttığı absorbans değişimleri karşılaştırın.
      Not: Aşağıdaki adımlara devam etmek için bir aday gen olarak ifade edilmiş olan protein ekstrelerinin kaynaklanan belirli faaliyetleri, en az iki veya m olmalıdırSadece boş bir vektör liman protein ekstrelerinin neden belirli faaliyetleri için elde edilen değerlerden daha cevher.
    6. Daha fazla deneyler için, p-nitrofenil-içeren bileşiğin hidrolizi hücre içermeyen özütler (yani, boş vektör) ile p -np en belirgin bir şekilde oluşması ve p -nitrophenolate anyondur (Şekil minimal olduğu gruplardır koşulları seçmek protein özleri, bir aday gen olarak ifade edilmiş olan, kullanıldıklarında, 1) görülmektedir.
  2. 3.1 ilk enzim etkinliğinin belirlenmesi sonra, NaCI konsantrasyonu, pH, tampon türü değiştirilerek ilgili enzim için deney koşulları optimize gücü tampon, örneğin Triton X-100 gibi deterjanlar ve yokluğunda ya da farklı bivalent katyonlar varlığında.
    1. Her değişkenin farklı konsantrasyonu için, (3.1.4.2 bakınız) özel enzim aktivitesinin belirlenmesi (elde edilen en yüksek sayısı koşulu tanımlarmaksimal enzim etkinliğinin). Her bir değişken optimum bir konsantrasyonda mevcut olduğu, optimum enzim tahlili tanımlamak için her bir değişken için karşılaşılan en iyi şartlarda bir arada kullanarak.

Şekil 1
Şekil 1. p-Nitrofenil esterler bir spektrofotometrik tahlilinde (fosfo) lipazlar gibi yapay substratlar. S-nitrofenil esterlerin hidrolizi üzerine, bir asit (R = OH) ve p-nitrofenolu (s -np) oluşturulur. Nedeniyle pKa s -np fenolik H + ayrılması için = 7.2, ile> 9,2 fazla% 99, parlak san bir p -nitrophenolate formu ve 18,000 M-1 sm bir molar sönüm katsayısı olan bir pH değerinde - 1, bir dalga boyu kullanılabilir serbest p -nitrophenolate 22 miktarının 405 nm. 8.5 pH ile tamponlar kullanıldığı zaman, absorbans -1 400 nm ve 14.500 M -1 cm molar sönüm katsayısı belirlenmiştir 23 kullanılmıştır. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

NOT: ilgi enzim aktivitesi için en uygun koşulları tanımlanmış ettikten sonra, bu lipaz fizyolojik / gerçek substrat için arama atılmak. Prensip olarak, genellikle tamamlayıcı iki almak, bu amaca, bir in vivo yaklaşımı veya bir in vitro yaklaşım elde etmek için yaklaşımlar.

Bir lipaz Fizyolojik Yüzey 4. İn Vivo Kimlik

"ove_content> Not: Başka bir in vivo yaklaşımda, bir oluşturmak in vivo yaklaşımda, lipaz ifade host's lipid profili değiştirip değiştirmediğini zamanla kaydetmek için bir konak organizmada 8,11 ilgi lipaz ifade eder. Çevrede 8,11 konusu genin eksikli mutant ve lipid profili, vahşi tip sürüm 6,8,11 farklı olup olmadığını incelemek. organizmanın lipid profili kantitatif bir değerlendirmesini elde etmek için, basit bir yöntem hücresel bileşikler, radyo-etiketleme oluşur , lipidler ayıklanması kromatografi ile ayırarak ve radyoaktif işaretli ayrıldı lipidlerin ölçülmesidir.

  1. Lipidlerin radyo-etiketlenmesi.
    1. İstenen kültür ortamında (karmaşık, orta ya da tanımlanan minimal ortam) 5 ml daki (E. coli veya S. melılotı) bir organizmanın bir gece boyunca kültür öncesi hazırlamak ve 30 ° C'de büyür.
    2. Ön-kültür, sa 20 ml inoküle100 ml'lik bir kültür şişesi içinde me taze ortam ilk OD 620 = kültür 0.3 elde edildi.
    3. steril koşullar altında kültür bir kısım (1 mi) al ve 14 ml steril polistiren yuvarlak tabanlı bir tüpe aktarılır.
    4. 1 ml kültüre [1- 14C] asetat (mmol başına 60 mCi) 1 uCi ekleyin.
    5. 24 saatlik bir süre için 30 ° C'de çalkalama altında sıvı bir kültürün inkübe edin.
    6. İnkübasyon süresinin sonunda, 5 dakika boyunca oda sıcaklığında 12.000 xg'de 1.5 ml mikrosantrifüj tüpü ve santrifüj kültürünün aktarın.
    7. su, 100 ul pelletini. Bu noktada, -20 ° C'de bir hücre süspansiyonu depolar ya da hemen polar lipidler (Bölüm 4.2) ekstraksiyonu ile devam edin.
  2. polar lipidler çıkarımı.
    NOT: esasen burada anlatılan yöntem Bligh ve Dyer 19 tarafından bildirilen prosedürü takip eder.
    1. Sulu hücre asmalar 100 ul için(:; Vol / vol 1 2) kloroform çözüm: ension, metanol 375 ul ekleyin.
    2. 30 saniye vorteksleyin ve oda sıcaklığında 5 dakika inkübe edilir.
    3. Santrifüj 5 dakika oda sıcaklığında 12.000 xg'de.
    4. yeni bir 1.5 ml mikrosantrifüj tüpüne süpernatant aktarın.
    5. kloroform 125 ul su ve 125 ul, girdap 30 sn ekleyin.
    6. Santrifüj 1 dak oda sıcaklığında 12.000 xg'de.
    7. bir azot gazı akımı ile, yeni bir tüpe ve kuru alt kloroform fazı aktarın.
    8. (:; Hacim / hacim 1: 1), metanol çözeltisi: kuru kloroform 100 ul lipidleri çözülür.
      NOT: Bu noktada, yağ çözeltisi, 5 ul bir alikosu, sıvı sintilasyon sayımı ile tayin edilebilir.
    9. ince tabaka kromatografisi (TLC) analizi için, bir azot gazı akımı, geri kalan 95 ul aşağı kurutun ve 20 kloroform ul kurutulmuştur lipitleri çözülür: metanol çözeltisi (1: 1; hac / hac). 3 ul tablet kullanınTLC analizi için.
  3. İnce tabakalı kromatografi (TLC) ile bir polar lipidler ayrılması.
    NOT: lipit sınıfları bağlı olarak analiz edilmesi, bir katı ve mobil fazların farklı kombinasyon ayrılması için kullanılabilen. Burada katı faz yüksek performanslı ince tabaka kromatografisi (HPTLC) silis jel, alüminyum levhalar kullanılarak nötr polar lipidler için daha uygun şarj polar lipidler ve başka, tipik bir ayırma özetlenmiştir.
    1. iki boyutlu TLC (2D-TLC) tarafından tahsil polar lipidler ayrılması.
      1. HPTLC silika jel alüminyum levha (10 x 10 cm), levhanın kenarı 2 cm bir köşesinde lipid Numunenin 3 ul tablet uygulanır.
      2. Hazırlama ve birinci boyutta ayrılması için mobil faz (140 mi kloroform, 60 mi metanol ve 10 ml su) karıştırınız.
      3. Coat kromatografi kağıdı ile içten bir TLC gelişmekte odası.
        Not: Bu sağlamak olduğunu odasının gaz fazıilk boyut mobil aşamasından sonra (30 dakika içinde) hızlı bir şekilde doyacak bölmeye eklendi ve oda bir cam plaka ile kapatıldı.
      4. Hazırlama ve mobil faz karışımı (130 mi kloroform, 50 mL metanol ve asetik asit 20 ml buzlu) dahili kromatografi kağıdı ile kaplanmış bir ikinci TLC gelişmekte olan bölmeye, ikinci boyutta ayırma ve transfer ve oda doyurulması sağlar.
      5. Dikkatle ilk boyut 5 kapalı bir odada, 60 dakika boyunca (yani, kromatografi yerine) plaka birinci bölme kurutularak lipit numune ile HPTLC silika jel alüminyum levha transferi ve geliştirilmesi.
      6. odasından plaka çıkarın ve çözücüler 30 dakika boyunca bir akış kaputu kapalı kurumaya bırakın.
      7. Önceki kromatografi ile ilgili olarak 90 derece plaka açtıktan sonra, secon için, lipitler bir boyutta ayrılmıştır üzerinde HPTLC silika jel alüminyum levha transferD odası ve ikinci boyut 5 60 dakika boyunca plaka geliştirir.
      8. odasından sayfasını çıkarın ve çözücüler en az 2 saat süreyle bir akış kaputu kapalı kurumaya bırakın.
    2. nötral polar lipidler ayrılması.
      1. levhanın kenarlarından 2 cm başlayarak HPTLC silika jel alüminyum levha lipid örnekleri 3 ul alikotları uygulanır. Birden çok numune tek boyutlu kromatografi analiz ise, farklı örnek uygulama noktaları arasında en az 1.5 cm bir mesafe bırakmak.
      2. mobil faz hazırlayın ve karıştırılır (140 mi heksan, 60 mL dietileter, ve 8 ml asetik asit) dahili kromatografi kağıdı ile kaplanmış ve oda doyurulması (30 dakika) sağlamak için bir cam levha ile kaplanmış bir ince tabaka kromatografisi, gelişmekte odasına transfer.
      3. bölme kurutularak lipit örnekleri ile HPTLC silika jel alüminyum levha transfer ve kapalı bölme 30 dakika boyunca plaka geliştirir.
      4. odasından plaka çıkarınve çözücüler 2 saat için bir akış kaputu kapalı kurumaya bırakın.
  4. Sayısallaştırılması ve ayrılan polar lipidler görselleştirme.
    1. geliştirilmiş TLC tabaka kuruduktan sonra, 3 gün süre ile kapalı bir kaset bir ışığa duyarlı lüminesans (PSL) ekran ile inkübe edin.
    2. Bir PSL tarayıcıya kuluçkaya ekranı Açığa ve ayrılan radyoaktif işaretli lipidlerin bir sanal görüntü kazanır.
    3. PSL yazılımı 20 kullanılarak ölçümü gerçekleştirin.
  5. Görselleştirme ve bireysel polar lipid sınıfların izolasyon.
    1. iyot kristalleri 1 g mevcudiyetinde bir kromatografi odası içinde 10 dakika boyunca, gelişmiş TLC levha inkübe edin.
      NOT: Ayrı lipidik bileşikler iyot çözülür ve kahverengimsi lekeler olarak görünür.
    2. Çember bir kalemle noktalar, standart bileşikler (yani, 1,2-dipalmitoyl- sn-gliserol, dipalmitoil-L-α-Fos nispi hareketlilik (R f) bunları karşılaştırmakphatidylcholine, DL-α-monopalmitin veya palmitik asit) ve onlar ait olabilir hangi lipit sınıfı tanımlamak.
    3. Davlumbaz, iyot TLC sacdan buharlaşmasına izin verin.
    4. Kloroform çözeltisi (2: Bir spatula yardımıyla tabakadan ilgi konusu bileşiği ihtiva eden silika jel kazımak ve suyun 100 ul metanol 375 ul bir karışımı ile, silika jel den bileşik elde 1; Vol / hacim).
    5. (Itibaren 4.2.2) belirtildiği gibi Bligh ve Dyer göre ekstraksiyon ile devam edin.
    6. Kullanılana kadar -20 ° C'de, (hac / hac 1: 1), metanol çözeltisi: kloroform 100 ul saklayın saflaştırılmıştır lipit sınıfı.

Bir lipaz Fizyolojik Yüzey 5. İn Vitro Kimlik

NOT: Bir in vitro yöntemde, ilgi konusu lipaz mukabil Hidrolojik izole lipitler veya bağımsız olarak saf bir lipit karışımı dönüştürmek olup olmadığını incelemek3.2 optimum olarak tanımlanan koşullar altında Salman kararı ürünleri.

  1. PC-spesifik fosfolipaz C SMc00171 (5.2), fosfolipaz A (5.3), ve DAG lipaz SMc01003 için Tablo 3'de göre enzim testleri için pipet şemalarını kullanın aktivitesini (5.4).
  2. PC özgü fosfolipaz C aktivitesinin (Tablo 3) belirlenmesi.
    1. 1.5 ml mikrosantrifüj tüpü için, dakika başına 5000 sayımları toplam 14 C-etiketli PC (CPM) ve Triton X-100 içeren bir çözelti ilave edin.
    2. bir azot akımı altında karıştırın ve kurutulur.
    3. 99.5 ul bir son hacim elde etmek için dietanolamin-HCl, pH 9.8 tampon, hem de NaCI ve MnCl2 çözümleri ve bidistile su ilave edilir. 5 saniye vorteksleyin.
    4. Enzim (5 ug protein), 0.5 ul ekle reaksiyonun başlatılması için (örneğin, bir hücre barındırmayan özü içinde SMc00171 mevcut aşırı eksprese). kısaca karıştırın.
    5. 4 saat 30 ° C'de inkübe edin.
    6. tarafından reaksiyonu durdurmakmetanol, 250 | il kloroform 125 ul eklenmesi.
    7. daha önce açıklandığı gibi lipidler (4.2) ayıklayın.
    8. tek boyutlu (1D) -TLC ile ayırın lipidler (4.3.2 ve 4.4) ve PSL görüntüleme ile bunları analiz.
  3. Fosfolipaz A aktivitesinin belirlenmesi (Tablo 3).
    1. 1.5 ml mikrosantrifüj tüpü için, 5000 toplam 14 C-etiketli fosfolipidlerin CPM ve Triton X-100 ihtiva eden bir çözelti ilave edin.
    2. bir azot akımı altında karıştırın ve kurutulur.
    3. bir son 100 ul tahlil için, Tris-HCI, pH 8.5 tampon, NaCl çözeltisi ve su ilave edilir. 5 saniye vorteksleyin.
    4. Enzim 5 ul (50 ug protein), ekleme (örneğin, bir hücre barındırmayan özü içinde SMc00930 ya SMc01003 mevcut aşırı eksprese).
    5. 5 saat boyunca 30 ° C'de inkübe edin.
    6. metanol, 250 | il kloroform 125 ul ilave ederek reaksiyonu durdurun.
    7. Ayrı daha önce açıklandığı gibi lipidler (4.2) Özü1D-TLC 130 mi kloroform, 50 mL metanol, ve mobil faz olarak 20 mL buzlu asetik asit kullanılarak PSL görüntüleme ile analiz ile bunları.
  4. diaçilgliserol (DAG) lipaz aktivitesinin belirlenmesi.
    1. 14C-etiketli DAG hazırlanması.
      1. Radyoetiket S. meliloti kültürleri (4.1) ve açıklandığı gibi (bkz: 4.2) kutup lipitleri ayıklayın. Ayrı S. metanol: kloroform 1D-TLC ile meliloti toplam lipid özler, asetik asit (130: 50: 20; hacim / hacim) 4.3.1 ikinci boyutta ayrılması için tarif edilen koşullar kullanılarak.
      2. iyot boyama ile PC görselleştirmek ve fosfatidilkolin (PC) lokalizasyonu işaretlemek için bir kalem kullanın.
      3. 4,5 de tarif edildiği gibi radyoaktif olarak işaretlenmiş bir PC izole edin.
      4. sintilasyon sayımı ile çıkarılan PC ölçmek.
        NOT: Yaklaşık 320.000 cpm PC bekleniyor.
      5. 50 mM Tris-HCI, pH 7.2, 0.5 Clostridium perfringens elde edilen fosfolipaz C 0.1 U PC (250,000 cpm) tedavisinde% Triton X-100 ve 100 ul toplam hacim içinde 2 saat süreyle, 10 mM CaCl2 ve metanol 250 ul kloroform 125 ul ilave etmek suretiyle reaksiyonu durdurun.
      6. 1D-TLC (4.3.2 bakınız) onlar tarafından daha önce ve ayrı açıklandığı gibi lipidler ayıklayın.
      7. Silika plakası diasilgliserol izole etmek ve (4.2 de tarif edildiği gibi), sintilasyon sayımı ile ölçmek
    2. Diaçilgliserol lipaz deneyi (Tablo 3).
      1. 1.5 ml mikrosantrifüj tüpü için, 5000 14C etiketli DAG CPM ve Triton X-100 ihtiva eden bir çözelti ilave edin.
      2. bir azot akımı altında karıştırın ve kurutulur.
      3. bir son 100 ul tahlil için, Tris-HCl (pH 9.0) tampon maddesi, bir NaCI solüsyonu ve bidistile su ilave edilir. 5 saniye vorteksleyin.
      4. enzim 5 ul (hücresiz ekstraktı 50 ug protein) eklenerek reaksiyon başlatılır.
      5. 4 saat 30 ° C'de inkübe edin.
      6. Metanol 250 ul ilave ederek reaksiyonu durdurunDaha önce tarif edildiği gibi kloroform ve ekstre lipidlerin D 125 ul (4.2).
      7. 1D-TLC (4.1.3.2) ve daha sonraki PSL görüntüleme nötr kutup lipidlerin analiz edin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bis p-nitrofenil Fosfat PC özgü Fosfolipaz C SMc00171 Faaliyet

E. elde edilen hücre içermeyen özütler E. coli BL21 (DE3) 'smc00171 oluşan s -np ölçme bir spektrofotometrik enzimatik analiz kullanılarak, bis- p-nitrofenil fosfat esterleri hidrolize etme kabiliyetleri açısından incelendi ifade vardı pLysS, x. Resim hidrolitik aktivitesi E. elde edilen hücresiz ekstrelerinde mevcuttu p-nitrofenil fosfat alt tabakası olarak kullanılmıştır bis zaman (veriler gösterilmemiştir) E. coli BL21 (DE3) pLysS X boş pET9a vektörü barındıran.

Oluşan s -np için zaman içerisinde SM sahip pLysS x, E. coli BL21 (DE3) hücre içermeyen ekstresi miktarı kuvvetli bir bağımlılık (olduğunu göstermektedirc00171) olarak ifade edilmiştir deneyi (Şekil 2A) ilave edildi. Oluşan s -np ürününün miktarı enzim konsantrasyonu sadece bağlı olacaktır ise, belirli bir süre sonra oluşan enzim (protein) arasında doğrusal bir ilişki konsantrasyonu kullanılabilen ve ürün gözlenmelidir. Açıktır ki, bu E. elde edilen hücre içermeyen ekstreler için geçerli değildir E. coli BL21 (DE3) 'smc00171 ifade olan pLysS (Şekil 2B) x. Protein konsantrasyonu 21 enzim etkinliğinin bir üstel bağlı bir çok nedeni olabilir, ancak sık sık sebebi enzim içeren bir protein ekstresi seyrelmesi üzerine, özü diğer bileşenler, enzim aktivitesi, örneğin, potansiyel kofaktörler için sınırlayıcı edilebilir olmasıdır yanı sıra seyreltilir. Bu gibi durumlarda, beklenmedik bir şekilde, düşük enzim aktiviteleri seyreltilmiş hücre içermeyen özütler kayıtlıdır. Enzim tahlilinde MnCl2 3 mM'lik bir doyma konsantrasyonunu dahil ederek, s Belirli bir zaman yalnızca enzim miktarına bağlıdır sonra oluşan -np ürün MnCl2 E. hücresiz özütlerinde SMc00171 aktivitesi için sınırlayıcı bir bileşen olduğunu belirten (veriler gösterilmemiştir) ilave E. coli.

şekil 2
Yapay alt tabaka bis p-nitrofenil fosfat kullanılarak SMc00171 (fosfolipaz) aktivitesinin Şekil 2. belirlenmesi. S -np oluşumu için zaman süreci, 15 ug / ml n, 10 ug / ml ● (hücresiz protein özleri kullanılarak olarak gösterilmektedir ▲ SMc00171 (ifade edilmiş olan A). SMc00171 ifade edilmiş olan hücresiz protein özleri farklı miktarlarda (B) inkübasyon 40 dakika sonra, oluşan p -np 20 ug / ml). Hata çubukları standart sapmayı belirtir..jove.com / files / ftp_upload / 54613 / 54613fig2large.jpg "target =" _ blank "> bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Farklı zincir uzunluğu p-Nitrofenil Asil Esterlerinin Fosfolipazlar SMc00930 ve SMc01003 Öngörülen Patatin benzeri faaliyetleri

E. smc00930 ya smc01003 sentezlenmesi sonra E. coli BL21 (DE3) pLysS, hücre içermeyen özütler elde edilmiş ve p-nitrofenil yağlı asil esterler hidrolize etme kabiliyetleri açısından incelenmiştir x. Enzimatik Deney sırasında oluşan s -np bir spektrofotometresinde tayin edildi. Küçük hidrolitik etkinlikleri E. elde edilen hücresiz ekstrelerinde mevcuttu differe coli BL21 (DE3) boş pET17b vektörü ile pLysS x (Tablo 4) p-nitrofenil asil esterlernt zincir uzunlukları substrat olarak istihdam edildi. Smc01003 ifade edildiğinde, elde edilen ekstreler, farklı zincir uzunluklarına p-nitrofenil esterleri artmış hidroliz gösterdi. SMc01003 orta zincirli p-nitrofenil dekanoat yanı sıra uzun zincirli p-nitrofenil palmitat ve p-nitrofenil stearat (Tablo 4) bozulmuş. SMc01003 S. uzun zincirli serbest yağlı asitlerin formasyonu için önemli bir etken olduğu gibi meliloti durağan faz 11 sırasında, SMc01003 uzun zincirli p-nitrofenil asil esterler (Tablo 4) göre daha orta zincir üzerinde eşit olarak hareket görülmesi şaşırtıcı idi. Beklenmedik bir şekilde, SMc01003 da p-nitrofenil butirat ya da p-nitrofenil oktanoat kısa zincirli alt tabakalar üzerinde hareket eder (veriler gösterilmemiştir). Bununla birlikte, bu ikinci alt-tabakalar, aynı zamanda, E., hücre içermeyen özütler mevcut faaliyetleri tarafından parçalanan E. coli (yani, boş vect barındıranya da herhangi bir ilave gen ve kısa zincirli substratlar (C4) ifade etmeden pET17b), alt-tabaka yarısının E. tarafından parçalanır E. coli iç enzimler (veriler gösterilmemiştir). Açıkçası, SMc01003 SMc01003, kısa, orta ve uzun zincirli yüzeylerde eşit derecede iyi çalışır olup olmadığını netleştirmek için saflaştırılmış gerekmektedir. Genel olarak, p-nitrofenil asil esterler SMc01003 gerçeklik bir DAG lipaz 11 olduğunu bilerek anlaşılır olabilir SMc01003 için iyi yüzeyler olmak değil gibi görünüyor. Smc00930 ifade edilmiş olan hücre içermeyen özütler, p-nitrofenil esterleri (Tablo 4) çok daha yüksek enzim aktivitelerini göstermektedir. (- 1 mg protein - 1 spesifik aktivitesi 5.5 mmol NP dakika) açık bir şekilde p-nitrofenil palmitat olsa da, SMc00930 farklı zincir uzunlukları (C10, C12, C14, C16 ve C18) p-nitrofenil asil esterler hidrolize edebilmektedir SMc00930 en iyi alt-tabaka. Bugüne kadar, physioloSMc00930 için jik alt-tabaka olarak bilinmemektedir.

İster Polar Lipidler keşfetme Öngörülen (Phospho) lipaz için Substratlar olarak işlev Can

A (fosfo) lipaz enzimatik deney, yapay substratlar, radyo-etiketli lipit karışımları veya saf lipidlerle optimize edildikten sonra, potansiyel alt-tabakalar olarak test edilebilir.

Optimize edilmiş koşullar altında 14 C-etiketli PC ile hücre içermeyen özütler SMc00171 içeren tahlil zaman, SMc00171 DAG, kütle spektrometrik çalışmaları 8 ile doğrulandı sonucu PC bozunduğunu gösterebilir. SMc00171 Ayrıca büyüme fosfor sınırlandığı koşullar altında uyarılır, bir bilgisayar özgü fosfolipaz C (PLCP) 8 olarak hareket eden, bu nedenle fosfokoline 32 P-etiketli PC çözülür ve.

Ne zamantahlil SMc00930- ya SMc01003 içeren optimize edilmiş koşullar altında 14 C veya 32-işaretli toplam polar lipidler ile hücre içermeyen özütler, biz fosfolipidlerin yok p-nitrofenil asil esterler görev koşullar altında SMc00930 ya SMc01003 dolayı derece kaybeder ve olduğunu gösterebilir olarak 11 alt tabakalar. Bunun aksine, yılan zehirinden bir ticari bir fosfolipaz A2 fosfolipid 11 böyle bir karışım indirgeme edebildi. Bu sonuçlar şaşırtıcıdır ve hem de beklenmedik, SMc00930 ve SMc01003, fosfolipazlar gibi patatin olarak tahmin edildi.

SMc00930- ya SMc01003 içeren optimize edilmiş koşullar altında 14 C-etiketli diaçilgliserol (DAG) ile hücre içermeyen özütler, biz DAG SMc00930 veya E. hücre içermeyen özütler tarafından bozulmaz gösterilebilir tahlil zaman E. coli, SMc01003 DAG çözülür ve serbest yağ asitleri gibi göç bileşikler oluşturmaktadır buna karşın (Şekil 3). Son zamanlarda biz SMc01003 DAG düşürebilir veya gliserol ve serbest yağ asitleri 11 (Şekil 4) monoaçilgliserol bir DAG lipaz olarak hareket ettiğini gösterebilir.

Şekil 3,
Şekil 3. SMc01003 diaçilgliserol düşürür. E. hücre içermeyen özütler pLysS SMc01003, SMc00930 ifade veya boş pET17b vektörü içeren, veya tampon x coli BL21 (DE3) 24 saat için (S. meliloti de elde edilmiş) 14 C-DAG ile inkübe edilmiştir. ilgili kuluçka süresi sonunda, radyo-etiketli lipitlerin ekstre edildi ve nötr kutupsal lipitler ayrılması için mobil faz (4.3.2) ile 1D-TLC ile ayrıldı. FA, yağ asitleri; DAG, diaçilgliserol. Bu rakam [Sahonero-CANAVESI ve ark. 2015] 11 modifiye edilmiştir.3large.jpg "target =" _ blank "> bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 4,
Şekil 4. Enzimatik diaçilgliserol lipaz DGLA (SMc01003) fonksiyonu. Diaçilgliserol (DAG) lipaz SMc01003 monoaçilgliserol ve bir yağ asidi için DAG düşürür ve daha sonra gliserol ve başka yağ asidi daha da monoaçilgliserol alçaltır. Bu büyük halini görmek için tıklayınız rakam.

oligonükleotid
isim
Sıra
(5'-3 ')
Gen
ilgi
Enzim kısıtlama
Site eklendi
Vektör
ifadesi için
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 Nde pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xhol pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 Nde pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 BamHI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 Nde pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 BamHI pET9a
Kalın harfler kısıtlama siteleri gösterir.

Yükseltmek ve klonlamak için kullanılan Tablo 1. Oligonükleotidler pET17b ya pET9a vektörüne fosfo (lipaz) genleri tahmin. Primer oligonükleotidler tarif yazılımı 15 ile tasarlanmıştır.

SMc00171 için tahlil SMc01003 için tahlil SMc00930 için tahlil
Stok Bileşen
Tris-HCI, pH 8.5 25 ul
2M Tris-HCI, pH 9.0 25 ul
1M dietanolamin-HCI, pH 9.8 50 ul
1M NaCI 40 ul 150 ul 150 ul
% 1 Triton X-100 200 ul 200 ul
50 mM p-nitrofenil palmitat 12.5 ul 12.5 ul
200 mM bis p-nitrofenil fosfat, 2.5 ul
hücresiz özü (1 mg protein,N aday gen / ml) olarak ifade 20 ul 100 ul 1 ul
Bidistile su 887,5 ul 512,5 ul 611,5 ul
son hacim 1 mi 1 mi 1 mi

Yapay p-nitrofenil ester substratları ile optimize edilmiş enzim testleri için Tablo 2. Pipetleme şemaları.

Smc00171 kodlanmış Fosfolipaz C için tahlil Smc01003 için tahlil - kodlanmış DAG lipaz Fosfolipaz A etkinlik için optimize tahlil
Stok Bileşen
2M Tris-HCI, pH 8.5 2.5 ul
2M Tris-HCI, pH 9.0 2.5 ul
100 mM MnCl2 3 ul
1M Dietanolamin-HCI pH 9.8 5 ul
1M NaCI 4 ul 15 ul 15 ul
% 1 Triton X-100 2 ul 20 ul 20 ul 14C-etiketli lipit (fosfolipit) 20 ul (5.000 cpm)
14C işaretli sfingosin (PC) 20 ul (5.000 cpm)
14C işaretli sfingosin (DAG) 20 ul (5.000 cpm)
10 mg / ml ifade aday genler ile protein ekstresi 0.5 ul 5 ul 5 ul
Bidistile su 87.5 ul 77,5 ul 77,5 ul
nihai hacmi 100 ul 100 ul 100 ul

tabloiçin optimize edilmiş enzim testlerinin (fosfo) 3. Pipetleme şemaları radyo işaretli sfingosin substratlan olan lipazlar.

etkinlik (mmol nitrofenol / mg protein x dk) birimleri cinsinden verilir
Kalın p sayılan-nitrofenil ester, alt-tabakanın asil zinciri uzunluğuna işaret 10 12 14 16 18
E.coli özü (arka plan) 16 ± 0.3 10 ± 1.1 13 ± 0.3 11 ± 0.8 10 ± 0.6
SMc00930 E. ifade E. coli ekstresi 1.839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
SMc01003 E. ifade E. coli ekstresi 43 ± 2.1 29 ± 2 20 ± 0.7 25 ± 1.5 22 ± 0.9
SMc00930 eksi zemin 1823 ± 283 1829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 eksi zemin 27 ± 2.1 18 ± 2 7 ± 0.7 14 ± 1.5 12 ± 0.9

Patatin gibi lipazlar SMc00930 ve SMc01003 için substrat olarak Tablo 4. p Nitrofenil asil esterler.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Son 20 yılda, birçok organizmanın genomu dizilimi edilmiş ve genom dizisi verilerin bir zenginlik üretilen olmasına rağmen, fonksiyonel yorumlama geride ve bu nedenle genom fonksiyonunun anlayışımızı engellemektedir edilir. genomları Gen fonksiyonları genellikle bilinen işlev veya korunmuş motiflerinin oluşum genlerine benzerliğine dayalı atanır. Bununla birlikte, belirli bir genin tam işlevi genellikle bilinmez. Özellikle, enzimler için yapısal genler nedeniyle kolaylıkla en enzimler iki yüzeyler ve iki ürünü içeren karmaşık reaksiyonları katalize gerçeğine omic tekniklerle keşfedilmeyi olamaz öngördü. Halen, en azından bir alt-tabaka sabittir ve burada değiştirilebilir burada enzim grupları için alt-tabaka özgüllükleri keşfetmek için daha uygundur görünmektedir. Örneğin, ökaryotlar içindeki proteinlerin en fosforillenme motifleri bilinen kinazlar için konsensüs peptidler peptid AR oluşturmak için bir katı destek üzerinde tespit edilmiştir edilirışınlar. Bir kinome profilinin kurulması izin belirlenebilir Bu diziler ve radyo-etiketlenmiş ATP, alt-tabaka özgüllükleri ile bir organizmanın farklı kinazlann aktivitesi seviyelerinin kullanılması ve alt tabakayı oluşturan 24 özgüllükler. Hidrolazlar bir alt tabaka, su, sabit fakat hangi (diğer) alt tabakanın hassas doğası genellikle bilinmemektedir hidroliz edilecek olan enzimlerin başka büyük bir grup oluşturur. Yeni bir enzim için optimum deney koşullan ya bilinmektedir değildir aslında, bir çok değişkenli problem yeni bir enzim etkinliğinin bulgulanması dönüştürür. Bu nedenle enzimin en iyi şekilde çalışır hangi koşullar altında tanımlamak amacıyla hidroliz edilecek alt tabakayı düzeltmek mümkün yardımcı olabilir.

Mevcut yazıda, prospektif (fosfo) için Tayin koşullarının optimize edilmesi tarif bilinmiyor alt-tabaka özgüllükleri olan lipazlar ve yeniden doğal alt-tabaka için arama, bu optimum koşulların kullanılması nasıl ayrıntılıprospektif (fosfo) lipaz. Bu tekniğin anlamı bir ölçüde doğal substratlar taklit florojenik veya kromojenik yapay substratlar, hidrolizi, spektrometri 25 ile takip edilebilir aslında oluşur ve bu deneyler, büyük ölçekli kolay uygulanabilir olduğu 26 inceler. Ötürü, bu gibi tahliller duyarlılık ve tepkisini izlemek için basitlik için, kolay, belirli bir enzim için optimize edilebilir. Açıkçası, yapay yüzeyler için bir daha az elverişli kinetik sabitleri bekliyor olabilir (yani, yüksek K M, düşük k kedi) doğal yüzeylerde 1,21 için daha spesifik bir enzim için. Ancak uygulamada, yapay substratlar kolay kullanılabilirliği ve tespit dezavantajları telafi genellikle daha fazla enzimin bütün grupları için (kötü) alt tabakalar olarak işlev yapar. (Yapay alt tabaka ile) çalışmak için bir enzim için koşullar karşılaşmıştır sonra, Natur ile yapacaktırgibi diğerleri fizyolojik / alt-tabaka. Potansiyel lipit substratların hazırlanması ve izole edilmesi zahmetli ve zaman alıcı olabilir, bir enzim birleştiren ve değerli substratlar ile inkübe zaman çalışmaya hazır olduğunu güvence olması önemlidir. Önemli bir şekilde, ilk olarak bir enzim çalışması için koşulları optimize prosedürü, yeni bir (fosfo) lipaz fizyolojik alt-tabaka daha hızlı bir olanak sağlayacak. Kavramının bir kanıtı olarak, başarılı bir lipaz SMc00171, SMc00930 ve SMc01003 8,11 substrat özgünlükleri karakterizasyonu için bu yöntemi kullanmışlardır. Buna karşılık, (fosfo) lipaz etkinlikleri için tahliller oluşturulması pek çok geleneksel, alternatif yöntemler alt-tabaka ve ürün, daha önce bilinen reaksiyonlarla içerir.

Açıktır ki, tahliller modifikasyonları işaretlenmiş yapay substratlar, kromojenik veya başka türlü varyasyonu, diğer florojenik kullanımını içerebilir uygun enzim etkinliği tespit etmek içinenzim konsantrasyonu, tipi ve tampon konsantrasyonu ya da başka katkı maddeleri (örneğin, deterjan veya iki değerli katyonlar). Hiçbir enzim aktivitesi yapay substratları ile tespit edilirse, ilgili enzim sadece bu alt tabaka ile işe yaramayabilir, ama bu gibi durumlarda sorun giderme kesinlikle enzim aktivitesi bozulmadan korumak için gerekli olabilir tüm önlemler alınmıştı güvence var içermelidir 27 (gerekirse örneğin 4 ° C'de hücre içermeyen özütler veya kullanıma kadar düşük sıcaklıklar ve depolanması, için hücre içermeyen özütler proteaz inhibitörlerinin kokteyl ilave ilgi enzimin proteolitik bozulmasını önlemek için).

Bu yazıda sunulan teknik sınırlamaları katalizli reaksiyon yanı sıra 1 olacak suni substrat ve doğal alt tabaka Biyoenerjetiğin birbirlerinden ve sonuç olarak farklı olmasından kaynaklanmaktadır. çeşitli parEnzim faaliyetin en iyi koşullar için metreler, doğal alt-tabaka için, aynı zamanda kurulmalıdır (güç tampon, tampon türü pH değiştirilerek, örneğin Triton X-100, yokluğunun ya da farklı bivalent katyonlar varlığında olarak NaCl ve deterjan konsantrasyonu), onlar söndürmeden olabilir yapay alt tabaka için karşılaşılan en uygun şartlarda biraz farklı olması. Diğer önemli bir sınırlama, muhtemelen Tüm (fosfo) lipazlar yapay kromojenik alt-tabakaların kullanımı ile tespit edilebilir olmasıdır. Örneğin ester yüzeylerde yapay p-nitrofenil kalıntısı sadece çok hantal, ya da böyle bir alt tabaka, bir enzimin aktif sitesine erişim alabilirsiniz engelleyen diğer kimyasal özelliklerini ortaya çıkarabilir. Bu DAG lipaz SMc01003 farklı zincir uzunlukları 11 tüm p-nitrofenil ester, alt-tabakalar ile, düşük aktivitelerini gösterdiği tespit edilmiştir. DAG SMc01003 ve doğal substrat olan bilgi birikimi ile DAG bir rel vardırgliserol oluşan lişmekte küçük polar baş grup, sadece 11 kadarı hantal p-nitrofenil kalıntısı sadece SMc01003 aktif sitesine kolay erişim için çok büyük olduğunu kolayca hayal olduğunu. Bununla birlikte, SMc01003 p-nitrofenil esterler iyi alt tabakalar değil neden molekül detayları bu noktada bilinmemektedir.

protokolü içinde kritik adımlar çalışılan enzim ilgili alt tabakaya erişimi sağlamak için alınan tüm hükümler içermektedir. Örneğin, fizyolojik sfingosinin arayışında, lipid substratı bir çözünmüş formda sağlanan çok önemlidir. Bu enzim tahlilleri ayarlarken Bu nedenle, (protokol 5'te tarif edilmiştir), genellikle metanol karışımları içinde çözülmüş lipidik substratlar: kloroform örneğin, bir deterjanın sulu çözeltisi ile karıştırılmalıdır, Triton X-100, kesilmeden önce kurutulması azot gazı ile karışımıdır. Bu prosedür sağlar, bu diğer Ingré ekledikten sonraDeney için tartarken potansiyel lipid sübstratı deterjan miseller ve tahlil sırasında enzim için, erişilebilir şekilde yerleştirilmiştir.

Prensip olarak, burada sunulan teknik yeni (fosfo) lipaz bulunması ve bunların doğal substratların tanımı için gelecekte yaygın olarak uygulanabilir olmalıdır. teknik Hidrolazların diğer sınıflar için kolayca genişletilebilir, ama onların katalitik döngüsünü tamamlamak için iki, genellikle bilinmeyen, substratlar gerektiren yeni enzimler için yapay substratları ile deneyleri geliştirmek için daha karmaşık olabilir.

tahmin (fosfo) lipaz veya doğru substrat ne bilinir fosfatazlar ne enzim iyi çalıştığı tahlil koşulları için. Bu nedenle, bu çalışma için yararlı olabilir örneğin tat p-nitrofenil-ihtiva eden bileşikler (s-nitrofenil fosfat, bis- p-nitrofenil fosfat gibi yapay bileşikleri, bir pil bir bileşik olup, p-nitrofenil palmitat), substrat olarak işlev olabilir. Yapay yüzeylerde ile ilk enzim faaliyetlerinin keşif SMc01003 bir DAG lipaz 11 olduğunu, SMc00171 PC özgü fosfolipaz C 8 olduğunu çözmek için yol açmıştır, ve SMc00930 bir hidrolaz 11 gibi davranan hangi şartlar altında tanımlamak için yardımcı olmuştur. Açıkçası, SMc00930 doğal substrat şu anda hala bilinmeyen ve SMc00930 ve SMc01003 fizyolojik bağlamları hala çözülecek olan. Bu nedenle, bir tahmin lipaz için bir fizyolojik fonksiyonu öneren görevi zordur ve her zaman hemen başarı ile bir araya geldi değil. tahmin edilen lipaz geninin eksik mutantlar kullanılarak ve ilgili vahşi tip suşu ile karşılaştırılması lipaz protokolünün bir parçası 4) 'de ileri sürülmüştür doğal suş arka özgüllük ile hareket olduğunu bulmuşlardır verebilir. Açıkçası, yeni bir lipaz aktivitesi sh iddiasıBelirli bir alt tabaka tanımlanan ürünler haline hidroliz yoluyla dönüştürülür in vitro kanıtlarla desteklenmelidir ould. Bazen öne fizyolojik fonksiyonu metabolik yollarda boşlukları doldurmak ya da üreten organizmanın fizyolojik davranışlarını açıklamak, ancak diğer durumlarda orada sadece hala bazı faaliyetler mantıklı yeterli biyokimyasal bilgi olabilir de olmayabilir de. Yaptığımız çalışmalar sırasında, biz daha karmaşık lipit döngüleri bir oyuncu dönüştürerek, bazı durumlarda, bunları aşağılayıcı bakterilerin içsel kutup membran lipitleri hareket enzimleri tespit ve. Örneğin, yeni bilgi birleştirerek SMc00171 önceden var verilerle, büyüme fosfor sınırlayıcı koşullar altında uyarılan bir PC özgü fosfolipaz C (PLCP) 8 olduğunu, bir çok çevre proteobakteride var olabilecek bir roman DAG döngüsü postulate edebilirsiniz bu, fosfor büyümesi sınırlayıcı olduğunda, fosfor içermeyen membran lipidlerinin oluşumuna neden olur. Contr içindefosfor kaynakları bol olduğunda ast, DAG fosfatidik asit, böylece bu lipit döngüsünü kapatarak, de novo fosfolipid biyosentezini giren ve çoğunlukla (glisero) fosfolipidler zarında 8,28 mevcut sağlamak için rephosphorylated edilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Acknowledgments

Bu eser (Investigación en Fronteras de la Ciencia de Investigación Científica BasicA 82614, 153998, 253549, ve 178359 yanı sıra 118) ve Dirección Genel de Consejo Nacional de Ciencias y Tecnología-México (CONACyT-Meksika) hibe ile desteklenmiştir (DGAPA-UNAM; PAPIIT IN202616, IN203612) asuntos de Kişisel Académico-Universidad Nacional Autonoma de México.

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Lipaz ve Fosfolipaz Adayları için substrat özellikleri tanımlama
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter