Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Environment

אמפירית, Metagenomic, שיטות חישוביות להאיר את מנגנוני הבריאות דבורה איזה פשרה קוטלי פטריות

doi: 10.3791/54631 Published: October 9, 2017

Summary

קונסורציומים חיידקים בתוך bumble דבורים כוורות להעשיר ולשמר אבקה של דבורה הזחלים. באמצעות רצף הדור הבא, יחד עם המעבדה, המבוסס על שדה ניסויים, כתב יד זה מתאר פרוטוקולים המשמשים כדי לבדוק את ההשערה כי שאריות פטריות לשנות את microbiome אבקה, ודמוגרפיה המושבה, המוביל בסופו של דבר אל המושבה הפסד.

Abstract

מגדלים מרבים להשתמש פטריות תרסיסים במהלך בלום, להגן על היבולים מפני המחלה, אשר חושף את הדבורים כדי פטריות שאריות. למרות נחשב "דבורה-בטוח", יש עדויות הרכבה פטריות שאריות אבקה משויכים דבורה ירידות (עבור גם דבש bumble דבורים מינים). בעוד המנגנונים עדיין לא ידועים יחסית, החוקרים העריכו כי דבורה-חיידק symbioses מעורבים. חיידקים לשחק תפקיד מרכזי לשימור ו/או עיבוד של אבקה, המשמש תזונה עבור דבורים זחל. על ידי שינוי בקהילה מיקרוביאלי, סביר כי קוטלי פטריות לשבש את שירותי אלה בתיווך חיידק, ובכך לסכן את בריאות דבורה. כתב יד זה מתאר בפרוטוקולים המשמשים כדי לחקור את mechanism(s) עקיף שבאמצעותו קוטלי פטריות עלול לגרום ירידה המושבה. כלוב ניסויים חשיפת דבורים פרחים שטופלו פטריות כבר סיפקו העדויות הראשונות כי קוטלי פטריות לגרום הפסדים המושבה עמוקה מקורית הדבורה (בומבוס הפרח). באמצעות שדה רלוונטי מינונים של קוטלי פטריות, סדרה של ניסויים פותחו כדי לספק תיאור עדינה יותר של הקהילה מיקרוביאלי הדינמיקה של אבקה החשופים פטריות. משמרות בהרכב מבנית של במכלולים פטרייתי ובקטריאליות בתוך microbiome אבקה נחקרות על-ידי הדור הבא רצפי וניתוח metagenomic. ניסויים שפותחו בזאת עוצבו כדי לספק הבנה מכניסטית של כיצד קוטלי פטריות משפיעים על microbiome של אבקה-הוראות. בסופו של דבר, ממצאים אלה צריך לשפוך אור על מסלול עקיף שדרכו קוטלי פטריות עלול לגרום ירידות המושבה.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הצליח, דבורה בר מינים חווים ירידות נפוצה, עם השלכות עיקריים עבור שתי מערכות חקלאיות טבעי1. למרות המאמצים מתואמת כדי להבין את הסיבות לבעיה זו, הגורמים נהיגה דבש דבורים ירידות הם עדיין לא הבין היטב2,3,4. עבור מינים מסוימים של דבורים פראי, מקורית, המצב נהיה קשה5,6. אם אוכלוסיות דבורה לא יכולה להתקיים כאשר הם מצטלבים עם חקלאות תעשייתית, אוכלוסיות שלהם ימשיכו ליפול היבולים הדורשים למאביקים (35% ייצור ברחבי העולם7) ימשיכו מופחת יבול.

בעוד גורמים פוטנציאליים רבים כגון חשיפה לחומרי הדברה, מחלות גידול הפסד1,4,8,9,10 היו מעורבים בהתדרדרות דבורים דבש, יחסית מעט מאוד ידוע על השפעת לחצים אלו אינטראקטיבית על דבורים יליד בריאות, בתוך או ליד ומערכות חקלאיות. מאמצים רבים במחקר הנוכחי להמשיך להתמקד קוטלי חרקים, (למשל, neonicotinoids11,12), למרות שהמחקר העבר מצביע על כך קוטלי פטריות עשוי גם לשחק תפקיד בהתדרדרות דבורים על ידי ופוגע היווצרות הזיכרון, חוש הריח הקבלה13, קן זיהוי14, פעילות אנזים, פונקציות מטבוליות15,16,17. באופן כללי, קוטלי פטריות להמשיך להחיל על היבול פורח במהלך בלום. המחקרים האחרונים תיעדו כי דבורים נפוץ להחזיר פטריות שאריות כוורת18, ואכן, מחקרים הראו שיעור גדול של כוורות שנבדקו הכיל פטריות שאריות19,20. עבודה נוספת חשף את שאריות פטריות קשורה עם שיעור גבוה של דבש דבורים התמותה זחל21,22,23 ואת נוכחותם של "אנטומבד אבקה" בתוך מושבות, אשר למרות שאינם רעילים, נטול פעילות מיקרוביאלית והוא פרוץ תזונתית24. למרות העובדה כי קוטלי פטריות יש מזמן נחשב "דבורה-בטוח", עכשיו יש ראיות כי החשיפה פטריות לבד יכול לגרום הפסדים המושבה חמור של זן דבורה במבל מקורית, וטופל בומבוס25.

כדי לקבוע סיבתיות בין חשיפה פטריות המושבה התמותה, המודוס אופרנדי של כימיקלים אלה צריך להיקבע. כפי שמעידים קרקעות26, משקעים27ו סביבות הימית28, מיקוד פטריות, קוטלי פטריות סביר לשנות השפע פטרייתי, גיוון בתוך אבקה-הוראות, ובכך מפעיל קהילה גדולה משמרת את זה ייתכן מאוד ממליץ חיידקים. ללא מתחרים פטרייתי או היריבים, חיידקים פתוגניים מסוימים יכולים להתרבות יחסית לא מסומן, להקל את קלקול של אבקה-הוראות. מחקרים שנעשו בעבר הוכיחה כי מיקרואורגניזמים, במיוחד שמרים ופטריות filamentous, לשמש אנחנו חיים איתם בסמביוזה תזונתי עבור דבורים29,30,31, להגן מפני טפילים פתוגנים32 ,33, ולספק שימור לטווח ארוך של חנויות אבקה. קוטלי פטריות, לכן, ייתכן בעקיפין לפגוע דבורים ילדותי באמצעות שיבוש הקהילה מיקרוביאלי, יש צורך לספק שירותים אלה ו/או על ידי הגדלת הרגישות פתוגנים וטפילים הזדמנותית12. עם הגדלת דרישות על ייצור מזון, יבולים ברחבי העולם להיות ריססו בכל שנה עם קוטלי פטריות במהלך בלום, דבר המלמד הצורך להבין את סדר הגודל של תופעות כאלה הנוצרות על-ידי פטריות.

עד היום, הפערים הידע העיקריים הנוגעים מיקרוביאלי יליד דבורה אקולוגיה יכול להיות מיוצג על ידי בשאלות הבאות: באיזו מידה פטריות משנה הקהילה חיידקים בתוך דבורה אבקה-הוראות? מהן ההשפעות במורד הזרם של צריכת אבקה עם קהילה מיקרוביאלי שינו עמוקות? לשמור על השאלות האלה שהם נוגעים מבחינה אקולוגית, ניסויים שפותחו עם המטרות של חשיפת 1) את שאריות פטריות לבד יכול לגרום המושבה חמורה שקיעתה של מין יליד דבורה; 2) מידת שבה קהילות מיקרוביאלי בהוראות-אבקה שונו על ידי קוטלי פטריות ו- 3) כיצד דבורה בריאות מושפע על-ידי קהילה מיקרוביאלי שינו באופן חמור. מטרות הניסוי הוגדרו להתייחס אל כל השאלות הנ ל באמצעות שילוב של ניסויים במעבדה שדה מבוססות. מחקר זה באמצעות המדינה-of-the-art metagenomic טכניקות מולקולריות לצד שיטות מסורתיות של התבוננות שדה, שואפת לחבר את השפעת קוטלי פטריות אפשריות על בריאות דבורה.

המטרה הראשונה של מחקר זה היא להדגים כי חשיפה פטריות לבד יכול לגרום הפסדים משמעותיים המושבה בקרב ילידי דבורה מינים. מחקר מעורבים כלובים גדולים שדה שימש לחקור את ההשפעות של חשיפה פטריות על הגידול המושבה של הפרח בומבוס, דבורה מקורית בכל מקום, שפע בארה ב (איור 1, איור 2, איור 3). זה היה שיערו כי כוורות שטופלו פטריות שיציג כושר נמוך, ודמוגרפיה טיפוסיות בהשוואה כוורות שאינו חשוף. והנתונים שהתקבלו בניסוי תמיכה השערה זו, הוכחת כי שאריות פטריות בתוך אבקה יכול להיות הגורם הבלעדי של המושבה עמוקה הפסדים מינים דבורה במבל יליד25. המטרה השנייה של מחקר זה היא לחקור את התגובה של microbiome אבקה פטריות חשיפה. זה זה שיערו כי הרכב הקהילה של חיידקים בתוך אבקה-הוראות נחשפים קוטלי פטריות תהיה שונה מזו של אבקה ללא טיפול. בעוד פטרייתי השפע והמגוון צפויים לירידה משמעותית, חיידקים ו/או בזן פטרייתי דומיננטי אחד סביר יגדל לא מסומן בהיעדרו של פטריות מתחרים אחרים. דרך סדרה של ניסויים ב- vivo , אלה משמרות בהרכב הקהילה מיקרוביאלי ינותחו תוך שימוש metagenomics.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. לבחון את ההשפעה של החשיפה פטריות על Bumble דבורים המושבה הצלחה באמצעות שדה כלוב ניסויים

  1. סט למעלה 10 כלובי רשת בשדה נטועים שיבולת שועל. נחפור תעלה סביב כל הכלוב, חופר לכל ארבעה קצוות של הכלוב רשת באדמה כדי להבטיח כי דבורים לא יכול לברוח. מלאי את הכלובים עם צמחים בעלי פרחים בעציץ, אשר ידועים להיות מושך דבורים (למשל כוסמת, borage, אליסון, קוסמוס, חמניות) ( איור 2).
  2. תוספת הכלובים עם מגש אחד (36 ס מ x 42 ס מ) תלתן, בלום. אשכול פרחוני המשאבים בתוך פינה אחת של הכלוב, כובש שטח כ 2.5 מ' x 1 מ' Vegetate שטח הכלוב שנותרו על ידי שיבולת שועל.
  3. להקצות באופן אקראי הדבורה מושבות, כל העובדים המכיל, מיטה זוגית, טיפול (פטריות המתנה/נעדרים, N = 5 מושבות לכל טיפול, הכולל 10 מושבות), ואז למקם אותם בתוך כלוב שדה (N = 1/כלוב) 29 ימים (23 ביוני -21 יולי 2014).
  4. אוריינט בתיבות המושבה כך המושבה ' s פתחים הצבע לדרום, כדי לספק תנאים אופטימליים ניווט הדבורים. לסבסד את המושבות עם סוכר מים שלפוחיות, בתוך התיבות כוורת להשלמת צוף זמינות.
  5. החל מבוסס chlorothalonil פטריות ברמה שדה רלוונטי (20 גרם/ליטר) כדי צמחים פורחים בכלובים טיפול 5 פטריות, תוך שימוש ביד שנערך ריסוס חומרי הדברה, פעמיים במהלך המחקר (יום 0 ו- 13). מעיל הפרחים בצורה אחידה, כך אין נוזל נוסף לאנאפוליס פרחוני משטחים ( איור 3).
  6. בתום המחקר כלוב שדה, להסיר את המושבות וטופל דרב מהכלובים בעבודת יד, מגניב הכוורות על-ידי הצבת במקפיא-20 ° C עבור 20 דק.
  7. להסיר דבורים באמצעות מלקחיים סטרילי ולהקליט את המספר של הזחלים, גלמים, נשים בוגרות (אני. e. איוראו), וזכרים בוגרים. באמצעות איזון האנליטי להקליט את משקל יבש של אמא מלכה, הזחלים, גלמים, נשים בוגרות (קרי איוראו), הזכרים הבוגרים.

2. לבחון את ההשפעות של החשיפה פטריות על קהילות מיקרוביאלי האבקה-מהוראות Bumble דבורים קינים באמצעות מעבדה המבוסס על ניסויים Vivo ב

  1. Pulverize שנרכשו באופן מסחרי אבקה אבקה באמצעות תקן מעבדה-טחנת הכדור. לחטא אבקה אבקת למסמס ב-70% אתנול, ולאפשר לו להתאדות במשך הלילה תחת אור UV. לוודא עקרות של אבקה על-ידי ציפוי ~0.5 מ"ג במדיה אגר למטרות כלליות.
    1. כדי היבשה אבקה מעוקר, באמצעות פיפטות מעוקר, הוסף שדה רלוונטי במינון של פטריות: propiconazole-14.3%; azoxystrobin ב 22.9% עבור טיפולים (0.74 µL ו- 0.65 µL בהתאמה / יום / כוורת). מערבבים היטב בעזרת מקלות עץ מעוקר.
  2. מקום 6 ניסיוני כוורות (n = 3 עבור בקרה וטיפול) ב- benchtop מעבדה נקייה, היגיינה נשמר בטמפרטורת החדר. כל יום שוקלים 4.27 גר' אבקה 34 , 35 מעורבב עם קוטלי פטריות (עבור טיפולים) או במים סטריליים (עבור פקד) בתוך ברדס באמצעות הטכניקה aseptic רגיל.
    1. באמצעות הדלתות שסופקו על-ידי הצד של תיבת קרטון תוחמת את הכוורות, להציג את האבקה בתוך הכוורות. תוספת ההייבס עם סוכר סטיריליים פתרון בכל שבוע. המשך האכלה המשטר במשך ארבעה שבועות.
  3. המסקנה של המחקר במעבדה מבוסס, מגניב הכוורות על-ידי הצבת במקפיא-20 ° C עבור 20 דקות מגרדים החוצה האבקה-הוראות הנכלל צ'יימברס שבוחרים באמצעות מלקחיים סטיריליים שפכטלים ומקום אחסון סטריליים צינורות. בחנות-80 ° ג ספירת ולהקליט המשקל של העובדים ואת המלכה האם-ההתחלה והסוף של הניסוי (שלב 1.7).
  4. לבודד דנ א מהדגימה אבקה-הוראה באמצעות בידוד ה-DNA זמינים מסחרית ערכות (לפרטים, ראה טבלה חומרי).
    1. להוסיף 0.25 גרם של אבקה-הוראה על החילוץ צינורות, בקצרה מערבולת לערבב.
    2. להפוך 200 מ"ג/מ"ל ליזוזים פתרון יונים מים מזוקקים, מספיק למדגם/50 µL. טלטל נמרצות כדי פתרון הטופס לגמרי.
    3. להוסיף 50 µL של הפתרון ליזוזים הצינורות חילוץ עם מדגם זה, ומערבבים היטב על ידי היפוך מספר פעמים. דגירה הצינור 10 דקות ב 37 מעלות צלזיוס בתוך אמבט מים. אם התמיסה הקימה, חום פתרון עד 60 ° צלזיוס עד התפרקה לפני השימוש.
    4. µL להוסיף 70 פירוק מימית לפתרון צינורות החילוץ, לאבטח בצורה אופקית על משטח מערבולת גרר עם קלטת, מערבולת במשך 10 דקות צנטריפוגה צינורות ב g x 10,000 ל 30 s בטמפרטורת החדר.
    5. להעביר את תגובת שיקוע צינור נקי mL 2 אוסף. להוסיף 250 µL של חלבון משקעים פתרון, מערבולת של Incubate ס' 5 ב 4 מעלות צלזיוס למשך 5 דקות באמבט קרח.
      הערה: מצפה בין µL 400 עד 500 µL של תגובת שיקוע. תגובת שיקוע עדיין עשויה להכיל כמה חלקיקים.
    6. Centrifuge הצינורות בטמפרטורת החדר במשך 1 דקה ב 10,000 x g, להעביר עד 600 µL של תגובת שיקוע צינור נקי mL 2 אוסף. להוסיף 200 µL של פתרון להסרת מעכב מימית, בקצרה, מערבולת, דגירה ב 4 מעלות צלזיוס במשך 5 דק צנטריפוגה הצינורות בטמפרטורת החדר במשך 1 דקות ב- 10,000 x ג' להעביר עד 750 µL של תגובת שיקוע לתוך צינור נקי mL 2 אוסף.
    7. 1200 להוסיף µL של bind מימית פתרון תגובת שיקוע, ו מערבולת עבור 5 ס לטעון כ 675 µL של תגובת שיקוע על גבי ספין ומסנן צנטריפוגה ב 10,000 x g עבור 1 דקות בטמפרטורת החדר. למחוק את הזרימה.
    8. חוזר 2.4.7. פעמיים.
      הערה: בסך הכל שלושה מטענים עבור כל דגימה מעובד נדרשים.
    9. להוסיף 500 µL אתנול, צנטריפוגה בטמפרטורת החדר במשך 30 s ב- 10,000 x ג למחוק את הזרימה, ו צנטריפוגה שוב בטמפרטורת החדר במשך 1 דקות ב- 10,000 x ג מקום ספין מסנן בשפופרת איסוף mL 2 נקייה.
    10. מאגר
    11. להוסיף 100 µL של • תנאי למרכז של קרום מסנן. צנטריפוגה בטמפרטורת החדר במשך 30 s ב 10,000 x ג למחוק את המסנן ספין. חנות שנאספו DNA בין-20 ° C ל-80 מעלות צלזיוס
  5. שימוש מבודד DNA עבור רצף.
    1. Quantify, ואת לנרמל מבודד דנ א נג 2/µL על ידי ניתוח fluorometric. תגובות
      1. הכן דולר עבור כל דגימה שחולצו להשוות את כמויות יחסיות של 28S (צמח), לנתח שלה (פטריות), ורכיבים 16 (חיידקים) של כל מדגם אבקה-סעיף 36. ודא כי כל התגובה מכילה 10 ng של DNA הכולל, 2 x של cyanine סימטרית צבע המבוסס על מיקס מאסטר 2.5 µL כל תחל ואחורה זוגות 28KJ/28B 37 למפעל, ITS1/ITS5.8R עבור ה-DNA פטרייתי 38 .
    2. דנ א להגביר שימוש בפרמטרים הבאים: 2 דקות דנטורציה טרום ב 50 מעלות צלזיוס, 2 דקות דנטורציה הראשונית ב 95 מעלות צלזיוס, 40 מחזורי של (15 s ב 98 ° C, 15 s-58 ° C, 60 s ב-72 מעלות), ואחריו עיקול להמיס.
    3. להכין 2-צעד, מקוננת PCR פרוטוקול באמצעות ספריות הדור הבא רצפי פילוח של rRNA 16 אזור משתנה V3/V4 ו- ITS / 5.8s אזור מרווח rRNA.
      1. µL להוסיף 12.5 של ה-DNA ל- 5 pmol של כל פריימר ו- 2 x מיקס מאסטר. להפוך לתגובות נפרד לכל אזור (16 או ITS; ראה טבלה 1). שינוי אזור ספציפי תחל כפי שתואר לעיל 39 , 40 להוספת מתאם ספציפי הרצפים (sequencer) החריגה רצפי רצפי הגן הספציפי.
      2. לבצע הגברה הראשונית באמצעות הפרמטרים הבאים: 3 דקות דנטורציה הראשונית ב 95 מעלות צלזיוס, 25 מחזורי של (30 s ב 95 ° C, 30 s-55 ° C, 30 s ב-72 מעלות), 5 דקות הארכה הסופי-72 מעלות צלזיוס
      3. הבאות הראשוני הגברה, לאמת גודל הספרייה וכמות על ידי ניידות electrophoretic, לנקות באמצעות 1 x נפח מעבדתי imm הפיךחרוזים obilization כדי להסיר תחל שיורית, ריאגנטים התגובה. בריכה מטוסי אף-16, amplicons שלה באופן כמותי כדי ליצור בריכה אמפליקון יחיד עבור כל דגימה.
      4. להוסיף מתאמי ספציפי הרצפים (sequencer), לטעום באינדקסים ספציפיים כפול באמצעות את תחל הבאים (ראה טבלה 1). להוסיף 2.5 µL של ה-DNA מוגבר pmol 5 של כל פריימר ו- 2 x מיקס מאסטר. לבצע הגברה הספרייה באמצעות הפרמטרים הבאים: 3 דקות דנטורציה הראשונית ב 95 מעלות צלזיוס, 8 מחזורים של (30 s ב 95 ° C, 30 s-55 ° C, 30 s ב-72 מעלות), 5 דקות הארכה הסופי-72 מעלות צלזיוס
    4. הבאים PCR, ספריות סיים לנקות באמצעות נפח 1 x של מחרוזת הנייח הפיך מעבדתי. להעריך את האיכות והכמות של ספריות סיים באמצעות ניידות electrophoretic ו- fluorometry, בהתאמה. לתקנן ספריות 2 מיקרומטר, בריכת לפני רצף.
    5. לבצע רצף הדור הבא על פלטפורמה מקביל המתאמים שנוספו ב- PCR המשני, באורך המתאים כדי לכסות את כולו אמפליקון 41.
  6. רצף ביאור וניתוח הקומפוזיציה מיקרוביאלי.
    1. לשלב זוג רצף נתונים (R1 ו- R2) לתוך contigs יחיד עבור ספריות הכל ברצף. לאחר מיזוג קבצים R1 ו- R2, מופק קובץ fasta יחיד עבור כל הספריות של.
      הערה: שלב זה ואת התהליכים המתוארים להלן (אלא אם כן צוין אחרת) מתבצעות ב- Mothur גירסה 1.38.0 38.
    2. מסך כל קובץ fasta להסיר בסיסים רב-משמעי, רצפים ארוכים לא צפויה, homopolymers ארוך.
      הערה: הפרמטרים עבור הקרנה, וגם להסרת רצף הם maxambig = 0, maxlength = 600 ו- maxhomop = 8 עבור שני גנים. להסיר רצפים זהים, אך לשמור טבלה contingence בנפרד עבור כל ספריות (המוכר גם בשם הרוזן טבלה ב- Mothur).
    3. יישור רצפים ייחודי של ספריית הגן מטוסי אף-16 יצאו נגד גירסת מסד הנתונים סילבה 123, ואת הספריה ITS ג'ין נגד מסד הנתונים לאחד שלה 42.
      הערה: רצפים חייב להיות מבואר מרמת ממלכת לשלב סוג.
      1. לאחר מכן, אשכולות המיושרים רצפים עם pre.cluster הפונקציה באמצעות diff = 5, ולהסיר כימרות.
    4. לסווג רצפים בשיטת וואנג 43 בהתבסס על סילבה (עבור ג'ין 16) טקסונומיה לאחד שלה (עבור ג'ין ITS) קבצים (ערך סף של 80%).
    5. לטעון לתוך R 44 contingence הטבלאות (אחת בכל גן) שנוצר במהלך תהליך סיווג ב- Mothur. בכל רמה בטקסונומיה, לקבל שפע יחסי לכל ספריה עבור ניתוח נוסף של הקהילה מיקרוביאלי שינויים.
      הערה: בכל רמה בטקסונומיה, מתמזגים יחד קבוצות בטקסונומיה בעת השפע היחסי הוא פחות מ 2% עבור כל החזרות ניסיוני.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מחקר שדה הכלוב:

והנתונים שהתקבלו כלוב הניסויים הראו כי המושבות bumble דבורים היה בתגובה פטריות חשיפה משמעותית. ההייבס שטופלו פטריות המיוצר באופן משמעותי פחות עובדים (12.2 ± 3.8, זאת אומרת ± SE) מאשר ההייבס שליטה (43.2 ± 11.2, F1,9= 6.8, p = 0.03) (איור 4). בנוסף, ביומסה דבורה של הכוורות שטופלו פטריות (± 0.91 g 0.15) היה נמוך באופן משמעותי כוורות שליטה (± 2.36 g 0.55; F 1,9 = 8.3, p = 0.02). תבנית זו של ביומסה הוריד בשלפוחיות שטופלו פטריות נצפתה גם בקרב המלכות אמא. מלכות ההייבס שטופלו פטריות עם ביומסה (0.14 g ± 0.04) נמוך משמעותית מאשר מלכות ההייבס שליטה (0.27 g ± 0.01; Z = 2.5, p = 0.01). עם זאת, חשיפה פטריות לא השפיע על המספר של הזחלים, גלמי זכרים לאורך הטיפולים. ביומסה של שלבי החיים דיסקרטית (הזחלים הגלמים, עובדים, הזכרים הבוגרים) ומשקולות בודדות עבור הזחלים, גלמים, העובדים לא הראה שום הבדל מעבר שטופלו פטריות, שליטה כוורות.

במעבדה מבוסס מחקר:

הנתונים המתקבלים מבוסס מעבדה ניסויים הצביעו לפני חשיפה פטריות, פטריות שטופלו כוורות ובקרה שיש השוואה סטטיסטית עובד מתכוון לספור (לשלוט כוורות = 28.0 ± 3.1; כוורות שטופלו פטריות = 31.67 ± 2.0; n = 3 כל) ואז קווין משקל (לשלוט כוורות = ± 0.77 g 0.04; כוורות שטופלו פטריות = 0.74 g ± 0.01). עם זאת, בסוף המחקר, העובד הרוזן היה גבוה באופן מובהק שליטה כוורות (67.67 ± 4.3), בהשוואה לכוורות שטופלו פטריות (45.33 ± 3.8) (t4 = 3.89, p = 0.01). אוכלוסייה עובדת מוגברת על ידי ~ 150% בשלפוחיות שליטה לעומת ~ 45% בשלפוחיות שטופלו פטריות. באופן דומה, המשקל הסופי של המלכה האם נותר כמעט ללא שינוי בשליטה כוורות (0.76 g ± 0.02) בהשוואה של % ~ 35 הדירי כוורות שטופלו פטריות (0.49 g ± 0.16). יחדיו, תוצאות אלו עקביים עם התוצאות שפורסמו בעבר25 ולציין פטריות חשיפה מושפעות המושבה כושר כפי שמעידים מספרים העובד פחות שומן מופחתת המלכה האם משקולות (איור 5).

ניתוח Metagenomic של אבקה-הוראות הצביעו על הבדלים ברורים בין הקהילות מיקרוביאלי שנאסף שטופלו פטריות ולשלוט כוורות (איור 6). חלה ירידה (> 95%) בשפע יחסי של Streptomycetales בדרך כלל מבודדים, Enterobacteriales ב ההייבס שטופלו פטריות. מעניין, שתי הקבוצות הללו ידועים שלהם פעילות נגד פטריות ואת תפקיד שימור-אבקה30,,45 , בתוך סביבות כוורת דבורת הבומבוס. חיידקי חברי המסדר Rickettsiales, הכוללת גורמי מחלה נפוצה של פרוקי רגליים46, הראה הרבה שפע רב יותר ההייבס פטריות מטופלים. כוורות שטופלו פטריות היה של שפע התחתון של פטריות השייכים ההוראות Eurotiales, Sordariales, ושפע גבוה יותר של הזמנות Capnodiales ו- Ascosphaerales לעומת שליטה כוורות (איור 7). כצפוי, גם חיידקים ופטריות, גיוון אינדקס (H) של שאנון, שויון (E) היה נמוך בשלפוחיות שטופלו פטריות לעומת שולט, למרות הבדלים אלה לא היו משמעותיים מבחינה סטטיסטית (חיידקים: H לשלוט כוורות = ±1.25 0.3, Hכוורות שטופלו פטריות = 0.82 ± 0.2, אישליטה כוורות = 0.46 ± 0.1; Eכוורות שטופלו פטריות = 0.31 ± 0.1; פטריות: Hכוורות שליטה =0.99 ± 0.3, Hכוורות שטופלו פטריות = 0.72 ± 0.4, אישליטה כוורות = 0.57 ± 0.2; Eכוורות שטופלו פטריות = 0.42 ± 0.2). למרות המפרט את ההשלכות מטבולית ופונקציונליים של הקהילה כגון משמרות היה מעבר להיקף של מחקר זה, בשילוב עם ספירת המושבה, נתונים משקל, תוצאות אלה מראים כי חשיפה פטריות יכול להשפיע על ירידה בבריאות המושבה על ידי שיבוש סימביוזה בין דבורים microbiome אבקה. חקירה נוספת לתפקיד של קבוצות חיידקים ספציפיים המשפיעים על זחל שאירים מומלץ להעריך טוב יותר את התפקיד של microbiome אבקה ב סופגת אוכלוסיות דבורה בריא.

Figure 1
איור 1: בתוך קן בומבוס וטופל . תמונה ברזולוציה גבוהה של העובדים נוטה תאי הרבייה. תאי הרבייה יכול להכיל מספר הביצים והזחלים בכל זמן נתון. פיתוח הזחלים ניזונים האבקה-הוראות מעת לעת הציג לתוך החדר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: כלובים שדה גדול זקף בבית למושבות דבורה. בכל כלוב רשת (N = 10) היה מצויד עם אחד שנרכשו באופן מסחרי בומבוס וטופל הכוורת, כמו גם בבלום צמח מינים ידועים מושכים דבורים. פרחים היו מצויד בכל פינה אחת של הכלוב, השטח הנותר היה הירוק. בכדור עם שיבולת שועל עשב. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: פטריות השאריות על חמנית לאחרונה מותז. שדה רלוונטי מינונים של פטריות רוססו ביום 0 ו- 13 של הניסוי. באמצעות ריסוס הדברה, הפרחים היו אחיד מצופה פתרון פטריות בשעת בין ערביים/ערב להימנע ממגע ישיר עם הדבורים הרעיה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: ההשפעות של פטריות השאריות על דבורים בניסוי הכלוב. Bumble ג'וקים מתנגדות שאריות פטריות על ירידות משמעותיות אבקה הציג בגודל המושבה (reductיונים בשפע נקבה בוגרת) במהלך חודש בודד. קווי שגיאה מייצגים ± 1SE; p < 0.05. איור זה שונה מן ברנאואר. et al. 25. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: ההשפעות של פטריות השאריות על דבורים בניסוי מבוסס המעבדה. Bumble דבורים מושבות מתנגדות אבקה שטופלו פטריות הציגה ירידות משמעותית בגודל המושבה (הנחות בשפע עובד מבוגר) והירידה במשקל המלכה האם במהלך חודש בודד. קווי שגיאה מייצגים ± 1SE; p = 0.03. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6: תרשים עוגה של metagenomic סיווג של גיוון פטרייתי ובקטריאליות לפי פקודה הדרגה. ניתוח המבוסס על סיווג ITS מבוסס () 16 ו- (b) של אבקה-מתן דוגמאות שנאסף כוורות שטופלו פטריות ובקרה. שליטה כוורות הפגין גבוה יותר גיוון, שויון בחלוקת מיקרוביאלי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 7
איור 7: שיעור שינוי סדר בשפע היחסי דרגה של חיידקים ופטריות, בתגובה לחשיפה פטריות- Metagenomic סיווג של חיידקים הקהילות באמצעות () 16 ו- (b) ITS מבוסס תחל אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

זוג פריימר פריימר מסוג פריימר רצף
28KJ/28B צמח GGC GGT AAA TTC מס רווחי הון CC /
מס רווחי הון CCG TGT TTC AAG ACG
ITS1 / ITS5.8 פטריות TCC GTA GGT גה CCT GCG ב G /
איסור פרסום ATC מס רווחי הון TGT TGA AAG TT
מטוסי אף-16 קדימה / אחורה בקטריאלי מקוננים 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG-3'/
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACHVGGGTATCTAATCC-3'
פריימר ITS1F / ITS4 מקונן פטרייתי 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCGTAGGTGAACCTGCGG - 3'
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC - 3'
מתאם תחל 5'-AATGATACGGCGACCACCGAGATCTACAC [55555555]
ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
5'-CAAGCAGAAGACGGCATACGAGAT [77777777]
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3'

טבלה 1: רשימת פריימר זוגות ורצפים פריימר בשימוש הגברה דנ א. ראה טקסט עבור הפניות.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

חקירות ההשפעות של קוטלי פטריות על דבורה בריאות נשארו היבט understudied של אסטרטגיות ניהול בפשט. המחקר שלנו שואפת את פער הידע זה באמצעות חבילה של טכניקות משלימים במפורש לבודד את הגורמים הפוטנציאליים נהיגה דבורה ירידות. תכנון הרציונל, עיבוד של ניסויים אלה מפורטים להלן.

חשוב לוודא כי אין דבורים מותר לברוח רשת השינוי של הניסויים הכלוב, מאז זה ימוטט את ניתוח דמוגרפיה. חשוב גם כי קינים מלאכותית יש בידוד מספיק כדי להגן מפני גשם, שמש ישירה. כדאי לשים לב כך קוטלי פטריות לא מרססים ישירות על קינים. המושבות צריך להינתן עם שלפוחיות מים סוכר מוסף צוף התאספו ולמנוע התייבשות.

עבור המעבדה מבוסס ניסויים האכלה, תנאים aseptic קפדנית צריך להישמר למניעת זיהום בעת הכנת הארוחות אבקה. חייב להיות אבקת אבקה מסחרית שנרכשו, UV לעקר לפני השימוש. כוורת היגיינה חייבת להישמר כדי למנוע התפשטות של טפילים חיצוניים כגון עש במזווה, מקקים. יש להשלימה שלפוחיות נוזל עם סוכר סטיריליים פתרון למניעת התייבשות. עבור טיפול קדם במפקד, להקפיד לא ללחץ את הדבורים על ידי טיפול מופרז, ולשמור אותם בחוץ hived. עבור ממושך תקופות.

כמו ה-DNA תשואה תלוי גיל וסוג החומר מתחיל, יש להשתמש רק דוגמאות טרי או קפוא היטב הפקת דנ א, הגברה. משקל מדגם להפקת DNA לא יעלה 0.25 gm, משום שזה יחליש את התשואה הדנ א. התשואות דנ א צריך ניתן לכמת באמצעות אלקטרופורזה בג'ל. כימות electrophoretic מראש של DNA מבודדות חיוני לפני שימשיך qPCR תגובות על מנת להבטיח יעילות הגברה47.

לניתוח metagenomic, ניתוח מקיף יותר של הדינמיקה מיקרוביאלי יכולה להיות מושגת על ידי הגבלת כמות רצפים המבואר (על-ידי מרגיע את חלק נסבל ההבדלים בין רצפים) הפחתת מספר קבוצות בטקסונומיה, כמו וכן מיזוג אלה אשר השפע היחסי הינו נמוך משמעותית (< 2%).

גודל המדגם השמרני (N = 5 פטריות שני מטופלים, מטופל כלוב המחקר כוורות) יכול לנפח את הסטיות בנתונים, אשר יהיה ממוזער במחקרים עתידיים באמצעות שכפול רבתי. כדי להוסיף עוצמה סטטיסטית של רזולוציה גדולה יותר התוצאות, המושבות דבורה יהיה censused שנשקל לפני ואחרי חשיפה פטריות. עורכים את הניסוי כלוב לתקופות ארוכות יאפשר הייצור של קווינס החדשה, אשר יכול לשמש משתנה התגובה נוספים. עם אלה שינויים בפרוטוקול הנוכחי, מחקרים עתידיים תספק יותר פרטים על הכוורת המלאכותיות.

מהות הידרופובי אבקה מרתיעה של ערבוב יעיל עם מים. כתישה, ניפוי של גרגרי אבקה על אבקה, מסייע בתהליך ערבוב. ניתן להתאים את כמות האבקה האבקה כדי להשיג את המרקם הרצוי. צריך לקחת ביסודיות לערבב את הנוזלים (המים או פטריות) כדי להשיג את התפלגות הומוגנית של החומרים הפעילים ומסירת אפילו כדי איוראו.

כמו עודף ה-DNA יכול לעכב תגובות PCR, מומלץ שהדגימה לא צריך לשקול יותר מ 0.25 ג'י vortexing מוגזמת יש להימנע ככל זה שירס ה-DNA, בהורדת התשואה. תשואה נמוכה דנ א יכול להיות גם תוצאה של חשיפה ממושכת אל המאגר פירוק. תחל חיידקי צריך להיבחר רצוי מאזור V7-V9 מטוסי אף-16 rRNA למזער שאינם ספציפיים הגברה של כלורופלסט דנ א48. בנוסף, רצף של גנים אחרים, כגון הגן ribosomal RNA 18S יכול לספק הבנה טובה יותר של המגוון מיקרוביאלית של אבקה, כמו גם השינויים האוכלוסייה על ניצול פטריות.

בהתחשב בכמות של ספריות לעבד עם Mothur, הזמן מחשוב יכול להיות גבוה במידה ניכרת. הסרת singletons בהשוואת רצפים אחד נגד השני (אם מיחשוב משאבים מוגבלים, הסר אותן לפני סינון כימרה) יכול להקטין במידה ניכרת את הזמן הנדרש עבור מחשוב ביחידות תפעוליות בטקסונומיה.

הניסויים כלוב להגביל את טווח טיסה טבעי של הדבורים (בניגוד ומאפשר להם שננבור נרחב פני השטח), ולא ברור הדרגה שאליה הגבלות כאלה יכולים להשפיע המשתנים התגובה. למרות הכלובים בקרה וטיפול חווים באותו טווח משתנים ביוטיים, והאביוטיים, זה בלתי אפשרי לוגיסטית לפקד עבור microenvironment בתוך כל הכלוב.

היקף אינטראקציות חיידקים תוך-קהילתית אמיתית הוא הרבה יותר מדי מסובך ומורכב להעתיק במבחנים ניסיוני. אמנם הנתונים שלנו סביר לתעד תת-קבוצה של המגוון הכולל חיידקים בתוך אבקה-הוראות, היא התובנה הראשונה לתוך ההשפעות אינטראקטיבי זה עשוי לגבור בין חיידקים ופטריות, בהעדר הנוכחות/קוטלי פטריות.

באמצעות מאגרי מידע חלופי עבור יישור רצף49 או חיזוי פונקציונלי הברית מטבולית המבוסס על חיידקי גיוון אבקה50 יכול לספק מבט נרחב יותר על microbiome אבקה. בסופו של דבר, כדי לאפיין טוב יותר את הדינמיקה מטבולית ופונקציונליים של קהילות מיקרוביאלי לאחר היישום פטריות, רצף הגנום כולו של אבקה microbiome היא הכרחית.

כלוב ניסויים באמצעות כוורות מסחרית שנרכשו מספקים באחת המסגרות הכי טוב כדי למדוד את התגובה משתנים בסביבה מבוקרת למחצה. גורם שינוי מינימלי אקולוגיה הדבורים טבעית (יעילות הרעיה, מבנה חברתי, טיפול הצאצאים), ניסויים הכלוב למזער המצאה ומתחים, שהוצגו על ידי מדריך טיפול במהלך מבוסס המעבדה והסביבה מלאכותי ניסויים.

למיטב ידיעתנו, אין עדיין בוצע כדי להעריך את ההשפעות של קוטלי פטריות על הקהילה מיקרוביאלי הדינמיקה בתוך האבקה-מתן bumble דבורים. חשיפה קוטלי פטריות עלול לחסל את אחד או יותר מינים רגישים, לשבש את הפסקת האש אקולוגית בין פטריות וחיידקים. מחקר זה באמצעות שדה וניסויים במעבדה מבוסס כמו כור לשחק אינטראקציות אלה, שואפת להפגין השמדתם של מינים חיידקים יכולים סוטה את האיזון האקולוגי של microbiome אבקה, ייתכן בתורו את הפשרה דבורה בריאות.

תלוי תרבות טכניקות כגון דילול, ציפוי על לכידת סטנדרטיים מדיהרק שבריר microflora מסביבת נתון. זה יכול להוביל underrepresentation מגעיל המגוון חיידקים, חיידקים unculturable יכול ללכת מבלי שיבחינו51. ללמוד את רוחב היריעה של מיקרואורגניזמים, מדענים חייבת להסתמך על טכניקות תלויית תרבות, אשר הם יותר כולל ומקיף, למשל ניתוח metagenomic, הדור הבא רצפי. ציור בכבדות מן אלה טכניקות מולקולריות עוצמה, מחקר זה שואף להשיג רזולוציה גדולה יותר לתוך microbiome אבקה ממה שסופק על-ידי תרבות המבוססת על טכניקות מסורתיות לבד.

תוצאות המחקר נחשפו התביעות עמוקה מספר העובדים בתוך bumble דבורים מושבות נחשפים פטריות. מושבה דבורה במבל מוצלח, העובדים צריכים לספק מספיק משאבים ולדאוג עבור האמא-המלכה, במיוחד לפיתוח הזחלים. בסופו של דבר, המטרה של המושבה היא להגדיל את לכידת משאב (אבקה, צוף) כך בת-מלכות רבים ככל האפשר יכול להיות מיוצר על ידי סוף הקיץ. הבת בריא-מלכות הן מידת הכושר עבור מושבה. ירידות גדולות של עובדים, לאחר מכן, מורדת ביעילות של המושבה וביכולתם לייצר מלכות לקראת השנה הבאה. במחקר זה, לא רק היו מספרים העובד ירד באופן משמעותי, אלא האמא-המלכות מ ונעביר מטופלים כוורות הציג עם ביומסה נמוכה יותר, ככל הנראה כתוצאה אספקת המזון לא מספיקות על ידי איוראו. לאור המורכבות של אינטראקציות חיידקים בתוך אבקה-הוראות, קשה להבחין את ההשפעות אינטראקטיבי המדויק בין פטריות וחיידקים לתרום הדפוסים הללו. אולם, תוצאות נגזר ניסויים משוכפל, חוזרות ונשנות כפי שמתואר כאן, יספק תובנות symbioses הסטה בין קבוצות חיידקים אלה חיוניים (בין אם תחרותי, mutualistic או commensal) בתגובה xenobiotic הלחץ. ואת השפעותיו במורד הזרם על microbiome אבקה.

באמצעות כלים מולקולריים חזקים, מהמורכבות האקולוגית microbiome אבקה ניתן כדאי לפתור. הבנה ראשונית מגלה שפע של טבעי חיידקים ופטריות, תורם באופן קולקטיבי כדי לשמור על כושר המושבה. בפרט, שמרים זה הם בודדו אותנו מהמתרחש אבקה-הוראות ידועים לשאת מאפיינים אחרים, fermentative, שניהם אשר חיוניים לפיתוח של דבורים זחל. אסוציאציות אקולוגי שכאלה הם רמיזות של רמה גבוהה של מוטואליזם בין דבורים microbiome אבקה שלהם. אבקה-הוראות, לכן, מייצגים אפקט גיוון מתהווה, הביא על ידי הטיפוח של קהילה מיקרוביאלי מורכבת בתפקידי מפתח פונקציונלי. בהיעדר אלה אנחנו חיים איתם בסמביוזה מפתח, האבקה-מתן מופיע לסיכון למעלות לא ידוע. המשך עבודה בכיוון זה, סביר להניח להסביר את המגוון פונקציונליות של החיידקים האלה ולחשוף את תפקידם כמו דבורה אנחנו חיים איתם בסמביוזה.

מחקרים אחרונים קעקע את הרעיון של קוטלי פטריות כבלתי מזיק דבורים19,24,-52,-53,-54. המטרה של מחקר זה היא כדי לבודד את מנגנוני נהיגה פטריות ההשפעות על דבורים, ובכך מאיר היחס סיבה-תוצאה בין ירידות דבורה ושימוש פטריות. המרכז השערות סביב הרעיון כי דבורה-חיידק symbioses להיות שונו באופן משמעותי על ידי פטריות שאריות אבקה. בסופו של דבר, עבודה זו מחדש מסגרת קוטלי פטריות הם צפו ב וכיצד המשמשים בחקלאות בסביבה עירונית. לאור המשבר העולמי המאביק הנוכחי, המחקר המוצע יוצר ידע חדש על אקולוגיה דבורה יליד, ככל שהוא מתייחס לשיטות הייצור החקלאי. קוטלי פטריות יישארו בקבוצה agrichemical האחרונה כדי לקבל פטור ביעילות תקנות הגבלת יישומים לגידולים חקלאיים במהלך בלום. כתוצאה מכך, דבורים מנוהל והן פראי בעקביות נחשפים קוטלי פטריות. גוף גדל והולך של הספרות עולה כי, למרות קוטלי פטריות אינם קטלניים כדי דבורים על קשר, במינון גבוה, חשיפה מזיקה למדי, המוביל אל זחל תמותה גבוהה יותר21 , שינוי התנהגות באיסוף. הוא צפוי כי עבודה זו תדלק את mechanism(s) שבו קוטלי פטריות הן פגיעה למאביקים. יתר על כן, המחקר הזה יוצרות את הבסיס של מדיניות ניהול חכם של המזיק ויודיע מגדלים של שיטות עבודה מומלצות לניהול. עבודה זו תהיה גם אינסטרומנטלי במתן הנחיות ריסוס חומרי הדברה משופרת, העלולים להשפיע על חומרי הדברה חוקים ותקנות. באופן כללי יותר, ממצאים אלה יהיה רלוונטי כל המערכת האקולוגית מנוהל שבו צמחים פורחים הם ביקרו איסוף אבקה חרקים. עם הערכות הכללית של דבורה ספציפיים שירותי האבקה להיות גבוה באופן55,56, אם עבודה זו יכולה להמתיק את הירידה של אוכלוסיות דבורה, ההשפעות פוטנציאלי יהיה משמעותי.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

והמלצה תודה של אוניברסיטת ויסקונסין ביוטכנולוגיה במרכז DNA רצף המתקן למתן הגברה, רצף מתקנים ושירותים, קייטלין קרלסון, ג'ניפר המיומנות, ג'ייק אוטו, וכן מקס Haase למתן סיוע טכני עם אנליזה מולקולרית. עבודה זו נתמכה על ידי שירות המחקר החקלאי-USDA הופקעו קרנות (מחקר מידע המערכת הנוכחית 3655-21220-001). תמיכה נוספת סופק על ידי הקרן הלאומית למדע (תחת גרנט מס DEB-1442148), DOE הגדול אגמים Bioenergy המרכז לחקר (DOE משרד המדע בער דה-FC02-07ER64494), לבין משרד החקלאות המכון הלאומי של מזון חקלאות (פתח פרוייקט 1003258). C.T.H. הוא חוקר הספסל למדעים ביו ועמית של אלפרד Toepfer סגל, הנתמך על-ידי בוטח צדקה הספסל ועל קרן אלכסנדר פון הומבולדט, בהתאמה.

Materials

Name Company Catalog Number Comments
Natupol Beehive Koppert USRESM1 16 hives
Propiconazole 14.3 Quali-Ppro 60207-90-1 Propiconazole 14.3%
Abound Syngenta 4033540 Azoxystrobin 22.9%
Chlorothalonil Syngenta 3452 Fungicide used for trials
Pollen granules Bee rescued B004D5650C 3X 16oz bottles, pollen for trials
Bacterial strains for inoculation Currie Lab
Yeast strains for inoculation Hittinger lab
Primer pairs UW Biotech Center
DNA Isolation Kit Mo Bio 12830-50 Commercial DNA isolation kit
Qubit dsDNA HS Assay Kit Thermo Fisher Q32851 DNA quantification tool
Select Master Mix for CFX Thermo Fisher 4472952 Used to perform real-time PCR using SYBR GreenER dye.
Real-Time PCR Detection System Bio Rad 1855196 Instrument used for PCR amplification
PCR Clean-Up Kit, Axygen 10159-696 Used for efficient removal of unincorporated dNTPs, salts and enzymes
DNA 1000 Kit Agilent 5067-1504 Used for sizing and analysis of DNA fragments
MiSeq Sequencer Illumina Used for next-generation sequencing
Assorted glassware (beaker, flasks, pipettes, test tubes, repietters) VWR

DOWNLOAD MATERIALS LIST

References

  1. Potts, S. G., Biesmeijer, J. C., Kremen, C., Neumann, P., Schweiger, O., Kunin, W. E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol Evolut. 25, (6), 345-353 (2010).
  2. Vanengelsdorp, D., Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J Invertebr Pathol. 103, Suppl 1. S80-S95 (2010).
  3. Ellis, J. D., Evans, J. D., Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, (1), 134-136 (2010).
  4. Vanbergen, A. J. Insect Pollinators Initiative. Threats to an ecosystem service: pressures on pollinators. Front Ecol Environ. 11, (5), 251-259 (2013).
  5. Cameron, S. A., et al. Patterns of widespread decline in North American bumble bees. Proc. Natl. Acad. Sci. U.S.A. 108, (2), 662-667 (2011).
  6. Szabo, N. D., Colla, S. R., Wagner, D. L., Gall, L. F., Kerr, J. T. Do pathogen spillover, pesticide use, or habitat loss explain recent North American bumblebee declines? Conser Lett. 5, (3), 232-239 (2012).
  7. Klein, A. -M., et al. Importance of pollinators in changing landscapes for world crops. Proc R Soc Lond [Biol]. 274, (1608), 303-313 (2007).
  8. Sánchez-Bayo, F., Goulson, D., Pennacchio, F., Nazzi, F., Goka, K., Desneux, N. Are bee diseases linked to pesticides? - A brief review. Environ Int. 89, 7-11 (2016).
  9. Kwong, W. K., Moran, N. A. Gut microbial communities of social bees. Nature Rev. Microbiol. 14, (6), 374-384 (2016).
  10. Engel, P., et al. The Bee Microbiome: Impact on Bee Health and Model for Evolution and Ecology of Host-Microbe Interactions. mBio. 7, (2), e02164-e02115 (2016).
  11. Henry, M., et al. A common pesticide decreases foraging success and survival in honey bees. Science. 336, (6079), New York, N.Y. 348-350 (2012).
  12. Pettis, J. S., vanEngelsdorp, D., Johnson, J., Dively, G. Pesticide exposure in honey bees results in increased levels of the gut pathogen Nosema. Die Naturwissenschaften. 99, (2), 153-158 (2012).
  13. Williamson, S. M., Wright, G. A. Exposure to multiple cholinergic pesticides impairs olfactory learning and memory in honeybees. J. Exp. Biol. 216, (10), 1799-1807 (2013).
  14. Artz, D. R., Pitts-Singer, T. L. Effects of fungicide and adjuvant sprays on nesting behavior in two managed solitary bees, Osmia lignaria and Megachile rotundata. PLoS ONE. 10, (8), (2015).
  15. Johnson, R. M., Wen, Z., Schuler, M. A., Berenbaum, M. R. Mediation of Pyrethroid Insecticide Toxicity to Honey Bees (Hymenoptera: Apidae) by Cytochrome P450 Monooxygenases. J. Econ. Entomol. 99, (994), 1046-1050 (2006).
  16. Pilling, E. D., Bromleychallenor, K. A. C., Walker, C. H., Jepson, P. C. Mechanism of synergism between the pyrethroid insecticide lambda-cyhalothrin and the imidazole fungicide prochloraz, in the honeybee (Apis mellifera L). Pest Biochem Physiol. 51, (1), 1-11 (1995).
  17. Iwasa, T., Motoyama, N., Ambrose, J. T., Roe, R. M. Mechanism for the Differential Toxicity of Neonicotinoid Insecticides in the Honey Bee Mechanism for the differential toxicity of neonicotinoid insecticides in the honey bee, Apis mellifera. Crop Protection. (2016).
  18. Mullin, C. A., et al. High levels of miticides and agrochemicals in North American apiaries: implications for honey bee health. PLoS One. 5, (3), e9754 (2010).
  19. Pettis, J. S., Lichtenberg, E. M., Andree, M., Stitzinger, J., Rose, R., Vanengelsdorp, D. Crop pollination exposes honey bees to pesticides which alters their susceptibility to the gut pathogen Nosema ceranae. PLoS One. 8, (7), e70182 (2013).
  20. David, A., et al. Widespread contamination of wildflower and bee-collected pollen with complex mixtures of neonicotinoids and fungicides commonly applied to crops. Environ Int. 88, 169-178 (2016).
  21. Zhu, W., Schmehl, D. R., Mullin, C. A., Frazier, J. L. Four common pesticides, their mixtures and a formulation solvent in the hive environment have high oral toxicity to honey bee larvae. PLoS One. 9, (1), e77547 (2014).
  22. Simon-Delso, N., Martin, G. S., Bruneau, E., Minsart, L. A., Mouret, C., Hautier, L. Honeybee colony disorder in crop areas: The role of pesticides and viruses. PLoS ONE. 9, (7), (2014).
  23. Park, M. G., Blitzer, E. J., Gibbs, J., Losey, J. E., Danforth, B. N. Negative effects of pesticides on wild bee communities can be buffered by landscape context. Proc R Soc Lond [Biol]. 282, (1809), (2015).
  24. van Engelsdorp, D., et al. "Entombed Pollen": A new condition in honey bee colonies associated with increased risk of colony mortality. J Invertebr Pathol. 101, (2), 147-149 (2009).
  25. Bernauer, O. M., Gaines-Day, H. R., Steffan, S. A. Colonies of bumble bees (Bombus impatiens) produce fewer workers, less bee biomass, and have smaller mother queens following fungicide exposure. Insects. 6, (2), 478-488 (2015).
  26. Tu, C. M. Effect of fungicides, captafol and chlorothalonil, on microbial and enzymatic activities in mineral soil. J Environ Sci Health B. 28, (B28), 67-80 (1993).
  27. Huang, C. -Y., Ho, C. -H., Lin, C. -J., Lo, C. -C. Exposure effect of fungicide kasugamycin on bacterial community in natural river sediment. J Environ Sci Health B. 45, (5), 485-491 (2010).
  28. Artigas, J., et al. Effects of the fungicide tebuconazole on microbial capacities for litter breakdown in streams. Aquat. Toxicol. 122, 197-205 (2012).
  29. Goerzen, D. W. Microflora associated with the alfalfa leafcutting bee, Megachile rotundata (Fab) (Hymenoptera: Megachilidae) in Saskatchewan, Canada. Apidologie. 22, (5), 553-561 (1991).
  30. Anderson, K. E., Sheehan, T. H., Eckholm, B. J., Mott, B. M., DeGrandi-Hoffman, G. An emerging paradigm of colony health: Microbial balance of the honey bee and hive (Apis mellifera). Insectes Sociaux. 58, (4), 431-444 (2011).
  31. Crotti, E., et al. Microbial symbionts of honeybees: a promising tool to improve honeybee health. N. Biotechnol. 30, (6), 716-722 (2013).
  32. Koch, H., Schmid-Hempel, P. Socially transmitted gut microbiota protect bumble bees against an intestinal parasite. Proc. Natl. Acad. Sci. U.S.A. 108, (48), 19288-19292 (2011).
  33. Anderson, K. E., et al. Microbial ecology of the hive and pollination landscape: bacterial associates from floral nectar, the alimentary tract and stored food of honey bees (Apis mellifera). PloS One. 8, (12), e83125 (2013).
  34. Evans, E. C., Spivak, M. Effects of Honey Bee (Hymenoptera: Apidae) and Bumble Bee (Hymenoptera: Apidae) Presence on Cranberry (Ericales: Ericaceae) Pollination. J Econ Entomol. 99, (3), 614-620 (2006).
  35. Goulson, D., et al. Can alloethism in workers of the bumblebee, Bombus terrestris, be explained in terms of foraging efficiency? Anim. Behav. 64, (1), 123-130 (2002).
  36. ThermoFisher Scientific. User Guide: Qubit dsDNA HS Assay Kits. Available from: https://tools.thermofisher.com/content/sfs/manuals/Qubit_dsDNA_HS_Assay_UG.pdf 3-6 (2010).
  37. Khadempour, L., LeMay, V., Jack, D., Bohlmann, J., Breuil, C. The Relative Abundance of Mountain Pine Beetle Fungal Associates Through the Beetle Life Cycle in Pine Trees. Microbial Ecol. 64, (4), 909-917 (2012).
  38. Dorn-In, S., Hölzel, C. S., Janke, T., Schwaiger, K., Balsliemke, J., Bauer, J. PCR-SSCP-based reconstruction of the original fungal flora of heat-processed meat products. Int J Food Microbiol. 162, (1), 71-81 (2013).
  39. Klindworth, A., et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 41, (1), (2013).
  40. White, T., Bruns, T., Lee, S., Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. 18, (1), 315-322 (1990).
  41. Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Available from: http://ngs.biodiv.tw/NGSCore/wp-content/uploads/Documents/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  42. Kõljalg, U., et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 22, (21), 5271-5277 (2013).
  43. Wang, Q., Garrity, G. M., Tiedje, J. M., Cole, J. R. Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl. Environ. Microbiol. 73, (16), 5261-5267 (2007).
  44. Team, R. C. R: A language and environment for statistical computing [Computer software]. R Foundation for Statistical Computing. Vienna, Austria. (2015).
  45. Kaltenpoth, M., Engl, T. Defensive microbial symbionts in Hymenoptera. Funct Ecol. 28, (2), 315-327 (2014).
  46. Gerth, M., Saeed, A., White, J. A., Bleidorn, C. Extensive screen for bacterial endosymbionts reveals taxon-specific distribution patterns among bees (Hymenoptera, Anthophila). FEMS Microbiol Ecol. 91, (6), (2015).
  47. Smith, C. J., Osborn, A. M. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology. FEMS Microbiol Ecol. 67, (1), 6-20 (2009).
  48. Kim, M., Morrison, M., Yu, Z. Evaluation of different partial 16S rRNA gene sequence regions for phylogenetic analysis of microbiomes. J Microbiol Methods. 84, (1), 81-87 (2011).
  49. DeSantis, T. Z., et al. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 72, (7), 5069-5072 (2006).
  50. Langille, M. G. I., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature Biotechnol. 31, (9), 814-821 (2013).
  51. Malik, S., Beer, M., Megharaj, M., Naidu, R. The use of molecular techniques to characterize the microbial communities in contaminated soil and water. Environ Int. 34, (2), 265-276 (2008).
  52. Ladurner, E., Bosch, J., Kemp, W. P., Maini, S. Assessing delayed and acute toxicity of five formulated fungicides to Osmia lignaria and Apis mellifera. Apidologie. 36, (3), 449-460 (2005).
  53. Huntzinger, C. I., James, R. R., Bosch, J., Kemp, W. P. Fungicide Tests on Adult Alfalfa Leafcutting Bees (Hymenoptera: Megachilidae). J Econ Entomol. 101, (4), 1088-1094 (2008).
  54. Gradish, A. E., Scott-Dupree, C. D., Shipp, L., Harris, C. R., Ferguson, G. Effect of reduced risk pesticides for use in greenhouse vegetable production on Bombus impatiens (Hymenoptera: Apidae). Pest Manag. Sci. 66, (2), 142-146 (2010).
  55. Calderone, N. W. Insect pollinated crops, insect pollinators and US agriculture: trend analysis of aggregate data for the period 1992-2009. PloS One. 7, (5), e37235 (2012).
  56. Ollerton, J., Winfree, R., Tarrant, S. How many flowering plants are pollinated by animals? Oikos. 120, (3), 321-326 (2011).
אמפירית, Metagenomic, שיטות חישוביות להאיר את מנגנוני הבריאות דבורה איזה פשרה קוטלי פטריות
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).More

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter