Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Environment

Empirica, metagenomica e tecniche computazionali illuminano i meccanismi attraverso i quali salute delle API di fungicidi compromesso

Published: October 9, 2017 doi: 10.3791/54631

Summary

Consorzi microbici all'interno alveari dell'ape di bumble arricchiscono e preservare il polline per larve di ape. Mediante sequenziamento di nuova generazione, insieme al laboratorio ed esperimenti sul campo, questo manoscritto descrive protocolli utilizzati per verificare l'ipotesi che residui di fungicidi alterano il microbioma di polline e demographics di Colonia, infine conducendo alla Colonia perdita.

Abstract

I coltivatori spesso utilizzano fungicida spray durante la fioritura per proteggere le colture contro la malattia, che espone le API ai residui di fungicidi. Anche se considerato "bee-safe", c'è prova di montaggio che residui di fungicida in polline sono associate con i declini di ape (per specie di ape di bumble e miele). Mentre i meccanismi rimangono relativamente sconosciuti, i ricercatori hanno speculato che la simbiosi di ape-microbo sono coinvolti. Microbi giocano un ruolo fondamentale nella conservazione e/o elaborazione di polline, che serve come nutrimento per le API larvale. Alterando la comunità microbica, è probabile che i fungicidi interrompono questi servizi microbo-mediata e quindi compromettono la salute delle API. Questo manoscritto descrive i protocolli utilizzati per indagare i meccanismi indiretti da cui fungicidi possono essere la causa declino di Colonia. Esperimenti di gabbia esponendo le API ai fiori fungicida-trattati hanno già fornito la prima prova che fungicidi causano perdite colonia profonda in un calabrone nativo (Bombus impatiens). Utilizzando il campo rilevanti dosi di fungicidi, una serie di esperimenti sono stati sviluppati per fornire una descrizione più fine delle dinamiche di comunità microbica di polline fungicida-esposti. Cambiamenti nella composizione strutturale di assemblaggi fungine e batteriche all'interno il microbioma di polline sono indagati dal sequenziamento di nuova generazione e analisi metagenomica. Esperimenti sviluppati nel presente documento sono stati progettati per fornire una comprensione meccanicistica di come fungicidi influenzano il microbioma del polline-disposizioni. In definitiva, questi risultati dovrebbero far luce sulla via indiretta attraverso il quale fungicidi possono causare cali di Colonia.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Gestito e specie di api selvatiche sono verificati diffuse diminuisce, con importanti implicazioni per entrambi i sistemi naturali e agricoli1. Nonostante sforzi concertati per comprendere le cause di questo problema, i fattori guida declini di ape del miele non sono ancora ben compreso2,3,4. Per alcune specie di api selvatiche, native, la situazione è diventata terribile5,6. Se le popolazioni di API non possono essere sostenute quando si intersecano con l'agricoltura industriale, la popolazione continuerà a cadere e le colture che richiedono impollinatori (35% della produzione mondiale7) resisterà ridotto raccolti.

Mentre molti potenziali fattori quali l'esposizione dell'antiparassitario, malattia e habitat perdita1,4,8,9,10 sono stati implicati nel declino di API del miele, relativamente piccolo è conosciuto circa l'effetto interattivo di questi fattori di stress sulla salute delle API native, all'interno o vicino a sistemi agricoli. Molti sforzi di ricerca corrente continuano a concentrarsi su insetticidi, (ad es., neonicotinoidi11,12), anche se in passato la ricerca indica che fungicidi possono anche svolgere un ruolo nella diminuzione di API alterando la formazione della memoria, ricezione olfattiva13, nido riconoscimento14, l'attività enzimatica e funzioni metaboliche15,16,17. A livello globale, fungicidi continuano ad essere applicati alle colture di fioritura durante la fioritura. Studi recenti hanno documentato che le API comunemente riportare residui fungicida in alveare18, infatti, hanno dimostrato una grande proporzione di alveari testati contenuti fungicida residui19,20. Ulteriore lavoro ha rivelato quel residuo fungicida è associato con alti tassi di miele ape mortalità larvale21,22,23 e la presenza di "polline entombed" all'interno di colonie, che anche se non tossico, è privo di attività microbica e nutrizionalmente compromessa24. Nonostante il fatto che fungicidi lungamente sono stati considerati "bee-safe", ora c'è prova che l'esposizione al fungicida da solo può causare perdite gravi Colonia in una specie di ape di bumble nativo, Bombus impatiens25.

Per stabilire la causalità tra l'esposizione fungicida e Colonia mortalità, il modus operandi di queste sostanze chimiche devono essere determinate. Come evidenziato nei suoli26, sedimenti27e ambienti acquatici28, mirando ai funghi, fungicidi più probabile alterano fungina abbondanza e diversità all'interno di polline-disposizioni, quindi richiamando un'importante comunità shift che fortemente può favorire i batteri. Senza concorrenti fungine o antagonisti, alcuni batteri patogeni possono proliferare relativamente incontrollato, facilitando il deterioramento di polline-disposizioni. Ricerca passata ha dimostrato che i microrganismi, in particolare lieviti e funghi filamentosi, servire come simbionti nutrizionale per le API29,30,31, proteggere contro parassiti e patogeni32 ,33e fornire la conservazione a lungo termine dei depositi di polline. Fungicidi, pertanto, indirettamente possono danneggiare le API immature interrompendo la comunità microbica che è necessario per fornire tali servizi e/o aumentando la suscettibilità a parassiti e patogeni opportunistici12. Con l'aumento di richieste sulla produzione alimentare, raccolti in tutto il mondo vengono spruzzati ogni anno con fungicidi durante la fioritura, sottolineando la necessità di comprendere la portata di tali effetti indotti da fungicida.

A-data, le lacune di conoscenza primaria relative API native microbica ecologia può essere rappresentato dalle seguenti domande: fino a che punto cambia fungicida della comunità microbica nel ape polline-disposizioni? Quali sono gli effetti a valle di consumare polline con una comunità microbica profondamente alterata? In linea con queste domande ecologicamente germane, gli esperimenti sono stati sviluppati con gli obiettivi primari di rivelare 1) quel residuo fungicida da solo può causare grave Colonia declino in una specie di API native; 2) il grado a cui le comunità microbiche in polline-disposizioni sono alterate di fungicidi e 3) come la salute delle API è influenzata da una comunità microbica gravemente alterata. Gli obiettivi sperimentali sono stati definiti per affrontare le questioni di cui sopra utilizzando una combinazione di esperimenti di laboratorio e campo-base. Utilizzando state-of-the-art metagenomica e tecniche molecolari a fianco dei tradizionali metodi di osservazione del campo, la ricerca si propone di mettere insieme i potenziali effetti dei fungicidi sulla salute delle API.

Il primo obiettivo di questo studio è di dimostrare che l'esposizione fungicida da solo può causare perdite di Colonia significativa tra specie di API native. Uno studio che coinvolge gabbie grande campo è stato utilizzato per studiare gli effetti dell'esposizione di fungicida sulla crescita Colonia di Bombus impatiens, un'ape nativa onnipresente, abbondante negli Stati Uniti (Figura 1, Figura 2, Figura 3). È stato supposto che fungicida-trattati alveari presenterebbe fitness inferiore e Demografia atipico rispetto ai non esposti alveari. I dati ottenuti da questo esperimento supportano questa ipotesi, dimostrando che i residui di fungicidi all'interno di polline possono essere l'unica causa delle perdite di Colonia profonda in un nativo bumble bee specie25. Il secondo obiettivo di questo studio è quello di indagare la risposta del microbioma polline all'esposizione di fungicida. È stato ipotizzato che la composizione della comunità di microbi all'interno di polline-disposizioni esposti ai fungicidi sarà diversa da quello di polline non trattati. Mentre diversità e abbondanza fungina dovrebbero diminuire significativamente, i batteri e/o una singola specie fungina dominante probabilmente crescerà incontrollata in assenza di altri funghi concorrenti. Attraverso una serie di prove in vivo , questi cambiamenti nella composizione della comunità microbica saranno analizzati utilizzando metagenomica.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. esaminare l'effetto del fungicida esposizione su Bumble Bee Colony successo utilizzando campo gabbia esperimenti

  1. Set 10 maglia gabbie in un campo piantato con avena. Scavare una trincea intorno ogni gabbia e tutti e quattro i bordi della gabbia della maglia di scavare nel terreno per garantire che le API non possono sfuggire. Magazzino le gabbie con piante fiorite in vaso, che sono noti per essere attraente per le API (ad es. grano saraceno, borragine, alyssum, cosmos e girasoli) ( Figura 2).
  2. Supplemento le gabbie con un unico cassetto (36 x 42 cm) di trifoglio in fiore. Risorse floreali all'interno di un angolo della gabbia, occupando uno spazio di circa 2,5 m x 1 m. vegetare la restante area di gabbia di avena cluster.
  3. Assegnare casualmente il calabrone colonie, ciascuna contenente i lavoratori e una singola con letto queen, un trattamento (fungicida presente/assente, N = 5 colonie per ogni trattamento, 10 colonie totale), quindi inserirli all'interno di una gabbia di campo (N = 1/gabbia) per 29 giorni (23 giugno -21 luglio 2014).
  4. Orient le caselle di Colonia tale che la Colonia ' aperture s punto a sud per fornire le API con condizioni di navigazione ottimale. Sovvenzionare le colonie con vesciche di acqua zucchero, collocati all'interno delle scatole di alveare per integrare disponibilità di nettare.
  5. Applica basati su clorotalonil fungicida a livello campo-pertinenti (20 g/L) per piante fiorite nelle gabbie trattamento cinque fungicida, utilizzando una mano tenuta spruzzatore dell'antiparassitario, due volte durante lo studio (giorno 0 e 13). Cappotto in modo uniforme i fiori tale che nessun ulteriore liquido aderisce a superfici floreale ( Figura 3).
  6. A conclusione dello studio gabbia campo, rimuovere a mano le colonie di b. impatiens dalle gabbie, raffreddare gli alveari mettendo nel congelatore a -20 ° C per 20 min.
  7. Rimuovere le API utilizzando pinze sterili e registrare il numero di larve, pupe, le femmine adulte (i. e. raccoglitrici) e i maschi adulti. Utilizzando una bilancia analitica registrare il peso a secco della regina madre, larve, pupe, femmine adulte (cioè raccoglitrici) e maschi adulti.

2. Esaminare gli effetti di fungicida esposizione sulle comunità microbiche in polline-disposizioni di Bumble Bee nidi utilizzando laboratorio basato In Vivo studi

  1. Pulverize commercialmente acquistato polline polvere finissima utilizzando uno standard laboratorio-laminatoio di sfera. Sterilizzare in polvere polline ammollo in etanolo al 70%, lasciandolo evaporare durante la notte sotto la luce UV. Verificare la sterilità del polline di placcatura ~0.5 mg su General-Purpose agarizzati.
    1. a secco, polline sterilizzato, utilizzando pipette sterilizzati, aggiungere il dosaggio relativo campo del fungicida: propiconazolo al 14,3%; azoxystrobin 22,9% per trattamenti (0.74 µ l e 0,65 µ l rispettivamente / giorno / alveare). Mescolare bene usando bastoni di legno sterilizzati.
  2. Posto 6 alveari sperimentali (n = 3 ciascuno per il controllo e trattamento) in un laboratorio pulito, igienico benchtop mantenuta a temperatura ambiente. Ogni giorno pesare 4,27 g di polline 34 , 35, mescolato con acqua sterile (per controllo) all'interno di una cappa usando una tecnica asettica standard o fungicidi (per i trattamenti).
    1. Utilizzando le porte trappola fornite dal lato della scatola di cartone che racchiude le arnie, introdurre il polline all'interno le arnie. Supplemento gli alveari con soluzione di zucchero sterilizzato ogni settimana. Continuare il regime d'alimentazione per quattro settimane.
  3. a conclusione dello studio lab-basata, raffreddare gli alveari mettendo in congelatore a-20 ° C per 20 min. raschiare fuori il polline-disposizioni contenute all'interno di covata chambers utilizzando pinze sterili e spatole e posto in tubi di stoccaggio sterile. Conservare a-80 ° C. Count e registrare il peso dei lavoratori e regina madre all'inizio e alla fine dell'esperimento (punto 1.7).
  4. Isolare il DNA da campione di polline-fornitura mediante isolamento del DNA disponibile in commercio Kit (Vedi materiali tavolo per dettagli).
    1. Aggiungere 0,25 g di polline-disposizione per estrazione tubi, brevemente vortice mescolare.
    2. Fare un 200 mg/mL soluzione di lisozima in acqua distillata deionizzata, abbastanza per 50 µ l di campione. Agitare vigorosamente per soluzione completamente forma.
    3. Aggiungere 50 µ l della soluzione di lisozima per i tubi di estrazione con il campione in esso e mescolare bene capovolgendo più volte. Incubare la provetta per 10 min a 37 ° C in un bagno d'acqua. Se ha forma un precipitato, riscaldare la soluzione a 60 ° C fino a quando disciolto prima dell'uso.
    4. Aggiungere 70 µ l di soluzione acquosa Lisi per tubi di estrazione, fissare orizzontalmente su un pad di vortice a base piatta con nastro adesivo, e tubi di vortice per 10 min. centrifuga a 10.000 x g per 30 s a temperatura ambiente.
    5. Trasferire il surnatante in una provetta di raccolta pulita 2 mL. Aggiungere 250 µ l di soluzione di precipitazione della proteina e vortexare per 5 s. Incubare a 4 ° C per 5 min in un bagno di ghiaccio.
      Nota: Si aspettano tra 400 µ l a 500 µ l del surnatante. Surnatante potrebbe ancora contenere alcune particelle.
    6. Centrifugare le provette a temperatura ambiente per 1 min a 10.000 x g e trasferire fino a 600 µ l del surnatante in una provetta di raccolta pulita 2 mL. Aggiungere 200 µ l di soluzione per la rimozione acquosa inibitore, brevemente, vortex e incubare a 4 ° C per 5 min. Centrifugare le provette a temperatura ambiente per 1 min a 10.000 x g. trasferire fino a 750 µ l del surnatante in una provetta di raccolta pulita 2 mL.
    7. Aggiungere 1200 µ l di soluzione acquosa bind per il surnatante e vortexare per 5 s. caricare circa 675 µ l del surnatante in un filtro spin e centrifugare a 10.000 x g per 1 min a temperatura ambiente. Scartare il flusso attraverso.
    8. Ripetere 2.4.7. due volte.
      Nota: Un totale di tre carichi per ogni campione elaborato sono necessari.
    9. Aggiungere 500 µ l etanolo e centrifuga a temperatura ambiente per 30 s a 10.000 x g. scartare il flusso attraverso e centrifugare nuovamente a temperatura ambiente per 1 min a 10.000 x filtro spin di g. posto in una provetta pulita 2 mL.
    10. Buffer di
    11. aggiungere 100 µ l di eluizione al centro della membrana del filtro. Centrifuga a temperatura ambiente per 30 s a 10.000 x g. gettare il filtro spin. Archivio raccolto DNA tra-20 ° C e -80 ° C
  5. uso isolato del DNA per il sequenziamento.
    1. Quantificare e normalizzare il DNA isolato a 2 ng / µ l di analisi fluorometrica. Reazioni
      1. preparare in triplice copia per ogni campione estratto confrontare la quantità relativa di 28S (pianta), analizzare i suoi (funghi) e 16S (batterica) componenti di ogni campione di polline-disposizione 36. Garantire che ogni reazione contiene 10 ng di DNA totale e 2 x di mix master di tintura base asimmetrica cianina 2,5 µ l di primer forward e reverse coppie 28KJ/28B 37 per pianta e ITS1/ITS5.8R per DNA fungoso 38 .
    2. Amplificare DNA utilizzando i seguenti parametri: pre-denaturazione 2 min a 50 ° C, 2 min denaturazione iniziale a 95 ° C, 40 cicli di (15 s a 98 ° C, 15 s a 58 ° C, 60 s a 72 ° C), seguita da una curva di fusione.
    3. Preparare un protocollo PCR 2-step, nidificato utilizzando librerie di sequenziamento di nuova generazione rRNA 16S di targeting regione variabile V3/V4 e ITS / 5.8s regione distanziatore rRNA.
      1. Aggiungere 12,5 µ l di DNA a 5 pmoli di ciascun primer e 2 x mix master. Fare reazioni separate per ciascuna regione (16S o ITS; cfr. tabella 1). Modificare primers specifici regione come descritto in precedenza 39 , 40 aggiungere sequenze nucleotidiche di adattatore specifico sequencer sporgenza per le sequenze di gene-specific del.
      2. Eseguire amplificazione iniziale utilizzando i seguenti parametri: 3 min denaturazione iniziale a 95 ° C, 25 cicli di (30 s a 95 ° C, 30 s a 55 ° C, 30 s a 72 ° C), 5 min estensione finale a 72 ° C.
      3. Seguente iniziale amplificazione, verificare la dimensione di biblioteca e la quantità di mobilità elettroforetica e pulire usando un 1 x volume fase solida reversibile immobilization perline per rimuovere primer residuo e reagenti di reazione. Piscina 16S e sua ampliconi quantitativamente per creare un pool di amplicon singolo per ciascun campione.
      4. Aggiungere schede specifiche di sequencer e assaggiare gli indici dual specifici utilizzando i seguenti primer (Vedi tabella 1). Aggiungere 2,5 µ l di DNA amplificato a 5 pmoli di ciascun primer e 2 x mix master. Eseguire amplificazione libreria utilizzando i seguenti parametri: 3 min denaturazione iniziale a 95 ° C, 8 cicli di (30 s a 95 ° C, 30 s a 55 ° C, 30 s a 72 ° C), 5 min estensione finale a 72 ° C.
    4. Seguente PCR, pulito finite librerie utilizzando un volume di 1 x di perline reversibile immobilizzazione in fase solida. Valutare la qualità e la quantità delle librerie finite utilizzando la mobilità elettroforetica e fluorimetria, rispettivamente. Standardizzare le librerie a 2 µM e piscina prima del sequenziamento.
    5. Eseguire il sequenziamento di nuova generazione su una piattaforma analoga per le schede aggiunte nella PCR secondario, con una lunghezza adeguata per coprire l' intero amplicone 41.
  6. Sequenza annotazione e analisi della composizione microbica.
    1. Combine coppia-fine dati di sequenziamento (R1 e R2) nel singolo contigs per librerie tutte in sequenza. Dopo l'Unione di file sia R1 e R2, viene prodotto un file di singolo fasta per ognuna delle librerie.
      Nota: Questo passaggio e i processi descritti di seguito (se non diversamente indicato) sono eseguiti in Mothur versione 1.38.0 38.
    2. Schermo ogni file fasta per rimuovere basi ambigui, inaspettati lunghe sequenze e lunghi omopolimeri.
      Nota: I parametri per lo screening e la rimozione di sequenza sono maxambig = 0, maxlength = 600 e maxhomop = 8 per entrambi i geni. Rimuovere le sequenze identiche, ma mantenere una tabella di contingenza separatamente per tutte le librerie (a.k.a. tabella di conteggio in Mothur).
    3. Allineare sequenze uniche della biblioteca gene 16S contro la versione del database SILVA 123 e la biblioteca ITS gene contro l'unire ITS database 42.
      Nota: Sequenze devono essere annotate dal livello unito al livello di genere.
      1. Successivamente, cluster allineati sequenze con la funzione pre.cluster utilizzando diff = 5 e rimuovere le chimere.
    4. Classificare sequenze utilizzando il metodo Wang 43 basato sui file di unire la sua (per gene ITS) Tassonomia (valore massimo di 80%) e SILVA (per gene 16S).
    5. Caricare in R 44 le tabelle di contingenza (uno per ogni gene) generate durante il processo di classificazione in Mothur. Ad ogni livello tassonomico, ottenere abbondanza relativa a libreria per un'ulteriore analisi della comunità microbica modifiche.
      Nota: Ogni livello tassonomico, unire insieme gruppi tassonomici quando abbondanza relativa è inferiore al 2% per tutte le ripetizioni sperimentale.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Studio di gabbia di campo:

I dati ottenuti dagli esperimenti gabbia colonie dell'ape di bumble presentava una significativa risposta all'esposizione di fungicida. Le arnie fungicida-trattati prodotta significativamente meno lavoratori (12,2 ± 3.8, media ± SE) che gli alveari di controllo (43,2 ± 11,2, F1,9= 6.8, p = 0,03) (Figura 4). Inoltre, la biomassa delle API degli alveari fungicida-trattati (0,91 g ± 0.15) era significativamente più bassa rispetto gli alveari di controllo (2,36 g ± 0.55; F 1,9 = 8.3, p = 0,02). Questo modello di biomassa abbassata in alveari fungicida-trattati inoltre è stato osservato tra le regine di madre. Le regine degli alveari fungicida-trattati ha presentati con una biomassa significativamente più bassa (0,14 g ± 0.04) rispetto le regine degli alveari di controllo (0,27 g ± 0.01; Z = 2.5, p = 0,01). Tuttavia, l'esposizione fungicida non ha influenzato il numero di larve e pupe maschi attraverso i trattamenti. La biomassa di fasi di vita discreti (larve, pupe, lavoratori e maschi adulti) e pesi singoli per le larve, pupe e lavoratori non ha mostrato alcuna differenza tra fungicida-trattati e controllo hives.

Studio Lab-basata:

Dati ottenuti da esperimenti di laboratorio hanno indicato che prima dell'esposizione di fungicida, controllo e fungicida-trattati alveari avevano conteggio lavoratore medio statisticamente comparabile (alveari di controllo = 28.0 ± 3.1; orticaria fungicida-trattati = 31.67 ± 2.0; n = 3 ogni) e la regina di peso (alveari di controllo = 0,77 g ± 0.04; orticaria fungicida-trattati = 0,74 g ± 0.01). Tuttavia, alla fine dello studio, conteggio lavoro era significativamente più alta in alveari di controllo (67.67 ± 4.3), rispetto ai trattati con fungicida alveari (45.33 ± 3,8) (t4 = 3.89, p = 0,01). Popolazione di lavoratore ~ 150% negli alveari di controllo rispetto a ~ 45% in alveari trattati con fungicida. Allo stesso modo, il peso finale della regina madre è rimasto relativamente immutato nel controllo alveari (0,76 g ± 0.02) rispetto ad un ~ 35% diminuiscono in alveari fungicida-trattati (0,49 g ± 0,16). Presi insieme, questi risultati sono coerenti con i risultati precedentemente pubblicati25 e indicano l'esposizione fungicida colpite fitness di Colonia come testimoniano meno numeri dell'operaio e ridotto pesi regina madre (Figura 5).

Analisi Metagenomica del polline-disposizioni indicate chiare differenze fra le comunità microbiche raccolte da fungicida-trattati e controllano alveari (Figura 6). C'era una diminuzione (> 95%) nell'abbondanza relativa di Streptomycetales comunemente isolati, Enterobacteriales negli alveari trattati con fungicida. Interessante, entrambi i gruppi sono noti per la loro attività antifungina e ruolo nel polline-conservazione30,45 all'interno degli ambienti di alveare calabrone. Batterici membri dell'ordine Rickettsi dal suo cognome, che include gli agenti patogeni comuni di artropodi46, ha mostrato molto maggiore abbondanza negli alveari fungicida trattato. Alveari fungicida-trattati ha avuto una bassa abbondanza di funghi appartenenti agli ordini Eurotiales e organismi modello e una maggiore abbondanza di ordini Capnodiales e Ascosphaerales rispetto al controllo Arnie (Figura 7). Come previsto, per batteri e funghi, indice di diversità (H) e l'uguaglianza (E) di Shannon era più bassa in alveari fungicida-trattati rispetto ai controlli, anche se queste differenze non erano statisticamente significative (batteri: H alveari di controllo =1,25 ± 0,3, Hfungicida-trattati orticaria = 0.82 ± 0,2, Ealveari di controllo = 0.46 ± 0,1; Efungicida-trattati orticaria = 0.31 ± 0,1; funghi: Hcontrollo orticaria =0,99 ± 0,3, Hfungicida-trattati orticaria = 0.72 ± 0,4, Ealveari di controllo = 0,57 ± 0.2; Efungicida-trattati orticaria = 0.42 ± 0,2). Anche se dettagliare le implicazioni metaboliche e funzionali di tali comunità si sposta era oltre lo scopo di questo studio, combinato con il conteggio delle colonie e dati di peso, questi risultati suggeriscono che l'esposizione fungicida potrebbe interessare declino nella salute della colonia di interrompere la simbiosi tra le API e il microbioma di polline. Ulteriore indagine sul ruolo di specifici gruppi microbici che influenzano la sopravvivenza larvale è raccomandato di valutare meglio il ruolo del microbioma polline nel sostenere le popolazioni di api sane.

Figure 1
Figura 1: all'interno di un nido di Bombus impatiens . Immagine ad alta risoluzione dei lavoratori tendente a cellette. Cellette possono contenere diverse uova e larve in un dato momento. Lo sviluppo di larve si nutre di polline-disposizioni periodicamente introdotte nella cella. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: gabbie di grande campo eretto per ospitare colonie dell'ape. Ogni gabbia di rete metallica (N = 10) era rifornito con uno commercialmente acquistato Bombus impatiens alveare, come pure in fioritura pianta specie conosciute per attirare le API. I fiori erano riforniti in un angolo della gabbia e l'area rimanente è stato vegetato con erba di avena. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: residuo fungicida su un girasole recentemente spruzzato. Il giorno 0 e 13 dell'esperimento sono state spruzzate dosi rilevanti di campo del fungicida. Usando uno spruzzatore di pesticidi, i fiori erano uniformemente rivestiti con una soluzione fungicida al crepuscolo/sera per evitare il contatto diretto con api bottinatrici. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: impatto dei residui di fungicida sui bombi in esperimento gabbia. Colonie dell'ape di Bumble che sono stati esposti ai residui di fungicidi il polline ha esibito i declini significativi nel formato della Colonia (reductioni in abbondanza femmina adulto) nel corso di un solo mese. Barre di errore rappresentano ± 1SE; p < 0.05. Questa figura è stata modificata da Bernauer et al. 25. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: impatto dei residui di fungicida sui bombi in un esperimento di laboratorio. Colonie dell'ape di Bumble che sono state esposte al polline fungicida-trattati hanno esibito declini significativi nel formato della Colonia (riduzioni in abbondanza di lavoratore adulto) e calo di peso di regina madre nel corso di un solo mese. Barre di errore rappresentano ± 1SE; p = 0,03. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 6
Figura 6: grafico a torta della metagenomica classificazione delle diversità fungine e batteriche presso l'ordine di rango. Analisi basate su (un) classificazione di ITS basata 16S e (b) dei campioni di polline-fornitura raccolti da controllo e orticaria fungicida-trattati. Alveari di controllo ha dimostrato maggiore diversità e uniformità nella distribuzione microbica. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 7
Figura 7: variazione percentuale in ordine rango relativa abbondanza di batteri e funghi in risposta all'esposizione di fungicida. Metagenomica classificazione delle comunità microbiche utilizzando (un) 16S e (b), ITS base primer Clicca qui per visualizzare una versione più grande di questa figura.

Coppia di primer Tipo di primer Sequenza più superelegante
28KJ/28B Pianta GGC GGT AAA TTC CGT CC /
CGT CCG TGT TTC AAG ACG
ITS1 / ITS5.8 Fungine TCC GTA GGT GAA CCT GCG G /
BAVAGLIO ATC CGT TGT TGA AAG TT
16S avanti / indietro Batterica nidificato 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG-3'/
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACHVGGGTATCTAATCC-3'
ITS1F primer / ITS4 Nidificati fungine 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCGTAGGTGAACCTGCGG - 3'
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC - 3'
Primer di adattatore 5'-AATGATACGGCGACCACCGAGATCTACAC [55555555]
ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
5'-CAAGCAGAAGACGGCATACGAGAT [77777777]
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3 '

Tabella 1: elenco di coppie di primer e primer sequenze impiegati per l'amplificazione del DNA. Vedere testo per i riferimenti.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le indagini sugli effetti dei fungicidi sulla salute delle API sono rimaste un aspetto understudied di strategie di lotta. Il nostro studio si propone di colmare questo divario di conoscenza utilizzando una suite di tecniche complementari che isolano in modo esplicito i potenziali fattori ape declini. La pianificazione, la spiegazione razionale e il rendering di questi esperimenti sono dettagliati sotto.

È importante garantire che nessuna ape sono ammessi per sfuggire la mesh degli esperimenti gabbia, poiché ciò avrebbe compromesso analisi demografia. È anche importante che i nidi artificiali hanno un isolamento sufficiente per proteggere da pioggia e luce solare diretta. Cura dovrebbe essere presa in modo che fungicidi non vengono spruzzati direttamente sui nidi. Le colonie dovrebbero essere fornite con vesciche acqua zucchero per integrare nettare raccolto e prevenire la disidratazione.

Per il laboratorio basato su esperimenti di alimentazione, condizioni di asepsi rigorose dovrebbero essere mantenute per evitare la contaminazione durante la preparazione i pasti di polline. Acquistato in commercio polline deve essere in polvere e UV sterilizzati prima dell'uso. Alveare igiene deve essere mantenuto per prevenire l'infestazione da parassiti estranei come falene dispensa e scarafaggi. Vesciche fluidi dovrebbero essere completati con soluzione di zucchero sterilizzati per prevenire la disidratazione. Per censimento di pre-trattamento, dovrebbe prestare attenzione non per lo stress le API gestendo eccessivo e prolungato per loro mantenere fuori la hived periodi.

Come rendimento del DNA dipende da età e tipo di materiale di partenza, solo i campioni freschi o ben congelati devono essere utilizzati in amplificazione e l'estrazione del DNA. Peso del campione per l'estrazione di DNA non deve superare 0,25 gm, come questo abbasserà il rendimento del DNA. Rendimenti del DNA devono essere quantificati mediante elettroforesi su gel. Upfront quantificazione elettroforetica del DNA isolato è fondamentale prima di procedere alle reazioni di qPCR per garantire amplificazione efficiente47.

Per l'analisi metagenomica, un'analisi più completa della dinamica microbica può essere ottenuta limitando la quantità di sequenze con annotazioni (rilassando la frazione di tollerabile differenze tra sequenze) e riducendo il numero di gruppi tassonomici, come bene come l'Unione di coloro per i quali è considerevolmente bassa abbondanza relativa (< 2%).

La dimensione del campione conservatore (N = 5 per entrambi fungicida trattati e non trattati di alveari Studio gabbia) può gonfiare le varianze nei dati, che saranno minimizzati negli studi futuri utilizzando la replica maggiore. Per aggiungere una maggiore risoluzione e potenza statistica i risultati, le colonie di API sarà censita e pesati prima e dopo l'esposizione di fungicida. L'esperimento di gabbia per periodi più lunghi di esecuzione consentirà la produzione di nuove regine, che può servire come una variabile di risposta supplementare. Con queste modifiche al protocollo attuale, gli studi futuri fornirà maggiori dettagli sulla dinamica di popolazioni di alveare.

La natura idrofobica di polline scoraggia la sua efficiente miscelazione con acqua. Polverizzazione e spulciando i granuli di polline polvere finissima, aiuta nel processo di miscelazione. La quantità di polvere di polline può essere regolata per ottenere la consistenza desiderata. Prestare la massima attenzione per mescolare accuratamente il liquido (acqua o fungicida) per ottenere una distribuzione omogenea dei principi attivi e anche consegna le raccoglitrici.

Come DNA in eccesso può inibire le reazioni di PCR, è consigliabile che il campione non dovrebbe pesano più di Vortex eccessivo di 0,25 g. dovrebbe essere evitata come questo cesoie DNA, abbassando la resa. Rendimento basso del DNA può anche essere un risultato di una prolungata esposizione al buffer di lisi. Primer batteriche dovrebbero essere scelti preferibilmente dalla regione V7-V9 di rRNA 16S per ridurre amplificazione aspecifici del cloroplasto DNA48. Sequenziamento di altri geni, come il gene del rRNA 18S è inoltre in grado di fornire una migliore comprensione della diversità microbica nel polline, così come i cambiamenti di popolazione su utilizzazione del fungicida.

Data la quantità di librerie per l'elaborazione con Mothur, tempo di calcolo può essere notevolmente elevata. Rimozione di singoletti durante il confronto di sequenze contro l'altro (se calcolo le risorse sono limitate, rimuoverli prima della filtrazione chimera) può diminuire notevolmente il tempo richiesto per il calcolo unità tassonomica operative.

Gli esperimenti di gabbia confinare la gamma naturale di volo delle API (in contrapposizione a permettendo loro di foraggio ampiamente attraverso il paesaggio), e non è chiaro il grado a cui tali restrizioni possono influenzare le variabili di risposta. Anche se le gabbie di controllo e trattamento esperienza la stessa gamma di variabili biotiche e abiotiche, è logisticamente impossibile da controllare per il microambiente all'interno di ogni gabbia.

La reale portata delle interazioni microbiche all'interno della Comunità è troppo complesso e intricato di replicare attraverso prove sperimentali. Mentre i nostri dati probabilmente documentano un sottoinsieme della diversità microbica totale all'interno di polline-disposizioni, è il primo spaccato gli effetti interattivi che possono prevalere tra batteri e funghi in presenza/assenza di fungicidi.

Utilizzo di database alternativi per l'allineamento di sequenze49 o stati metabolici funzionali basati su polline diversità batterica50 di predizione in grado di fornire una visione più ampia del microbioma polline. Alla fine, per meglio caratterizzare la dinamica metabolica e funzionale delle comunità microbiche dopo applicazione di fungicida, sequenziamento del genoma intero del polline microbiome è necessario.

Gli esperimenti di gabbia utilizzando alveari acquistati in commercio forniscono uno dei migliori quadri per misurare le variabili di risposta in un ambiente semi-controllato. Causando la minima alterazione all'ecologia naturale delle API (efficienza di foraggiamento, struttura sociale, cura della prole), esperimenti di gabbia minimizzano l'espediente e lo stress, introdotto dall'ambiente artificiale e la movimentazione durante il laboratorio manuale esperimenti.

Al meglio della nostra conoscenza, nessuno studio ha ancora stati intrapresi per valutare gli effetti dei fungicidi sulle dinamiche di comunità microbica nell'ambito del polline-provvedimento di bombi. L'esposizione ai fungicidi può eliminare una o più specie sensibili, interrompere la tregua ecologica tra funghi e batteri. Utilizzando il campo e prove di laboratorio come un crogiolo a giocare fuori queste interazioni, questo studio mira a dimostrare che lo sterminio di specie microbiche residenti possa pervertire l'equilibrio ecologico del microbioma polline, che può a sua volta compromesso salute delle API.

Tecniche di coltura-dipendente come diluizione e placcatura su supporti standard catturasolo una frazione della microflora da un determinato ambiente. Questo può portare a una grave sottorappresentanza delle diversità microbica e saggiati microbi possono andare inosservata51. Per studiare l'ampiezza dei microrganismi, gli scienziati devono fare affidamento su tecniche di coltura-indipendenti, che sono più inclusiva e completa, per es. analisi metagenomica e sequenziamento di nuova generazione. Disegno pesantemente da queste potenti tecniche molecolari, questo studio mira a ottenere una maggiore risoluzione nel microbioma di polline di quelle previste dalla tradizionale tecniche basate sulla cultura da solo.

I risultati di questo studio hanno rivelato profonde perdite del numero di lavoratori all'interno di colonie dell'ape di bumble esposti al fungicida. Per una colonia dell'ape di bumble avere successo, i lavoratori hanno bisogno di fornire risorse sufficienti e cura per la madre-regina e specialmente per lo sviluppo di larve. In definitiva, l'obiettivo della Colonia è quello di massimizzare l'acquisizione di risorse (polline e nettare) tale che figlia-regine come molti come possibile possono essere prodotta entro la fine dell'estate. Figlia sane-regine sono la misura di idoneità per una colonia. Le riduzioni importanti nei lavoratori, quindi, efficacemente i sottosquadri capacità della colonia di produrre regine per l'anno successivo. In questo studio, non solo numeri dell'operaio sono stati diminuiti significativamente, ma la madre-regine dal fungicida trattati alveari ha presentati con biomassa inferiore, presumibilmente come conseguenza di cibo insufficiente entro le raccoglitrici. Data la complessità delle interazioni microbiche all'interno di polline-disposizioni, è difficile distinguere gli effetti interattivi esatti tra funghi e batteri che contribuiscono a questi modelli. Tuttavia, risultati ottenuti da esperimenti ripetuti e replicati come descritto qui, fornirà vitale intuizioni la deragliata simbiosi tra questi due gruppi microbici (sia competitivo, mutualistiche o commensale) in risposta allo stress di xenobiotici, e i suoi effetti a valle sul microbioma di polline.

Attraverso l'utilizzo di potenti strumenti molecolari, la complessità ecologica del microbioma polline possono essere meglio risolti. La comprensione preliminare rivela una pletora di batteri naturalmente presenti e funghi, che contribuiscono collettivamente per mantenere la forma fisica di Colonia. In particolare, i lieviti che sono stati isolati da polline-disposizioni sono conosciuti per bear proprietà battericide e fermentativa, entrambi i quali sono cruciali per lo sviluppo di API larvale. Tali associazioni ecologiche sono indicativi di un alto grado di mutualismo tra API e loro microbioma di polline. Polline-disposizioni, pertanto, rappresentano un effetto di diversità emergente, provocato tramite la coltura di una comunità microbica di ruoli funzionali chiave. In assenza di questi simbionti chiave, il polline-disposizione sembra essere compromessa per gradi sconosciuti. Lavoro continuato in questa direzione, sarà probabilmente spiegare la diversità funzionale di questi microbi e smascherare il loro ruolo come simbionti ape.

La ricerca recente ha smascherato la nozione di fungicidi come essendo innocuo per le API19,24,52,53,54. L'obiettivo di questa ricerca è quello di isolare i meccanismi che guidano fungicida impatti sulle API, quindi illuminando il rapporto di causa-effetto tra fungicida uso e ape diminuisce. Il centro di ipotesi intorno al concetto che simbiosi ape-microbo si stanno alterando significativamente dai residui di fungicida in polline. In definitiva, questo lavoro ri-faranno da cornice come fungicidi sono visto e utilizzati in agricoltura e ambienti urbani. Alla luce dell'attuale crisi globale impollinatore, la ricerca proposta genera nuove conoscenze sull'ecologia di API native, per quanto riguarda le pratiche di produzione agricola. Fungicidi rimangono l'ultimo gruppo di agrochimica efficacemente essere esentata dalle regolazioni di limitare le applicazioni a raccolti durante la fioritura. Di conseguenza, le api selvatiche e non gestito sono costantemente esposti a fungicidi. Un corpo crescente di letteratura suggerisce che, sebbene fungicidi non sono letali per le API il contatto, alle dosi elevate, l'esposizione è molto dannoso, che conduce a più alta mortalità larvale21 e modificato il comportamento del raccoglitore. Si prevede che questo lavoro si illuminerà i meccanismi da cui fungicidi sono danneggiando gli impollinatori. Inoltre, questa ricerca formeranno la base della politica di gestione dei parassiti più saggio e informare i coltivatori delle migliori pratiche gestionali. Questo lavoro sarà anche strumentale nel fornire orientamenti per l'irrorazione di pesticidi migliorato, che possono influenzare pesticidi leggi e regolamenti. Più in generale, questi risultati saranno rilevanti per qualsiasi ecosistema gestito in cui piante fiorite sono visitati attraverso la raccolta di polline insetti. Con stime globali di ape-specifici servizi di impollinazione è straordinariamente alta55,56, se quest'opera può attenuare il declino delle popolazioni di API, i potenziali impatti saranno sostanziali.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Autore (i) ringraziare l'Università del Wisconsin Biotechnology Center DNA sequenziamento impianto per la fornitura di amplificazione e sequenziamento servizi, Caitlin Carlson, Jennifer Knack, Jake Otto e Max Haase per assistenza tecnica con analisi molecolare. Quest'opera è stata sostenuta dai fondi di USDA-Agricultural Research Service appropriato (attuale ricerca Information System #3655-21220-001). Un ulteriore supporto è stato fornito dalla National Science Foundation (sotto Grant No. DEB-1442148), il DOE Great Lakes Bioenergy Research Center (ufficio DOE di scienza DE BER-FC02-07ER64494) e l'USDA National Institute of Food e agricoltura (progetto portello 1003258). C.T.H. è uno studioso di Pew in scienze biomediche e Alfred Toepfer facoltà Fellow, supportato da Pew Charitable Trusts e la Fondazione Alexander von Humboldt, rispettivamente.

Materials

Name Company Catalog Number Comments
Natupol Beehive Koppert USRESM1 16 hives
Propiconazole 14.3 Quali-Ppro 60207-90-1 Propiconazole 14.3%
Abound Syngenta 4033540 Azoxystrobin 22.9%
Chlorothalonil Syngenta 3452 Fungicide used for trials
Pollen granules Bee rescued B004D5650C 3X 16oz bottles, pollen for trials
Bacterial strains for inoculation Currie Lab
Yeast strains for inoculation Hittinger lab
Primer pairs UW Biotech Center
DNA Isolation Kit Mo Bio 12830-50 Commercial DNA isolation kit
Qubit dsDNA HS Assay Kit Thermo Fisher Q32851 DNA quantification tool
Select Master Mix for CFX Thermo Fisher 4472952 Used to perform real-time PCR using SYBR GreenER dye.
Real-Time PCR Detection System Bio Rad 1855196 Instrument used for PCR amplification
PCR Clean-Up Kit, Axygen 10159-696 Used for efficient removal of unincorporated dNTPs, salts and enzymes
DNA 1000 Kit Agilent 5067-1504 Used for sizing and analysis of DNA fragments
MiSeq Sequencer Illumina Used for next-generation sequencing
Assorted glassware (beaker, flasks, pipettes, test tubes, repietters) VWR

DOWNLOAD MATERIALS LIST

References

  1. Potts, S. G., Biesmeijer, J. C., Kremen, C., Neumann, P., Schweiger, O., Kunin, W. E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol Evolut. 25, (6), 345-353 (2010).
  2. Vanengelsdorp, D., Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J Invertebr Pathol. 103, Suppl 1. S80-S95 (2010).
  3. Ellis, J. D., Evans, J. D., Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, (1), 134-136 (2010).
  4. Vanbergen, A. J. Insect Pollinators Initiative. Threats to an ecosystem service: pressures on pollinators. Front Ecol Environ. 11, (5), 251-259 (2013).
  5. Cameron, S. A., et al. Patterns of widespread decline in North American bumble bees. Proc. Natl. Acad. Sci. U.S.A. 108, (2), 662-667 (2011).
  6. Szabo, N. D., Colla, S. R., Wagner, D. L., Gall, L. F., Kerr, J. T. Do pathogen spillover, pesticide use, or habitat loss explain recent North American bumblebee declines? Conser Lett. 5, (3), 232-239 (2012).
  7. Klein, A. -M., et al. Importance of pollinators in changing landscapes for world crops. Proc R Soc Lond [Biol]. 274, (1608), 303-313 (2007).
  8. Sánchez-Bayo, F., Goulson, D., Pennacchio, F., Nazzi, F., Goka, K., Desneux, N. Are bee diseases linked to pesticides? - A brief review. Environ Int. 89, 7-11 (2016).
  9. Kwong, W. K., Moran, N. A. Gut microbial communities of social bees. Nature Rev. Microbiol. 14, (6), 374-384 (2016).
  10. Engel, P., et al. The Bee Microbiome: Impact on Bee Health and Model for Evolution and Ecology of Host-Microbe Interactions. mBio. 7, (2), e02164-e02115 (2016).
  11. Henry, M., et al. A common pesticide decreases foraging success and survival in honey bees. Science. 336, (6079), New York, N.Y. 348-350 (2012).
  12. Pettis, J. S., vanEngelsdorp, D., Johnson, J., Dively, G. Pesticide exposure in honey bees results in increased levels of the gut pathogen Nosema. Die Naturwissenschaften. 99, (2), 153-158 (2012).
  13. Williamson, S. M., Wright, G. A. Exposure to multiple cholinergic pesticides impairs olfactory learning and memory in honeybees. J. Exp. Biol. 216, (10), 1799-1807 (2013).
  14. Artz, D. R., Pitts-Singer, T. L. Effects of fungicide and adjuvant sprays on nesting behavior in two managed solitary bees, Osmia lignaria and Megachile rotundata. PLoS ONE. 10, (8), (2015).
  15. Johnson, R. M., Wen, Z., Schuler, M. A., Berenbaum, M. R. Mediation of Pyrethroid Insecticide Toxicity to Honey Bees (Hymenoptera: Apidae) by Cytochrome P450 Monooxygenases. J. Econ. Entomol. 99, (994), 1046-1050 (2006).
  16. Pilling, E. D., Bromleychallenor, K. A. C., Walker, C. H., Jepson, P. C. Mechanism of synergism between the pyrethroid insecticide lambda-cyhalothrin and the imidazole fungicide prochloraz, in the honeybee (Apis mellifera L). Pest Biochem Physiol. 51, (1), 1-11 (1995).
  17. Iwasa, T., Motoyama, N., Ambrose, J. T., Roe, R. M. Mechanism for the Differential Toxicity of Neonicotinoid Insecticides in the Honey Bee Mechanism for the differential toxicity of neonicotinoid insecticides in the honey bee, Apis mellifera. Crop Protection. (2016).
  18. Mullin, C. A., et al. High levels of miticides and agrochemicals in North American apiaries: implications for honey bee health. PLoS One. 5, (3), e9754 (2010).
  19. Pettis, J. S., Lichtenberg, E. M., Andree, M., Stitzinger, J., Rose, R., Vanengelsdorp, D. Crop pollination exposes honey bees to pesticides which alters their susceptibility to the gut pathogen Nosema ceranae. PLoS One. 8, (7), e70182 (2013).
  20. David, A., et al. Widespread contamination of wildflower and bee-collected pollen with complex mixtures of neonicotinoids and fungicides commonly applied to crops. Environ Int. 88, 169-178 (2016).
  21. Zhu, W., Schmehl, D. R., Mullin, C. A., Frazier, J. L. Four common pesticides, their mixtures and a formulation solvent in the hive environment have high oral toxicity to honey bee larvae. PLoS One. 9, (1), e77547 (2014).
  22. Simon-Delso, N., Martin, G. S., Bruneau, E., Minsart, L. A., Mouret, C., Hautier, L. Honeybee colony disorder in crop areas: The role of pesticides and viruses. PLoS ONE. 9, (7), (2014).
  23. Park, M. G., Blitzer, E. J., Gibbs, J., Losey, J. E., Danforth, B. N. Negative effects of pesticides on wild bee communities can be buffered by landscape context. Proc R Soc Lond [Biol]. 282, (1809), (2015).
  24. van Engelsdorp, D., et al. "Entombed Pollen": A new condition in honey bee colonies associated with increased risk of colony mortality. J Invertebr Pathol. 101, (2), 147-149 (2009).
  25. Bernauer, O. M., Gaines-Day, H. R., Steffan, S. A. Colonies of bumble bees (Bombus impatiens) produce fewer workers, less bee biomass, and have smaller mother queens following fungicide exposure. Insects. 6, (2), 478-488 (2015).
  26. Tu, C. M. Effect of fungicides, captafol and chlorothalonil, on microbial and enzymatic activities in mineral soil. J Environ Sci Health B. 28, (B28), 67-80 (1993).
  27. Huang, C. -Y., Ho, C. -H., Lin, C. -J., Lo, C. -C. Exposure effect of fungicide kasugamycin on bacterial community in natural river sediment. J Environ Sci Health B. 45, (5), 485-491 (2010).
  28. Artigas, J., et al. Effects of the fungicide tebuconazole on microbial capacities for litter breakdown in streams. Aquat. Toxicol. 122, 197-205 (2012).
  29. Goerzen, D. W. Microflora associated with the alfalfa leafcutting bee, Megachile rotundata (Fab) (Hymenoptera: Megachilidae) in Saskatchewan, Canada. Apidologie. 22, (5), 553-561 (1991).
  30. Anderson, K. E., Sheehan, T. H., Eckholm, B. J., Mott, B. M., DeGrandi-Hoffman, G. An emerging paradigm of colony health: Microbial balance of the honey bee and hive (Apis mellifera). Insectes Sociaux. 58, (4), 431-444 (2011).
  31. Crotti, E., et al. Microbial symbionts of honeybees: a promising tool to improve honeybee health. N. Biotechnol. 30, (6), 716-722 (2013).
  32. Koch, H., Schmid-Hempel, P. Socially transmitted gut microbiota protect bumble bees against an intestinal parasite. Proc. Natl. Acad. Sci. U.S.A. 108, (48), 19288-19292 (2011).
  33. Anderson, K. E., et al. Microbial ecology of the hive and pollination landscape: bacterial associates from floral nectar, the alimentary tract and stored food of honey bees (Apis mellifera). PloS One. 8, (12), e83125 (2013).
  34. Evans, E. C., Spivak, M. Effects of Honey Bee (Hymenoptera: Apidae) and Bumble Bee (Hymenoptera: Apidae) Presence on Cranberry (Ericales: Ericaceae) Pollination. J Econ Entomol. 99, (3), 614-620 (2006).
  35. Goulson, D., et al. Can alloethism in workers of the bumblebee, Bombus terrestris, be explained in terms of foraging efficiency? Anim. Behav. 64, (1), 123-130 (2002).
  36. ThermoFisher Scientific. User Guide: Qubit dsDNA HS Assay Kits. Available from: https://tools.thermofisher.com/content/sfs/manuals/Qubit_dsDNA_HS_Assay_UG.pdf 3-6 (2010).
  37. Khadempour, L., LeMay, V., Jack, D., Bohlmann, J., Breuil, C. The Relative Abundance of Mountain Pine Beetle Fungal Associates Through the Beetle Life Cycle in Pine Trees. Microbial Ecol. 64, (4), 909-917 (2012).
  38. Dorn-In, S., Hölzel, C. S., Janke, T., Schwaiger, K., Balsliemke, J., Bauer, J. PCR-SSCP-based reconstruction of the original fungal flora of heat-processed meat products. Int J Food Microbiol. 162, (1), 71-81 (2013).
  39. Klindworth, A., et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 41, (1), (2013).
  40. White, T., Bruns, T., Lee, S., Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. 18, (1), 315-322 (1990).
  41. Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Available from: http://ngs.biodiv.tw/NGSCore/wp-content/uploads/Documents/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  42. Kõljalg, U., et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 22, (21), 5271-5277 (2013).
  43. Wang, Q., Garrity, G. M., Tiedje, J. M., Cole, J. R. Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl. Environ. Microbiol. 73, (16), 5261-5267 (2007).
  44. Team, R. C. R: A language and environment for statistical computing [Computer software]. R Foundation for Statistical Computing. Vienna, Austria. (2015).
  45. Kaltenpoth, M., Engl, T. Defensive microbial symbionts in Hymenoptera. Funct Ecol. 28, (2), 315-327 (2014).
  46. Gerth, M., Saeed, A., White, J. A., Bleidorn, C. Extensive screen for bacterial endosymbionts reveals taxon-specific distribution patterns among bees (Hymenoptera, Anthophila). FEMS Microbiol Ecol. 91, (6), (2015).
  47. Smith, C. J., Osborn, A. M. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology. FEMS Microbiol Ecol. 67, (1), 6-20 (2009).
  48. Kim, M., Morrison, M., Yu, Z. Evaluation of different partial 16S rRNA gene sequence regions for phylogenetic analysis of microbiomes. J Microbiol Methods. 84, (1), 81-87 (2011).
  49. DeSantis, T. Z., et al. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 72, (7), 5069-5072 (2006).
  50. Langille, M. G. I., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature Biotechnol. 31, (9), 814-821 (2013).
  51. Malik, S., Beer, M., Megharaj, M., Naidu, R. The use of molecular techniques to characterize the microbial communities in contaminated soil and water. Environ Int. 34, (2), 265-276 (2008).
  52. Ladurner, E., Bosch, J., Kemp, W. P., Maini, S. Assessing delayed and acute toxicity of five formulated fungicides to Osmia lignaria and Apis mellifera. Apidologie. 36, (3), 449-460 (2005).
  53. Huntzinger, C. I., James, R. R., Bosch, J., Kemp, W. P. Fungicide Tests on Adult Alfalfa Leafcutting Bees (Hymenoptera: Megachilidae). J Econ Entomol. 101, (4), 1088-1094 (2008).
  54. Gradish, A. E., Scott-Dupree, C. D., Shipp, L., Harris, C. R., Ferguson, G. Effect of reduced risk pesticides for use in greenhouse vegetable production on Bombus impatiens (Hymenoptera: Apidae). Pest Manag. Sci. 66, (2), 142-146 (2010).
  55. Calderone, N. W. Insect pollinated crops, insect pollinators and US agriculture: trend analysis of aggregate data for the period 1992-2009. PloS One. 7, (5), e37235 (2012).
  56. Ollerton, J., Winfree, R., Tarrant, S. How many flowering plants are pollinated by animals? Oikos. 120, (3), 321-326 (2011).
Empirica, metagenomica e tecniche computazionali illuminano i meccanismi attraverso i quali salute delle API di fungicidi compromesso
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).More

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter