Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Snelle en efficiënte generatie van recombinant humaan pluripotente stamcellen door Recombinase-gemedieerde Cassette Exchange in de doi: 10.3791/54718 Published: November 20, 2016
* These authors contributed equally

Summary

Hier melden wij een snelle en efficiënte gen-editing methode op basis van RMCE in de AAVS1 locus van menselijke pluripotente stamcellen (hPSCs), die verbetert eerder beschreven systemen. Met deze techniek kan isogene lijnen snel en betrouwbaar worden gegenereerd voor goede vergelijkende studies vergemakkelijkt-gemedieerde transgenese onderzoek met hPSCs.

Abstract

Zelfs met de revolutie van-gen-targeting technologie onder leiding van CRISPR-Cas9, genetische modificatie van menselijke pluripotente stamcellen (hPSCs) is nog steeds tijdrovend. Vergelijkende studies dat recombinant lijnen met transgenen geïntegreerd in veilige haven loci gebruik kan maken van benaderingen die gerichte plaatsspecifieke recombinasen, zoals Cre of FLPe gebruiken die sneller en minder gevoelig voor off-target effecten. Dergelijke werkwijzen zijn beschreven, hoewel ze niet significant beter presteren gen targeting in de meeste aspecten. Het gebruik van zink-finger nucleasen, wij eerder een master-cellijn in de AAVS1 locus van hPSCs dat een GFP-hygromycine-tk tot expressie cassette bevat, geflankeerd door heterotypische FRT sequenties. Hier hebben we de procedures te beschrijven FLPe-recombinase-gemedieerde cassette uitwisseling (RMCE) uit te voeren met behulp van deze lijn. De master cell lijn wordt getransfecteerd met een RMCE donor vector, die een promoter puromycineresistentie bevat, en met FLPe recombinase. Toepassing van zowel een positieve (Puromycine) en negatieve (FIAU) selectie programma leidt tot de selectie van RMCE zonder willekeurige integraties. RMCE genereert volledig gekarakteriseerde pluripotente polyklonale transgene lijnen 15 d met 100% rendement. Ondanks de recent beschreven beperkingen van de AAVS1 locus, het gemak van het systeem maakt de weg vrij voor HPSC transgenese in isogene instellingen is nodig voor vergelijkende studies, en maakt semi-high-throughput genetische screens voor winst / verlies van functie-analyse die anders zouden zijn zeer tijdrovend.

Introduction

Gerichte genoom recombinatie is snelle vooruitgang mogelijk gemaakt op vele terreinen van onderzoek. Bij muizen is de synergie tussen genoom bewerken en stamcelonderzoek toegestaan ​​voor een beter begrip van het complex mechanisme van gen-functie en genregulatie. Een dergelijke vooruitgang verwacht in menselijke pluripotente stamcellen (hPSCs) als goed, hoewel het voor vele jaren sinds de eerste isolatie van menselijke embryonale stamcellen (hESC 's), en later de mens geïnduceerde pluripotente stamcellen (hiPSCs), gen editing is een technische hindernis vormde . Recente ontwikkelingen in het genoom van techniek met behulp van doelgerichte nucleasen-Zinc Finger Nucleases (ZFNs), transcriptie activator-achtige effector nucleasen (TALEN) of geclusterde regelmatig interspaced korte palindroom herhalingen /-CRISPR geassocieerd eiwit 9 (CRISPR / Cas9) hebben ons om deze te overwinnen moeilijkheden, het maken van gerichte recombinatie een efficiënt proces 1-3.

Specifieke loci in de mouse genoom dat stabiele, betrouwbare en alomtegenwoordige transgenexpressie in de afwezigheid van bijwerkingen zoals Rosa26, Hprt1 of COL1A1 toestaan geworden essentiële hulpmiddelen bij het uitvoeren van genetische studies. Safe harbor loci mogelijk vergelijkbare analyse tussen de verschillende lijnen van muizen in isogene contexten. Dit kan niet worden bereikt met standaard willekeurige integratie werkwijzen die zijn geassocieerd met bekende beperkingen zoals mutagenese, dosisafhankelijke effecten of bonte transgenexpressie. Gene bewerken gemak en flexibiliteit veilige haven loci wordt verhoogd door het gebruik van plaatsspecifieke recombinasen zoals gerichte Cre of flippase (FLPe), dat specifiek herkennen doelsequenties (loxP of FRT respectievelijk) en efficiënt katalyseren recombinatie tussen identieke doelen. Als gevolg van deze kenmerken, recombinase gemedieerde gen bewerken met behulp van loxP of FRT sequenties in vooraf geïntegreerde veilige haven loci is een gemeenschappelijk instrument dat wordt gebruikt in de muis transGenesis. Naast cassette inbrengen of excisie bemiddelde tussen identieke doelsequenties, het gebruik van incompatibele loxP of FRT-plaatsen maakt recombinase-gemedieerde cassette uitwisseling (RMCE) 4.

Bij de mens probeert te identificeren veilige haven loci zijn uitgevoerd. De muis orthologe HPRT Ondanks de associatie met de verlies-van-functie Lesch-Nyhan syndroom en ROSA26 zijn gericht in hPSCs. HPRT gemeld snel zwijgen transgene expressie in ESC en, zoals ROSA26, het vermogen om transgenexpressie te ondersteunen in terminaal gedifferentieerde cellen werd niet onderzocht 5-7. Omdat een homozygote nul-mutatie van het CCR5-gen lijkt goed verdragen bij mensen, werd de waarde veilige zone bepaald. CCR5 werd gericht en aan stabiele transgene expressie houden in verschillende humane cellijnen, waaronder SER 8,9. Echter,de laatste werd niet aangetoond op klonale niveau tijdens langetermijnkweek en alomtegenwoordige transgenexpressie werd niet aangetoond in gedifferentieerde nageslacht van de drie kiembladen. AAVS1, de natuurlijke integratieplaats van het adeno-geassocieerde virustype 2 (AAV), werd getest in hESC 's goed ook, want van de gerapporteerde resistentie tegen transgene zwijgen 10. Later, veel groepen gebruikte AAVS1 locus en beschreven stabiele transgenexpressie in ongedifferentieerde hPSCs, alsmede in hun gedifferentieerde nageslacht van alle weefsels, zowel in vitro als in vivo 2,8,11,12. De recente resultaten niettemin nuanceren deze bevindingen, omdat de AAVS1 locus bleek variabele transgene remming in vitro uitoefenen ongedifferentieerde hESC 's en in hepatocyte nageslacht 13.

Extra screening studies met behulp van willekeurige integratie benaderingen en methoden om te bepalen enkel exemplaar integratie gericht op geno vindenmic integratieplaatsen bestand tegen transgene silencing tijdens hPSCs expansie en differentiatie 14,15. Over het algemeen, tot nu toe, geen genomische site is volledig gevalideerd als een veilige haven in hPSCs en hun nageslacht; identificatie van een geschikte plaats voor alomtegenwoordige stabiele transgene expressie, niet alleen in hPSCs maar ook in hun gedifferentieerde nakomelingen in vitro en in vivo, nog worden opgelost. Van alle onderzochte loci en ondanks zijn beperkingen, blijft AAVS1 de best gekarakteriseerd en meest gebruikte in stamcelonderzoek.

RMCE is met succes uitgevoerd in hPSCs uitgevoerd in een aantal van deze loci 6,7,14,16, met behulp van vooral Cre recombinase, zelfs als er aanwijzingen zijn dat FLPe is efficiënter dan Cre 17. In al deze gevallen werd een positief resistentie cassette voor de selectie van recombinante kolonies. Hoewel succesvol, zijn deze procedures geen technische vooruitgang ten opzichte van standaard gen- vormenediting procedures met behulp van ZFNs, Talens of CRISPR / Cas9, als één antibioticum selectieprocedure sluit niet uit willekeurige integraties en vereist kolonie screening om correct gerichte klonen te identificeren.

In deze procedure beschrijven we methoden RMCE voeren in hPSCs in de AAVS1 locus met een combinatie van positieve (binnen de inkomende cassette) en negatieve (binnen de vooraf geïntegreerde cassette) selecties die zorgen voor het genereren van polyklonale transgene lijnen in ± 15 dagen 100% rendement en vrij van willekeurige integratie evenementen. Daarom is deze methode vertegenwoordigt vooruitgang ten opzichte van momenteel beschreven RMCE technologieën in hPSCs.

Protocol

1. Voorbereiding van de FRT-bevattende HPSC Master Cell Line voor transfectie

  1. Cultuur hESC / iPSC meester cellijnen onder standaard procedures aan of uit geïnactiveerde muis embryonale fibroblasten (iMEF) met behulp van hESC of feeder-free iPSC medium, respectievelijk (tabel 1). Bereid 2 (op feeders) of 1 (feeder-vrij) putjes van hPSCs in een 6-wells plaat voor elke experimentele conditie.
  2. Let op de culturen en wanneer de cellen te bereiken 60-70% samenvloeiing, plaat resistente iMEF (iDR4). Kort, laag noodzakelijke putjes van een 12-wells plaat met 0,5 ml 0,1% gelatine-oplossing en incubeer gedurende 5 minuten bij kamertemperatuur. Plate 125.000 iDR4s per putje en incubeer O / N met iMEF medium (tabel 1).

2. HPSC Transfectie door Nucleofectie

  1. De volgende dag, pre-incubeer hESC / iPSC kweken met vers medium, zoals 10 uM Rho-geassocieerde proteïne kinase (ROCK) inhibitor (Y-27632), gedurende 1 uur bij 37 ° C. Next, neem hESC transfectie oplossing uit de koelkast voor een pre-warm tot kamertemperatuur.
  2. Bereid 1 ml nucleofection plating medium (tabel 1) per nucleofectie conditie. Neem iMEF medium uit de putjes, wassen met 1 ml PBS kamertemperatuur en voeg 500 ul van nucleofection plaatmedium. Breng de andere 500 pl steriele 1,5 ml buisjes en opgeslagen bij 37 ° C tot platen. OPMERKING: Een typische RMCE experiment omvat drie verschillende omstandigheden met moleculaire verhoudingen van RMCE donor: pFLPe vectoren 2: 0, 2: 1 en 0: 1.
  3. Maak hESC / iPSC in een enkele celsuspensie.
    1. Verwijder de media, was het met 2 ml RT PBS en voeg 1 ml trypsine 0,05% of Accutase op voeder of feeder-free HPSC culturen, respectievelijk. Incubeer gedurende 7 (trypsine) of en 2-5 (Accutase) min bij 37 ° C. Voor de behandeling Accutase - cellen moeten los, maar verbonden blijven.
    2. verwijder de plaat voorzichtig uit de incubator en zonderllowing de cellen los, verwijder de dissociatie middel door aspiratie. Voeg 1 ml van hESC media en distantiëren de losse cellen door voorzichtig spoelen van de media op het bord oppervlak, het vermijden van schuimvorming. Controleer de cellen in een enkele celsuspensie.
    3. Verzamel de cellen in een schone en steriele 15 of 50 ml buis. Was de putjes met 1 ml hESC media en het verzamelen van de cellen in dezelfde 15 of 50 ml buis. Neem een ​​50 pi aliquot voor het tellen (in de volgende stap) gebruik van een mobiele telinrichting. Noteer het volume van de collectie en bereken totale aantal cellen. Spin down de cellen bij 300 g gedurende 5 minuten bij kamertemperatuur.
  4. Resuspendeer de celpellet aan een suspensie van 10 6 cellen / ml met PBS met behulp van een 5 ml serologische pipet en voorzichtig pipetteren. Vermijd schuimvorming. Transfer 2 ml per experimentele conditie (ongeveer 2 x 10 6 cellen) te reinigen, steriele 15 ml buizen.
  5. Tijdens het centrifugeren, prepare de RMCE donor pFLPe plasmiden mengt in een maximaal volume van 10 pi.
    1. Transfer 2,5 ug pFLPe (6,5 Kb) van een schone, steriele 1,5 ml buis. Voeg een 2: 1 molverhouding van de RMCE donorvector 13 de pFLPe vector. Bijvoorbeeld ongeveer 10 ug per 12 kb RMCE donorvector.
  6. Ga verder met nucleofectie, het vermijden van schuimvorming in alle stappen.
    OPMERKING: Sommige HPSC transfectie protocollen voor een extra iMEF uitputting stap voor stap 2.4. Echter, in de praktijk, iMEF een geringe celfractie in enkele ophanging die niet significant transfectie-efficiëntie wijzigt, noch zal het creëren contaminerende recombinante cellen omdat ze niet-proliferatief. Bovendien, is het essentieel om binnen korte tijd tijdens de transfectieproces levensvatbaarheid verhogen. Om deze redenen is iMEF uitputting niet toegepast.
    1. Verwijder de iDR4 bord en de 1,5 ml buizen met de plating mediumuit de incubator. Één buis per keer, pipet uit de PBS voorzichtig zonder de celpellet. Verwijder zoveel mogelijk. Resuspendeer de pellet met 100 ul transfectie oplossing door voorzichtig pipetteren. Breng de celsuspensie naar de ml buis 1.5 die het plasmide mixen en meng voorzichtig.
    2. Breng de cel-DNA mix aan de transfector cuvette, met aandacht niet te bellen te introduceren. Introduceer de cuvette in het Nucleofector apparaat en de toepassing programma A13 (cellen gekweekt op feeders) of F16 (feeder-vrij).
      LET OP: Andere transfectie methoden of Nucleofector apparaten kunnen optimaliseren van deze programma's of transfectie omstandigheden vereisen.
    3. Heroveren het cuvette en via de wegwerpbare transferpipetten in de nucleofection kit, verzamelt de inhoud door toepassing van 0,5 ml van de beplating medium en aspireren alle volume. Voeren deze stap snel, maar voorzichtig en in één beweging.
    4. Plate druppelsgewijs in de 12-well plaat met de iDR4 en 500 pi van plating medium. Herhaal stap 2.6.1 - 2.6.4 voor de volgende experimentele conditie.
  7. Plaats de cultuur schotel op een plank in de incubator en beweeg deze langzaam heen en weer en heen en weer om gelijkmatig te verdelen de celsuspensie. Incubeer het voor 24 uur vóór de volgende media verandering om de cellen te herstellen in de aanwezigheid van 10 pM ROCK inhibitor (Y-27632).

3. Positieve en negatieve selectie van Cellen ondergaan RMCE

  1. Verandering kweekmedia dag (1 ml / putje) en 2 - 3 d na transfectie starten selectie met 100 ng / ml puromycine.
    OPMERKING: Optimale concentratie van positieve en negatieve selectie reagentia moet experimenteel worden bepaald voor elke nieuw gegenereerde HPSC meester cellijn. Voer een kill curve 13, met behulp van de master-cellijn van de lage dosis (concentratie waarbij een minimale visuele toxiciteit blijkt na 7 bepalend van de selectie, maar de cultuur is niet begroeid), optimale dosis (de laagste concentratie waarbij alle cellen dood zijn na 7 dagen van de selectie) en een hoge dosis (concentratie die evidente toxiciteit veroorzaakt, het doden van alle cellen na 2-3 d) voor zowel puromycine en Fialuridine (FIAU).
    1. Zuig het hESC medium. Wassen met 1 ml PBS. Voeg hESC medium met 100 ng / ml puromycine.
  2. Let op celgroei, zodat de dood en groei in balans zijn. Verander media met puromycine dagelijks, volgende stap 3.1.1. Wanneer groeisnelheid passeert celdood verhogen puromycine concentratie in blokken van 25 - 50 ng / mL tot een maximum van 250 ng / ml. Doorgaan puromycine selectie voor 5-7 d.
  3. 3-4 d na het starten puromycineselectie, rond dag 6 na transfectie starten selectie met 0,5 uM FIAU. Wijzig de media dagelijks en onderhouden FIAU voor niet meer dan 7 aaneengesloten dagen.

4. Uitbreiding en karakterisering van RMCE Lines

Na voltooiing van de selectie, rond D14 - 15, resistente RMCE kolonies aanwezig zijn en vormen de nieuwe RMCE lijn. Gesplitst in bulk in een 1: 2 verhouding volgens standaardprocedures (passage 1, P1).
  • Plaat 2 putjes van een 12-well plaat (aan of uit feeders, afhankelijk van de normale kweekomstandigheden van de originele master-cellijn). Gebruik een goed voor verdere uitbreiding, opslag, of experimentele set-up (geen extra beschrijving van deze procedures is gedaan in dit protocol), en de andere voor de karakterisering.
  • Wanneer cellen van P1 klaar te splitsen, dissociëren de put voor de karakterisering in een enkele celsuspensie zoals beschreven in 2,4 en het verzamelen van de cellen in een 15 ml buis. LET OP: Gebruik cellen uit de HPSC WT (zonder genetische modificatie) en master-cellijn als negatieve en positieve controles, respectievelijk voor de karakterisering.
  • Spin neer op 300 xg gedurende 5 minuten bij kamertemperatuur. Resuspendeer in 1 ml PBS en verdelen van het monster in twee voor flowcytometrieen DNA-analyse 13.
  • Flowcytometrieanalyse 13 (300 pi):
    1. Voeg foetaal kalfsserum om de cellen in PBS tot een eindconcentratie van 5%. Overdracht van de cellen om een ​​schone FACS buis met een cel zeef en bewaar ze op ijs.
      OPMERKING: Cellevensvatbaarheid is hoog in deze omstandigheden, zodat het mogelijk, maar niet noodzakelijk, om een fluorescerende kleuring van niet-levensvatbare cellen (bijvoorbeeld, 7-AAD of PI) gebruikt.
    2. Ga onmiddellijk analyse in een flowcytometer cel analyser en opnemen 20.000 - 30.000 events. Voor de analyse, stellen de poorten boven GFP of TDT achtergrond bloei met behulp van de WT negatieve controle monster.
  • DNA-analyse 13 (700 pi):
    1. Overdracht van de cellen naar een schone 1,5 ml buis. Spin neer op 300 xg gedurende 5 minuten bij kamertemperatuur en zuig de supernatant. Ga verder met DNA-extractie met behulp van een commerciële kit en volg de instructies van de fabrikant. Bewaar de droge pellet bij -20 ° C voor later analyse.
  • Meet DNA-concentratie.
    1. Bereid standaard PCR reacties volgens de voorwaarden in figuur 3 en tabel 2 13 Run PCR monsters op een 2% agarosegel met 1 x DNA gel stain bij 150 V gedurende 15 -. 25 min. Analyseer de vlucht in een gel-analysator.
  • Representative Results

    Met behulp van AAVS1 -specifieke ZNFs, volledig gekarakteriseerde hESC / iPSC meester cellijnen die heterotypic FRT doelsequenties werden gegenereerd en beschreven 13. De FRT-bevattende meester cellijnen gehandhaafd pluripotentie en integriteit van het genoom na de behandeling ZFN en stabiel GFP tot expressie in vitro en in vivo. RMCE wordt uitgevoerd door cotransfectie van de master cellijnen met FLPe recombinase en RMCE donor vectoren (Figuur 1A). RMCE vectoren bevatten identieke FRT-sequenties die in de AAVS1 meester cellijn aan weerszijden van de transgene figuur 1B bewaakt RMCE met behulp van de constitutief TDT pZ:.. F3-P CAGGS tdTPH-F Na transfectie, HPSC vormen kleine groepen cellen gelijkmatig verdeeld over de iDR4 MEF laag, en getransfecteerd HPSC uiten zowel GFP als voorbijgaande TDT (Figuur 1B, D2). Cellen mogen herstellen gedurende 2-3d na transfectie voordat selectie. Positieve selectie wordt eerst gestart met een lage dosis van puromycine om RMCE donor inbrengen bevorderen. Puromycine voorzichtig aangebracht bij het begin, omdat aanvankelijk massale celdood kan leiden tot enkele cellen ondergaan recombinatie, waardoor ze het proces niet overleven. In de volgende dagen, puromycine concentratie moet omhoog stapsgewijs tot de optimale dosis, zodat de recombinante cellen te groeien tot kleine kolonies, terwijl de nonrecombined cellen sterven geleidelijk.

    3-4 d na het begin van positieve selectie (ongeveer D 6 post-transfectie), is negatieve selectie begonnen om alleen voor FRT-gemedieerde recombinatie gebeurtenissen te selecteren. RMCE veroorzaakt het verlies van de thymidine kinase (tk) zelfmoord gen en aldus de gevoeligheid voor Fialuridine (FIAU). Negatieve selectie toegepast op dit punt, waarbij kleine clusters van 2-4 GFP - / + TDT (RMCE) cellenkunnen optimale concentraties FIAU (Figuur 1B, D 6) weerstaan, voorkomt random integratie, omdat dergelijke gebeurtenissen, de Tk gen in de locus AAVS1 onaangetast blijft. Het optreden van gelijktijdige FRT-gemedieerde en random integratie is zeer onwaarschijnlijk, zoals blijkt uit de afwezigheid van willekeurige integratiegebeurtenissen later tijdens de karakterisering (figuur 2B).

    De gemengde RMCE GFP - / + TDT kolonies blijven groeien, terwijl steeds homogeen, zodat in D 9-10 na transfectie sommige niet volledig geselecteerd gemengde RMCE kolonies vindt (figuur 1B). GFP - / + TDT RMCE kolonies aanwezig wanneer beide RMCE donor en FLPe (2: 1) gebruikt, terwijl RMCE niet voorkomt in afwezigheid van FLPe (2: 0). Volledige selectie met FIAU tot dag 13-15 na transfectie geeft aanleiding tot een homogene GFP - / + TDT cule. RMCE levert een gemiddelde van 12,8 ± 6,8 (n = 6) Puro R / R FIAU kolonies 15 dagen 13. Flowcytometrie karakterisering van de nieuw gegenereerde RMCE lijn (de Puro R / R FIAU RMCE kolonies gecombineerd in een nonclonal celpopulatie) bevestigd dat 100% van de cellen presenteren RMCE GFP - / TDT + fenotype (Figuur 2A). Wanneer RMCE donoren zonder constitutieve expressie van een fluorescente reporter worden gebruikt, de verkregen Puro R / R FIAU RMCE HPSC lijn homogeen GFP -.

    PCR karakterisering van de nonclonal RMCE lijn toont de volledige cassette uitwisseling (geen sporen van de cassette van de master-cellijn kan worden gedetecteerd) en dat de selectie gebruikte programma genereert willekeurige integratie-vrije lijnen (zowel van de RMCE donor en de FLPe expressie vector) (figuur 2B). Deze resultaten werden verder aangetoond door southern blot en bovendien we aangetoond dat de RMCE lijnen blijven pluripotent 13. Hierdoor is het niet langer noodzakelijk om uitvoeren, en wel het genoom-brede evaluatie van random integratie of pluripotentie tijdens het RMCE routine experimenten. Kortom, met dit protocol, HPSC transgene cellijnen in de AAVS1 locus vrij van willekeurige integratie kan gemakkelijk worden geproduceerd in 15 d met 100% rendement en zonder de noodzaak van uitgebreide karakterisatie.

    Figuur 1
    Figuur 1: Schematisch overzicht van RMCE (A) Chronologie van de RMCE selectie programma.. Links: de master cellijn (MCL), herbergt een FRT geflankeerd cassette (driehoeken) die GFP en hygromycine-tk uiten (verbonden door 2A self-klieven peptiden), wordt getransfecteerd door nucleofection (NF) met de FLPe expressie vector en de RMCE donor vector, which bevat een promoter puromycineresistentiegen (splicing acceptor - SA- Puro R) en een variabel experimentele cassette (X). Rechts: nieuwe RMCE lijn (RMCEL) verkregen na voltooiing van de selectie met Puromycine (rode driehoek) en FIAU (blauwe lijn). (B) RMCE met een constitutieve tdt expressie donor en verschillende verhoudingen van donor-DNA en FLPe DNA (0: 1, 2: 1, 2: 0) gecontroleerd door fluorescentie microscopie (GFP - groene fluorescentie, TdT - rode fluorescentie) op verschillende tijdstippen. D 2 en 6: schaal bars vertegenwoordigt 100 urn. D 10: schaalbalken vertegenwoordigen 200 urn. Klik hier om een grotere versie van deze figuur te bekijken.

    Figuur 2
    Figuur 2:. Karakterisering van RMCE lijnen (A) Bepaling van door RMCEflowcytometrie. GFP en TDT expressie wordt getoond voor de WT lijn, meester cellijn (MCL) en nieuw gegenereerde RMCE lijn bij D 15 post-nucleofection met behulp van een constitutieve TDT-expressievector (CAGGS TDT), of donoren met GFP aangedreven door een Goosecoid promotor (GSCP GFP, definitieve endoderm marker) of een AAT promotor (APOeAATp GFP, hepatocyt marker). (B) Bevestiging van RMCE (5 '/ 3' JA RMCEL), de afwezigheid van de master cellijn's (MCL) cassette (5 '/ 3' JA MCL) en het ontbreken van willekeurige integratie (5 '/ 3' / FLPe RI ) door PCR met de primerparen afgebeeld. DNA van WT, MCL, RMCE lijnen (1-5), donor RMCE vector (+ RI), FLPe expressie vector en geen template controle (NTC) gebruikt. Figuur gewijzigd ten opzichte van (Ordovas et al., 2015) 13. Klik hier om een grotere versie van deze figuur te bekijken.

    binnen-page = "1"> figuur 3
    Figuur 3. Productie van de RMCE-Master geschikte cellijn en vergelijking van Gene targeting met RMCE in AAVS1 Links:. Gene targeting ongemodificeerde WT cellen die zijn gecotransfecteerd met een donor (cassette in figuur 1A beschreven voor het genereren van de master cellijn , MCL) en specifieke geoptimaliseerd ZFNs. Het is voltooid de volledige karakterisering duurt maximaal 3 maanden. Rechts: RMCE wordt uitgevoerd door cotransfectie van de donor met FLPe vectoren, en een volledig gekenmerkt lijn wordt opgewekt in 15 d. Gene targeting-efficiëntie in AAVS1 is uit eerdere studies 1,2. Klik hier om een grotere versie van deze figuur te bekijken.

    egen "> Media Components eindconcentratie hESC medium DMEM-F12, HEPES 80% Serum vervanging medium 20% L-Glutamine 146 mg / ml MEM niet-essentiële aminozuren Solution (100x) 1x 2-Mercaptoethanol 0,1 mM Penicilline / streptomycine 0,1% Human basic FGF 4 ng / mL iMEF kweekmedium DMEM High Glucose Foetaal runderserum (FBS) 15% Penicilline-streptomycine 0,1% L-glutamine 200 mM 4 mM MEM niet-essentiële aminozurenAcids Solution (100x) 2x 2-Mercaptoethanol 0,1 mM plating medium hESC medium 100% ROCK inhibitor (Y-27632) 10 uM

    Tabel 1. Media samenstelling.

    analyse vooruit Omgekeerde amplicon PCR Cycle
    5'JA MCL CACTTTGAGCTCTACTGGCTTC CGTTACTATGGGAACATACGTCA 1,1 Kb 95 ºC, 5 '- [95 ºC, 30' '- 68 ° C (-0,5 ° C / cyclus), 1' 30 ''] X15 - [95 ºC, 30 '' - 58 ºC, 30 '' - 72 ° C, 1 '30' '] X25 - 72 ºC, 5'
    3'JA MCL TAACTGAAACACGGAAGGAG AAGGCAGCCTGGTAGACA 1,4 Kb 95 ºC, 5 '- [95 ºC, 30' '- 68 ° C (-0,5 ° C / cyclus), 1' 30 ''] X15 - [95 ºC, 30 '' - 58 ºC, 30 '' - 72 ºC, 1 '30' '] X25 - 72 ºC, 5'
    5'JA RMCEL CACTTTGAGCTCTACTGGCTTC CATGTTAGAAGACTTCCTCTGC 1,1 Kb 95 ºC, 5 '- [95 ºC, 30' '- 68 ° C (-0,5 ° C / cyclus), 1' 30 ''] X15 - [95 ºC, 30 '' - 58 ºC, 30 '' -72 ºC, 1 '30' '] X25 - 72 ºC, 5'
    3'JA RMCEL TTCACTGCATTCTAGTTGTGG AAGGCAGCCTGGTAGACA 1,5 Kb 95 ºC, 5 '- [95 ºC, 30' '- 68 ° C (-0,5 ° C / cyclus), 1' 30 ''] X15 - [95 ºC, 30 '' - 58 ºC, 30 '' - 72 ºC, 1 '30' '] X25 - 72 ºC, 5'
    5'RI DONOR GTACTTTGGGGTTGTCCAG TTGTAAAACGACGGCCAG 0,5 Kb 95 ºC, 5 '- [95 ºC, 30' '- 60 ºC, 30' '- 72 ºC, 30' '] X25 - 72 ºC, 5'
    3'RI DONOR CCTGAGTTCTAACTTTGGCTC ACACAGGAAACAGCTATGAC 0,5 Kb
    RI FLPe CCTAGCTACTTTCATCAATTGTG GTATGCTTCCTTCAGCACTAC 0.65 Kb 95 ºC, 5 '- [95 ºC, 30' '- 60 ºC, 30' '- 72 ºC, 30' '] X25 - 72 ºC, 5'

    Tabel 2. Primer sets gebruikt voor PCR genotypering. Gemodificeerde van Ordovas et al., 2015 13.

    Discussion

    Gene bewerken methoden in veilige haven loci blijft een essentieel instrument om transgenese ontwikkelen hPSCs. Hoewel de veilige haven karakter van AAVS1 is onlangs ondervraagd voor sommige toepassingen 13,18, blijft dit locus momenteel de beste gekenmerkt mens afgeleide cellijnen. Bewustwording van de beperkingen in hPSCs kan helpen om betrouwbare gegevens te verkrijgen. Daarom wordt AAVS1 nog steeds verwacht dat een bruikbare site, bijvoorbeeld, voor gain en verlies-van-functie studies of induceerbare / constitutieve expressie van factoren die een isogene context en tussen bepaalde genetische achtergrond vereist.

    De AAVS1 locus is doelwit van vele groepen met behulp van ZFNs, TALEN of CRISPR / Cas9 1,2,19. Deze nucleasen aanzienlijke verhoging van de efficiëntie van homologe recombinatie in een bepaalde locus. De werkwijze voor het screenen en gekarakteriseerd doelgericht klonen, zonder willekeurige integrantsoen en pluripotentie behouden en genoomintegriteit kan tot 3 maanden (met behulp van geoptimaliseerde gen-editing tools) (figuur 3). De laatste twee kunnen worden veroorzaakt door mogelijke mutaties gegenereerd door off-target nuclease activiteit. Het RMCE systeem hier gebruikt, biedt echter een snelle, efficiënte en elegante methode om dit doel te bereiken twee weken, eenmaal recombinase-specifieke doelsequenties in de vooraf geïntegreerde AAVS1 locus. Het gebruik van positieve / negatieve selectie en een passende selectie programma zijn de belangrijkste factoren die bijdragen aan de vereenvoudiging van gen-editing in de AAVS1 locus door RMCE.

    Genotypische karakterisatie van nieuwe transgene lijnen wordt aanzienlijk verminderd (geen klonale screening nodig) en karakterisering verbonden met off-target nuclease activiteit overbodig gemaakt door de specificiteit van FLPe voor FRTS. De kwalificatie kan ook in routine RMCE experimenten worden verminderd door het aantonen van devolledig verlies van GFP-expressie van de meester-cellijn (Figuur 2A), want vol cassette uitwisseling en het ontbreken van willekeurige integratie zijn reeds voldoende aangetoond door PCR (Figuur 2B) en Southern blot 13. Het gebruik van positieve / negatieve selectie vormt ook het belangrijkste verschil met de eerdere verslagen. Verscheidene groepen die eerder RMCE beschreven hPSCs, hetzij in de AAVS1 of andere loci, gebruikt slechts één positieve selectiestap 7,14,16. Dit betekent niet een grote technische voordeel ten opzichte van gen-editing uitgevoerd met nucleasen vormen, omdat kolonie screening moet eveneens worden uitgevoerd om de juiste integratie en de afwezigheid van willekeurige integratie aan te tonen op het klonale niveau.

    Het gebruik van deze RMCE systeem in meerdere hESC / iPSC lijnen vereist preintegration van de beschreven FRT-bevattende cassette in de AAVS1 locus van iedere onafhankelijke lijn. Echter, eenmaal uitgevoerd,de snelheid en eenvoud biedt de mogelijkheid om semi-high throughput genetische screens in bepaalde isogene instellingen daarboven anders vermeld applicaties zou technisch zeer tijdrovend zijn. Bovendien worden alle RMCE vectoren geconstrueerd in de pZ AAVS1-gen richtende vector die voor de locus met ZFNs doel, maar Talens of CRISPR / Cas9 gerapporteerd. De RMCE vector van dualiteit is zeer nuttig om meerdere regels voor een bepaald transgen in hPSCs met of zonder FRT genereren. Bijvoorbeeld, een hit succesvol in een bepaalde genetische screen door RMCE uitgevoerd aangetoond zou idealiter moeten worden getest in meerdere HPSC lijnen naar de resultaten te bevestigen. Aangezien meervoudige RMCE-meester geschikte cellijnen kunnen direct gene targeting van de treffer gebruik nucleasen worden uitgevoerd. Het nut van het duale karakter van de RMCE vectoren is bewezen door onze fractie 20. In deze studie werd correctie gen in de patiënt-afgeleide uitgevoerdFrontotemporale dementie (FTD) iPSCs dat een mutatie waardoor progranuline (PGRN) expressie tekort dragen. Gen complementatie door ZFNs-gemedieerde insertie in de AAVS1 locus van een cassette die PGRN niveau hersteld, corrigeerde de defecte fenotype in corticogenesis geassocieerd met de aanwezigheid van de mutatie. Daarnaast werd een vergelijkbare lijn die door RMCE in WT hESCs worden gebruikt als controle voor exogene PGRN expressie.

    Aangezien recombinante kolonies, controleer transfectie efficiëntie van de RMCE donorvector. Transfectie efficiënties hoger dan 30% geven de bovenstaande resultaten. Lagere transfectie efficiënties afnemen recombinatie efficiency. Tenslotte heeft de RMCE systeem gegenereerd in de AAVS1 locus, maar is toepasbaar op elk ander locus.

    Materials

    Name Company Catalog Number Comments
    DR4 Mouse Embryonic Fibroblasts (MEF) AMS bio GSC-6204G hPSC culture on feeders
    CF-1 MEF, mitomycin-C treated AMS Bio GSC-6001M
    EmbryoMax 0.1% Gelatin Solution Millipore ES-006-B iMEF plating
    DMEM/F-12, HEPES Gibco 31330-038
    KnockOut Serum Replacement

    Gibco 10828-028
    L-Glutamine Sigma Aldrich G8540 For hESC medium
    L-Glutamine, 200 mM Gibco 25030-081 For iMEF medium
    2-Mercaptoethanol, 50 mM Gibco 31350-010
    MEM Non-Essential Amino Acids Solution (100x) Gibco 11140-035
    Penicillin-Streptomycin (10,000 U/mL) Gibco 15140122
    Human basic FGF Peprotech 100-18C
    Y-27632 in Solution VWR 688001-500
    DMEM High Glucose Gibco 41965-039 
    Fetal Bovine Serum (FBS) Sigma Aldrich F7524
    Trypsin-EDTA (0.05%), phenol red Gibco 25300-054 hPSC culture on feeders
    Matrigel, hESC qualified VWR 734-1440
    mTeSR1 complete medium kit Stem cell technologies 05850 For Feeder-free culture
    StemPro Accutase Cell Dissociation Reagent Gibco A1110501 For feeder-free culture
    Y-27632 in solution VWR 56726
    Human Stem Cell Nucleofector Kit 2 Lonza VVPH-5022
    Puromycine Dihydrochloride Gibco A11138-03
    FIAU (Fialuridine) ABX 2910
    Hygromycin B Sigma Aldrich H3274
    pFLPe Modified to from pCAGGS-FLPe (MES4488, Open Biosystems) to remove puromycin
    RMCE donors - - Modified from pZ donor AAVS1 puromycin vector (PZD0020-1KT, Sigma Aldrich)13
    5 mL Round Bottom Polystyrene Test Tube, with Cell Strainer Falcon 352235
    PureLink Genomic DNA kit Invitrogen K182001
    GoTaq Flexi DNA Polymerase Promega M8298
    Agarose Sigma A9539
    SYBR Safe DNA Gel Stain Invitrogen S33102
    Nucleofector 2b Device Lonza (Amaxa) AAB-1001
    NucleoCounter NC-100 Chemometec NC-100
    BD FACS Canto BD Biosciences 337175
    NucleoCassette Chemometec 941-0002

    DOWNLOAD MATERIALS LIST

    References

    1. Hockemeyer, D., et al. Genetic engineering of human pluripotent cells using TALE nucleases. Nat. Biotechnol. 29, (8), 731-734 (2011).
    2. Hockemeyer, D., et al. Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat. Biotechnol. 27, (9), 851-857 (2009).
    3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    4. Baer, A., Bode, J. Coping with kinetic and thermodynamic barriers: RMCE, an efficient strategy for the targeted integration of transgenes. Curr. Opin. Biotechnol. 12, (5), 473-480 (2001).
    5. Sakurai, K., et al. Efficient integration of transgenes into a defined locus in human embryonic stem cells. Nucleic Acids Res. 38, (7), e96 (2010).
    6. Irion, S., et al. Identification and targeting of the ROSA26 locus in human embryonic stem cells. Nat. Biotechnol. 25, (12), 1477-1482 (2007).
    7. Di Domenico, A. I., Christodoulou, I., Pells, S. C., McWhir, J., Thomson, A. J. Sequential genetic modification of the hprt locus in human ESCs combining gene targeting and recombinase-mediated cassette exchange. Cloning Stem Cells. 10, (2), 217-230 (2008).
    8. Lombardo, A., et al. Site-specific integration and tailoring of cassette design for sustainable gene transfer. Nat. Methods. 8, (10), 861-869 (2011).
    9. Lombardo, A., et al. Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nat. Biotechnol. 25, (11), 1298-1306 (2007).
    10. Simth, J. R., et al. Robust , Persistent Transgene Expression in Human Embryonic Stem Cells Is Achieved with AAVS1-Targeted Integration. Stem Cells. 26, 496-504 (2008).
    11. DeKelver, R. C., et al. Functional genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger nuclease-driven transgenesis into a safe harbor locus in the human genome. Genome Res. 20, (8), 1133-1142 (2010).
    12. Qian, K., et al. A simple and efficient system for regulating gene expression in human pluripotent stem cells and derivatives. Stem Cells. 32, (5), 1230-1238 (2014).
    13. Ordovás, L., et al. Efficient Recombinase-Mediated Cassette Exchange in hPSCs to Study the Hepatocyte Lineage Reveals AAVS1 Locus-Mediated Transgene Inhibition. Stem Cell Reports. 5, (5), 918-931 (2015).
    14. Du, Z. -W., Hu, B. -Y., Ayala, M., Sauer, B., Zhang, S. -C. Cre recombination-mediated cassette exchange for building versatile transgenic human Embryonic Stem Cells lines. Stem Cells. 27, 1032-1041 (2009).
    15. Papapetrou, E. P., et al. Genomic safe harbors permit high β-globin transgene expression in thalassemia induced pluripotent stem cells. Nat. Biotechnol. 29, (1), 73-78 (2011).
    16. Ramachandra, C. J., et al. Efficient recombinase-mediated cassette exchange at the AAVS1 locus in human embryonic stem cells using baculoviral vectors. Nucleic Acids Res. 39, (16), e107 (2011).
    17. Takata, Y., Kondo, S., Goda, N., Kanegae, Y., Saito, I. Comparison of efficiency between FLPe and Cre for recombinase-mediated cassette exchange in vitro and in adenovirus vector production. Genes to Cells. 16, (7), 765-777 (2011).
    18. Mizutani, T., Li, R., Haga, H., Kawabata, K. Transgene integration into the human AAVS1 locus enhances myosin II-dependent contractile force by reducing expression of myosin binding subunit 85. Biochem. Biophys. Res. Commun. 465, (2), 270-274 (2015).
    19. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    20. Raitano, S., et al. Restoration of progranulin expression rescues cortical neuron generation in an induced pluripotent stem cell model of frontotemporal dementia. Stem Cell Reports. 4, (1), 16-24 (2015).
    Snelle en efficiënte generatie van recombinant humaan pluripotente stamcellen door Recombinase-gemedieerde Cassette Exchange in de<em&gt; AAVS1</em&gt; Locus
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ordovás, L., Boon, R., Pistoni, M., Chen, Y., Sambathkumar, R., Helsen, N., Vanhove, J., Berckmans, P., Cai, Q., Vanuytsel, K., Raitano, S., Verfaillie, C. M. Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus. J. Vis. Exp. (117), e54718, doi:10.3791/54718 (2016).More

    Ordovás, L., Boon, R., Pistoni, M., Chen, Y., Sambathkumar, R., Helsen, N., Vanhove, J., Berckmans, P., Cai, Q., Vanuytsel, K., Raitano, S., Verfaillie, C. M. Rapid and Efficient Generation of Recombinant Human Pluripotent Stem Cells by Recombinase-mediated Cassette Exchange in the AAVS1 Locus. J. Vis. Exp. (117), e54718, doi:10.3791/54718 (2016).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter