Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Гибрид-Cut: улучшенный Секционирование Метод непокорных растительных образцов тканей

Published: November 23, 2016 doi: 10.3791/54754
* These authors contributed equally

Abstract

Поддержание целостности раздела растений имеет важное значение для изучения детальных анатомических структур на клеточном, тканевом, или даже органной уровне. Тем не менее, некоторые растительные клетки имеют жесткие клеточные стенки, жесткие волокна и кристаллы (оксалат кальция, диоксид кремния и т.д.), и высокое содержание воды , что часто нарушают целостность ткани в процессе секционирования растительной ткани.

Это исследование устанавливает простой Гибрид-Cut ткани метод секционирования. Этот протокол изменяет основе парафина метод секционирования и улучшает целостность срезов тканей из различных растений. Растительные ткани заключали в парафин, прежде чем секционирования в криостате при -16 ° С. Секционирование при низкой температуре закаленные парафиновые блоки, уменьшается разрыв и ломают, а также улучшение целостности ткани значительно. Этот протокол был успешно применен для кальция оксалата богатых тканей фаленопсис орхидеи, а также непокорных тканей , таких как репродуктивное органинс и листья риса, кукурузы и пшеницы. Кроме того, высокое качество срезов ткани гибридно-Cut может быть использован в сочетании с гибридизация (МОГ) , чтобы обеспечить пространственное характер экспрессии генов , представляющих интерес. В заключение, этот протокол особенно полезен для непокорной ткани растений с высоким содержанием кристалл или содержание кремнезема. Хорошие срезы ткани качества позволяют морфологические и другие биологические исследования.

Introduction

Основе парафина метод секционирования является широко используемым методом для анатомических исследований. Сохранение анатомии неповрежденной ткани имеет важное значение для морфологических и биологических исследований. Парафин метод секционирования является предпочтительным, так как парафин-вложение сохраняет клеток и тканей морфологии. Кроме того, парафиновые блоки могут быть сохранены удобно в течение длительных периодов времени. Тем не менее, парафин секционирования не подходит для тканей растений, содержащих внутриклеточные кристаллы. Кристаллы в клетках часто слезу парафиновые ленты и целостности повреждения тканей во время секционирования.

В отличие от парафина секционирования, cryosectioning сравнительно быстро и секций можно получить без фиксации, серийный дегидратации или вложение среды инфильтрацию 1. Криосрезах совместимы со многими приложениями , такими как иммуногистохимии, на месте гибридизации и фермента гистохимии. Другим преимуществом является cryosectioningчто этот метод не проходит через потенциальный процессы денатурации , таких как высокая температура и химической обработки, так что клеточные молекулы хорошо сохранились в срезах ткани 2. Cryosectioning, как правило, предпочтительнее на основе парафина секционирования для исследований в тканях животных. Однако cryosectioning не первый выбор в растениях, так как температура замерзания иногда вызывает образование кристаллов льда, которые влияют на качество целостности раздела. Хотя осморегуляция такие как растворы сахарозы, полиэтиленгликоль (PEG) или глицерин 3 Сообщалось , чтобы уменьшить образование кристаллов льда в условиях замораживания, улучшение меньше оптимального.

Для того, чтобы адаптироваться к различным средам, разные растения часто имеют различные текстуры ткани и клетки растений развились , чтобы сформировать жесткие клеточные стенки, жесткие волокна и кристаллы 4,5. Например, нерастворимые кристаллы оксалата кальция и кремния тела являются довольно распространенными врастения 6. Силикатные тела / кристаллов сообщили , чтобы помочь сохранить архитектуру растений, erectness и профилактики заболеваний или вредителей в злаковых растений 7-9.

Горшечных орхидей и вырезать цветок орхидеи рынок процветает , и это растущая отрасль. Фаленопсис Aphrodite (моли орхидеи) является одним из наиболее важных экспортных декоративных растений в Тайване. Значительные усилия были предприняты , чтобы понять морфологические и физиологические изменения цветущих процессов в Phalaenopsis орхидеи. Цветочные шипы Phalaenopsis орхидеи инициируются из пазушных почек у основания листа. После периода прохладной температуры окружающей среды (примерно полтора месяца), пазушные почки увеличить, нарушения покоя, и выступать из основания листа, чтобы превратиться в молодых цветочных шипов. Чтобы понять физиологические, клеточном и молекулярные процессы инициации спайка, необходимо разработать надежную анатомическую технику для visuaткани или маркеры тивно своевременно. Тем не менее, присутствие вездесущих кристаллов в тканях орхидеи, особенно в пазушных почек, делает анатомический работу трудно.

Здесь мы стремились улучшить целостность сечения непокорных растительных тканей, которые были до настоящего времени считались технически сложной задачей. Здесь мы показываем улучшенный протокол под названием Hybrid-Cut. Это на основе парафина метод секционирования, который выполняется с помощью криостата. Парафин вложение устраняет высокое содержание воды в растительной ткани. Секционирование при низкой температуре твердеет парафиновый блок, уменьшает слезотечение кристалл проблемы, а также значительно улучшает целостность тканей. Этот протокол значительно улучшает целостность тканей для непокорных образцов растений.

Protocol

1. Закрепление и встраивание

  1. подготовка реагентов
    1. 10x фосфатно-солевого буфера (PBS),
      1. Добавляют 80 г NaCl, 2 г KCl, 14,4 г Na 2 HPO 4 и 2,4 г KH 2 PO 4 в 800 мл дважды дистиллированной воде (DDH 2 O) и доведения рН до 7,4 с помощью HCl. Добавить DDH 2 O до общего объема 1 л, затем добавляют 1,000 мкл диэтилпирокарбонат (DEPC) и энергично встряхивают. Хранить PBS в течение ночи при комнатной температуре и автоклаве при температуре 121 ° С в течение 20 мин на следующий день.
    2. 1x PBS
      1. Развести фондовом 10х PBS в соотношении 1:10 в DDH 2 O , чтобы получить конечную концентрацию 0,01 М Na 2 HPO 4, 0,002 М KH 2 PO 4, 0,003 М KCl, и 0,13 М NaCl.
    3. Параформальдегид (PFA) Фиксирующий
      Внимание: параформальдегид является токсичным. Готовят его под вытяжкой. Носить перчатки.
      1. Для приготовления 250 мл PFA закрепитель, нагрейте 100мл 1x PBS до 70 - 80 ° С и добавляют 1,750 мкл NaOH. Затем добавляют 10 г параформальдегида и тщательно перемешивают до полного растворения. Поместите раствор на льду , а затем довести рН до 7,2 с помощью H 2 SO 4 (260 - 270 мкл на 100 мл) после охлаждения.
      2. Регулировка громкости до 250 мл 1x PBS, добавляют 625 мкл глутарового альдегида до конечной концентрации 0,25%. Добавить 250 мкл Тритона Х-100 и 250 мкл Tween 20, чтобы облегчить проникновение в фиксаторе.
        Примечание: ПФА Фиксирующий можно хранить при температуре 4 ° С в течение одного месяца, не теряя при фиксации ее способности.
    4. Приготовьте различные концентрации этанола (30%, 50%, 70%, 85%, и 95%) с DEPC-обработанной воды.
  2. Сбор образцов растений
    1. пазушные почки
      1. Использование зрелых фаленопсис орхидеи растения на стадии четырех листьев. Осторожно удалите листья, оторвав лист ниже жилки, используя руки.
      2. Используйте острый скальпель carefully удалить пазушных почек от основания третьего или четвертого листа на моноподиального стебля.
    2. образец семян
      1. Заготавливают зрелые стручки семян орхидеи через 4 месяца после опыления. Разрежьте стручки семян в продольном направлении с помощью скальпеля. Встряхнуть отверстие семян стручок мягко и освободить сухие семена на фильтровальную бумагу.
    3. Protocorm
      1. Высевают зрелых семян орхидей на 1 / 2x Мурашига и Скуга агаром с, и расти в культуре ткани комнате в течение светового 12 ч и постоянной температуре 25 ° C. Образец зеленый protocorm через 7 недель после посева.
    4. Protocorm подобные тела (ИПР)
      1. Grow орхидеи ПРБ на Т2 регенерации агаром , как описано выше 10 и место в тех же условиях роста , как на стадии 1.2.3.1. Соберите 10 ИПР на высоте 5 - 8 мм.
    5. образец листа
      1. Собирают ткани листа от зрелого фаленопсис орхидеи , как описано в стадии1.2.1.1.
      2. Используйте острый скальпель, чтобы вырезать небольшой кусочек ткани листа (7 мм длина х ширина 5 мм) от второго недавно разработанного листа.
    6. образец Root
      1. Используя ту же установку, описанную в шаге 1.2.1.1, рассекают 1 см длины кончика корня ткани, используя острый скальпель.
    7. Молодой шип
      1. Используйте острый скальпель, чтобы вырезать молодой шип ткани из оконечной части стебель цветка 10 см в длину.
    8. Цветочный бутон
      1. Акцизный небольшой бутон цветка 5 мм в диаметре от цветок орхидеи стебле. Вырезать часть бутон цветка ткани в продольном направлении (3 мм в толщину).
    9. ткани листьев и колосковые ткани зерновых культур
      1. Вырезать 1 см длины листовой пластинки ткани из первых вновь разработанных листьев из риса, пшеницы и кукурузы растений.
      2. Соберите 10 колосков из растений (рис, пшеница и кукуруза) за один день до опыления.
  3. фиксация
    1. Фикс образцы растений сразу путем переноса их в стеклянный сцинтилляционный флакон, содержащий 15 мл охлажденного льдом PFA закрепитель.
    2. Применение вакуума (~ 720 мм рт.ст.) в образцах растений в 4 ° C прохладном помещении. Держите вакуум в течение 15 - 20 мин (небольшие пузырьки должны быть освобождены из образцов). Повторите этот шаг, пока большинство тканей не тонуть после освобождения вакуума. Держите вакуум в течение ночи и освободить вакуум медленно на следующий день.
  4. дегидратация
    Примечание: Используйте тот же флакон с фиксацией через шаги инфильтрации. Налейте или использовать пипетку, чтобы слить раствор в предыдущем шаге, и заменить 15 мл раствора в новом флаконе. В зависимости от текстуры тканей, лечить труднее тканей, таких как орхидеи подмышечной зародыше, семена, protocorm и PLB и колосков риса, пшеницы, кукурузы и в течение длительного времени; лечить мягкие ткани, такие как орхидеи бутон цветка, молодой шип, листьев и корней, а также листьев риса, пшеницы и кукурузы в течение более короткого времени. После фиксации, погрузить образец в 15 мл 1X PBS в течение 10 мин на льду.
    1. Высушить образцов в серии этанола 15 мл при комнатной температуре следующим образом: 30% этаноле в течение 30 мин, 50% этаноле в течение 30 мин, 70% этанола в течение 1 ч, 85% этаноле в течение 54 мин для более твердых тканей и 30 мин для мягких тканей, 95% этаноле в течение 54 мин для более твердых тканей и 30 мин для более мягких тканей, и 100% этанола, дважды в течение 54 мин для более твердых тканей и 30 мин для мягких тканей.
      Примечание: образцы растений могут быть сохранены в 70% -ном этаноле при температуре 4 ° С в течение нескольких месяцев.
  • Парафин инфильтрации
    1. Инфильтрат образцы с 15 мл этанола и ксилола заменителя смеси в течение 54 мин каждый для более твердых тканей и 30 мин для более мягких тканей, при комнатной температуре следующим образом: заменить этанол / ксилол (2: 1, об / об), этанол / заменителем ксилола (1 : 1, об / об), этанол / ксилол запасной (1: 2, об / об), и чистый ксилол заменитель дважды. Внимание: Ксилол является токсичным. Сделайте этот шаг в вытяжном шкафу. Инфильтрат образца во флаконе с заменителем ксилоле 15 мл и парафиновой смеси в печи при температуре 60 ° С, в течение ночи для более твердых тканей, и в течение 60 мин для более мягких тканей следующим образом: ксилол заменяющую / парафином (2: 1, об / об), ксилол заменителем / парафин (1: 1, об / об), и ксилол заменителем / парафин (1: 2, об / об).
    2. Инфильтрат образца с 15 мл чистого парафина два раза в день и инкубировать при 60 ° С в печи.
    3. Повторите шаг 1.5.3 на следующий день.
  • Тканевая вложение
    1. Включите питание тканевого вложения центра 1 час заранее, чтобы растопить воск в парафиновой резервуаре перед тем вложении ткани в парафиновый блок.
    2. Разогревают металлические формы (размер базовой 3,3 см длина х ширина 2 см) на лотке потепления при 62 ° C, и залить приблизительно 13 мл расплавленного воска в пресс-форме.
    3. Передача одного образца ткани из раздела 1.5.4 в пресс-форму с подогреваемой пинцетом и ориентировать ее в нужное положение.
    4. Перемещение формына тщательно прохладную тарелку и оставьте, пока воск затвердевает.
  • 2. Ткань Секционирование

    1. Метод секционирования Парафин
      1. Сделать восковую основу путем размещения вложение кассеты на верхней части пресс-формы (такого же размера в разделе 1.6.2), заполняют расплавленным воском и удалить плесень после того, как воск затвердевает.
        Примечание: Вложение кассеты образует восковую основу для закрепления блока образца парафина.
      2. Обрезка парафиновый блок в соответствующую форму и размер, и поместите некоторые восковые кусочки на плоской лопаточки. Нагреть кусочки воска не используя горелку спирта, пока воск тает, а затем поместить расплавленный воск на парафиновой базе в разделе 2.1.1 придерживаться блока. Зажмите его в микротома.
      3. Поместите новое лезвие на микротома, и отрегулируйте угол до 5 градусов для облегчения секционирования в микротома.
      4. Обрежьте парафиновый блок образца на тонкие ломтики (10 мкм), как описано выше 11.
      5. </ Ол>
      6. Гибрид-Cut секционирования метод
        1. Обрежьте образец парафина блок из стадии 1.6.4 колонки с поверхностью трапеции в верхней части до нужного размера с помощью лезвия бритвы.
        2. Добавьте Оптимальное температуры резания соединение (ОКТ) к центру сцены криостата. Приложить парафиновый блок на этапе криостат, а затем быстро сориентировать блок ткани в нужное положение.
        3. Передача парафинового блока / этап к криостата камере. Разрешить Октябре закрепить на быстром замораживании бар при -42 ° С в течение 10 мин. Не перемещайте блок во время затвердевания ОКТ (рис 2C).
        4. Разрешить адаптер для криостата и температуры в камере для охлаждения до -20 ° С и -16 ° С, соответственно, перед присоединением парафиновый блок / стадию к адаптеру криостата. Раздел ткани до 10 мкм в толщину.
        5. Выбор срезов ткани с щипцами. Поплавок разделы по 800 мкл DEPC обработанной воды в поли - L - лизин , сообTed слайдов и передавать слайды на горячей плите при температуре 42 ° C.
        6. Разрешить секции выравниваться на DEPC обработанной воды при температуре 42 ° C. Используйте фильтровальную бумагу, чтобы слить воду из края.
        7. Крепление ткани на слайде путем размещения слайдов на горячей плите 42 ° С в течение ночи.

      3. Ткань Окрашивание

      1. Депарафинирование
        1. Соберите слайды из горячей пластины и поместить их в стойку окрашивания. Добавьте 150 мл ксилола в сосуд для окрашивания в вытяжном шкафу и погружать стойку в ксилоле в течение 5 мин.
      2. Регидратация
        1. Готовят разные концентрации растворов этанола (100%, 95%, 70%, 50%, и 30%) в ДЭФЦ обработанной воде и заполнить 150 мл раствора в различных окрашивающих банок, соответственно.
        2. Увлажняет образцы через серию снижения концентрации этанола, каждый шаг в течение 3 мин при комнатной температуре. Передача слайдов в окрашивании наберешь одну банку в другой сосуд, содержащий гКонцентрации этанола ifferent: 100% этилового спирта, 95% этилового спирта, 70% этилового спирта, 50% -ного этилового спирта и 30% этилового спирта.
        3. После регидратации, погрузить образцы в DDH 2 O в течение 3 мин.
      3. гематоксилин окрашивание
        1. Образцы тканей Stain погружением слайдов ткани в гематоксилин растворе в течение 1,5 мин.
        2. Сполоснуть в DDH 2 O , содержащий 1 - 2 капли 12 н соляной кислоты (HCl) в течение нескольких секунд, а затем кратко промыть в DDH 2 O.
      4. дегидратация
        1. Обезвоживают образцы через серию возрастающих концентраций этанола в течение 3 мин при комнатной температуре: 30% этилового спирта, 50% этилового спирта, 70% этилового спирта, 95% этилового спирта, и 100% этилового спирта. Очистить образцы с ксилолом в вытяжном шкафу в течение 5 мин.
      5. монтаж
        1. Отбросьте соответствующим образом 600 мкл ксилола на основе монтажной среды на слайде. Осторожно поместите покровное над образцом. Избегайте пузырьков воздуха, образуя, чтобы получить хорошее качество изображения.
        2. Разрешить слайды высохнуть на воздухе в течение ночи. Обратите внимание на образец под микроскопом на следующий день.
          Примечание: Изображения были захвачены в 25X до 400X увеличения в зависимости от размера образцов.

      4. В гибридизация

      1. синтез Probe
        1. Клон фаленопсис Aphrodite актина гена специфических кодирующей последовательности с использованием праймеров 5'-GGCAGAGTATGATGAATCTGGTCC-3 'и 5'- AGGACAGAAGTTCGGCTGGC -3' (чтобы получить 242 п.о. PCR ампликона) и CyclinB1; 1 гена специфической последовательности кодирования с использованием праймеров 5'-TCGTAGCAAGGTTGCTTGTG-3 ' и 5'- ATGAGCATGGCGCTAATACC-3 '(для получения 327 п.о. PCR ампликона) , как описано 12.
        2. Перевязывать специфические последовательности , кодирующие в векторы (например, pGEMT) в соответствии с протоколом производителя.
        3. Сформировать дигоксигенином (DIG), меченного смысловую и антисмысловую зондов с использованием SP6 / T7 РНК-DIG комплект маркировки в соответствии с инструкцией производителяs.
      2. В месте гибридизации
        1. Вырезать 2 - й и 3 - й ломтики подмышечных бутон ткани (толщина 10 мкм) , генерируемых с использованием метода Hybrid-Cut, и смонтировать ломтиками на слайде с покрытием.
        2. Deparaffinize срезы ткани в ксилоле (см 3.1.1), регидратации в уменьшении концентрации этанола (см 3.2.2), и переваривают с 2 мг / мл протеиназы К при 37 ° С в течение 30 мин.
        3. Выполнение гибридизация в соответствии с протоколом , описанным ранее 11,13 с некоторыми изменениями, то есть с температурой гибридизации актина , как 59 ° С и 60 ° С в течение CyclinB1;. 1 гибридизуются слайд с 40 нг DIG-меченных РНК - зонда.
        4. С помощью 5-бром-4-хлор-3-индолил фосфат (НСТ / BCIP) раствор тетразола / для обнаружения сигналов гибридизации , как описано 11.

    Representative Results

    Гибрид-Cut повышает целостность ткани секций

    Понимание анатомии репродуктивной цветочной структуры имеет важное значение для изучения основной механизм цветочной инициации в орхидей. Тем не менее, накопление кристаллов оксалата кальция в внутриклеточным Phalaenopsis орхидеи делает такие исследования сложной задачей. Для того, чтобы обойти проблемы , связанные с разрывая вызванные кристаллами в процессе секционирования (рисунок 1), мы разработали систему , мы назвали Hybrid-Cut. Этот протокол сочетает в себе традиционные методы парафин и cryosection. Мы впервые опробован Hybrid-Cut в подмышечных бутонов орхидеи фаленопсис , потому что они славятся жесткости ткани и высоким содержанием кристаллов. Подмышечный бутон ткани фиксировали в 4% PFA (см протокол, шаг 1.3). После последовательного обезвоживания этанола и парафина Infiltration, подмышечные бутон был встроен в парафиновый блок. Блок был обрезали до нужного размера перед тем секционирования (фиг.2А). Небольшое количество ОКТ затем применяется к центру сцены криостата (Фигура 2В). Блок парафина затем приклеивают к стадии через ОКТ. Ступень инкубировали в криостате в течение 10 мин , чтобы обеспечить полное затвердевание ОКТ до того секционирования (фиг.2С) , а затем cryosection проводили в -16 ° C камера (рис 2D).

    В качестве сравнения, парафин блок , содержащий подмышечной бутон орхидеи фаленопсис подвергали регулярным микротома секционирования. Как показано на рисунке 1А, наблюдалась тяжелая разрывание парафиновых лент после микротома секционирования. Целостность ткани и клеточная структура была также нарушена (Фигура 1В). Гибрид-Cut, с другой стороны,полученные участки неповрежденной ткани (рис 3А) с сохраненной структурной целостности (рис 3B).

    Применение Гибрид-Cut для различных тканей Р. Афродита

    Для дальнейшего тестирования аменабельность Hybrid-Cut, мы тестировали различные ткани Phalaenopsis орхидеи. Часто бывает трудно получить участки семян с хорошей целостности тканей из-за затвердевшего семенных оболочек. Используя этот протокол, подробные структуры семян были сохранены после секционирования (рис 4а). Как показано на фиг.4А, белковые тела, общие хранения продуктов 14, могут быть четко идентифицированы. Гибрид-Cut также работал успешно и показали подробные структуры апикальной меристемы побега из одного месяца старого protocorm (пророщенных структуры из семени) (рис 4б) иprotocorm типа кузовов (ИПР, фиг.4С). Внутриклеточные кристаллы наблюдались в секциях PLB. Phalaenopsis орхидеи имеют толстые и сочные листья , и они выполняют метаболизм Crassulacean кислоты (САМ) -типа 15 фотосинтез. Поперечное сечение листовой пластинки показали крупные клетки мезофилла и сосудистые пучки , содержащие ксилемы и флоэмы (рис 4D). Немногие устьичных отверстия наблюдались на абаксиальной листовой поверхности в дневное время (рис 4D). На самом деле, CAM растения эволюционировали , чтобы максимизировать прибыль углерода , но одновременно свести к минимуму потери воды путем открытия их stomates ночью в аридных условиях 15,16. Корень апикальной меристемы Р. Aphrodite показан на рисунке 4E. Кончик клетки корня , похоже, содержит значительное количество кристаллов, которые были очень хорошо сохранились после секционирования (рис 4д). Продольные секции молодых цветочных шипов при условии Informatиона об архитектуре молодых цветочных primordials (рис 4F). Кроме того, чашелистики, лепестки, labellum и поллинии могли быть четко идентифицированы из продольного разреза молодых бутонов, завершивших дифференцировку в этом 5 мм бутон цветка (рис 4G). Обратите внимание на то, что кристаллы были накоплены в чашелистиков молодых цветочных почек. Короче говоря, этот протокол работает последовательно для поддержания целостности тканей и производит нетронутыми морфологии позволяет анатомических и возможные клеточные исследования.

    Гибрид-Cut Консервированные Tissue целостности в злаковых культур

    Мы также протестировали Hybrid-Cut на зерновых культур , таких как рис, пшеница и кукуруза , которые содержат высокое содержание диоксида кремния 17,18. Как показано на рисунке 5, целостность ткани поперечных сечений риса, пшеницы, кукурузы и листьев были значительно улучшены за счет HyБрид-Cut метод. Ксилем, флоэмы, мезофильные клетки, stomates и bulliform клетки, которые контролируют прокатные листовой пластинки, чтобы избежать потери воды были четко определены из разделов рисовых листьев. Кранц анатомии, мезофильные клетки, и сосудистые пучки листьев кукурузы 19,20 были четко определены. Это было интригующим , чтобы найти высокую плотность stomates на обоих адаксиальной и абаксиальной сторонах кукурузы листьев (рисунок 5). Отношение адаксиальную и абаксиальной устьицах 0,7 кукурузы сообщалось ранее 21. Кроме того, этот протокол также успешно работал , чтобы обеспечить подробную морфологии клеток колосков из риса, пшеницы, кукурузы и (рисунок 6). Колоски , как известно, содержат обильную кремнезема 9. Как правило, это вызывает трудности в проведении секционирования ткани.

    В гибридизация

    В-гибридизация (ISH) была разработана , чтобы локализовать паттерны экспрессии генов на тканевом уровне 11, 22-25. Кроме того, ISH может обеспечить сотовой связи, а в некоторых случаях субклеточном, разрешение распределения мРНК в многоклеточных организмах 26. Во время ISH, РНК и целостность ткани имеет важное значение для получения достоверной пространственной информации о выбранном транскрипта. Мы тестировали ISH с использованием протокола Гибрид-Cut актина гена (PATC157348) был клонирован с использованием праймеров 5'-GGCAGAGTATGATGAATCTGGTCC-3 'и 5'- AGGACAGAAGTTCGGCTGGC -3' , чтобы получить 242 п.о. PCR ампликона циклин В1:.. Ген 1 (PATC146999) специфические последовательность кодирования с использованием праймеров 5'-TCGTAGCAAGGTTGCTTGTG-3 'И 5'- ATGAGCATGGCGCTAATACC-3', чтобы получить 327 п.о. PCR ампликона. После того, как ISH, актин и циклин B1: 1 экспрессии генов контролировали у молодых и зрелых почек подмышечных (Рисунок 7). Выражались Оба гена в клетках меристемы 2 - й и 3 - й пазушных почек, с более сильным сигналом обнаружены в 3 - м пазушных почек. Эти результаты показали, что гибридная-Cut сохранить хорошую анатомию и обеспечивают пространственную картину экспрессии генов.

    Рисунок 1
    Рисунок 1: Традиционная секция Парафин Вызывает серьезные разрывание ткани Блок парафина , содержащий подмышечную бутон орхидеи фаленопсис подвергали регулярным микротома секционирования.. Тяжелая разрывание парафиновых лент наблюдалось после традиционного микротома секционирования (А) (Б). Стрелки показывают серьезный разрыв среза ткани. Arrowhead показывает кристаллические тела. Масштабная линейка 100 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    фигура 2
    Рис . 2: Гибрид-Cut Секционирование Метод подмышечной бутон ткани фиксировали в PFA и ткани были обезвожены, пропитывают парафином и заливали в парафиновый блок. Парафиновый блок был укорочен до соответствующего размера (A). Оптимальная температура резания соединение (ОКТ), наносили на центр сцены криостата (B). Блок парафин был прикреплен к ОКТ на сцене криостата. При низкой температуре, парафиновый блок приклеивали к стадии криостата с помощью ОКТ (C). Срезы тканей рассекают в криостат камере при -16 ° C (D). Масштабные столбцы представляют 0,5 см (А) и 1 см (BD). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    Рисунок 3
    Рисунок 3: Гибрид-Cut повышает целостность Раздел блок парафина , содержащий подмышечную бутон орхидеи фаленопсис подвергали гибридно-Cut секционирования (A) и метод Hybrid-Cut производятся секции с отличной целостности тканей (B).. Стрелолист показывает эндогенные кристаллические тела, встроенные в подмышечных бутон ткани. Масштабная линейка 100 мкм.rget = "_blank"> Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

    Рисунок 4
    Рисунок 4: Применение гибридных обрезкой тканей Разделы фаленопсис орхидеи Различные орхидеи. ткани рассекают с использованием гибридного метода штамповкой, таких как продольное сечение орхидеи семени во зрелой стадии (A), продольный разрез protocorm (B), продольное сечение protocorm типа тел (PLB) (С), поперечное сечение Листовые пластинки (D), продольный разрез корней (Е), продольный разрез молодого цветонос (F), и продольный разрез молодых цветочных почек (G). Тканевые срезы окрашивали гематоксилином. SC, кожура; PB, белковое тело; М,меристемы; MP, мать PLB; DP, дочь PLB; Ad, адаксиальная поверхность листа; Ab, абаксиальный поверхность листа; St, устьица; MC, мезофилла клеток; VB, сосудистый пучок; RC, корневой колпачок; Ф.Б., бутон цветка; Se, чашелистник; Пе, лепесток; La, labellum; Po, поллинии; Ro, носиком; Ca, каллус. Наконечники показывают кристаллы. Масштабные столбики представляют 20 мкм (AE) и 200 мкм (FG). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    Рисунок 5
    Рис . 5: Гибрид-Cut Консервированные Tissue целостности листьев в нескольких злаковых культур Сравнение ткани листьев с использованием традиционного метода парафина (левая панель) и метод Hybrid-Cut , разработанной в данном исследовании (правая панель). Изображения показывают поперечные срезы листьев риса, пшеницы и кукурузы. MC, мезофилла клеток; Ph, флоэма; St, устьица; До н.э., бушель lliform клеток. Стрелки показывают разрывание срез ткани. Наконечники показывают кремнезема тела. Синие пунктирные круги указывают Кранц анатомии в С4 кукурузы. Шкала баров 20 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    Рисунок 6
    Рис . 6: Гибрид-Cut Консервированные Tissue Целостность колоска в нескольких злаковых культур Сравнение целостности тканей колосковых секций между традиционными парафиновых и Гибрид-Cut методов. Стрелки показывают разрывание срез ткани. Наконечники указывают кремнезема тела. Шкала баров 20 мкм (рис) и 200 мкм (пшеница и кукуруза). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    лор "ВОК: Keep-together.within-странице =" 1 "> Рисунок 7
    Рисунок 7: В гибридизация актина и CyclinB1; 1 паттерны экспрессии в подмышечной бутон Phalaenopsis орхидеи Тканевые срезы м подмышечной зародыше 2 - й пазушных почек и 3 были получены с использованием метода Hybrid-Cut.. В общей сложности 40 нг актина и CyclinB1; 1 DIG-меченый зонд использовали для гибридизации. Смысл зонд был использован в качестве отрицательного контроля. Стрелки указывают на репродуктивную меристемы подмышечной зародыше. Шкала баров 100 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    Discussion

    Клетки растений имеют жесткие клеточные стенки, жесткие волокна, кристаллы, и высокое содержание воды, которые вызывают проблемы, разрывая ткани во время секционирования растительной ткани. Несмотря на то, парафин на основе секционирования часто используется для растительных тканей, эндогенные кристаллы часто разрывают ткани растений во время секционирования (Рисунок 1). Из-за своей природе высоким содержанием воды в клетках растений, криостат на основе секционирования часто вызывает разрушенных клеток и шершавой срезах тканей.

    В настоящем исследовании, комбинированный протокол парафино-вложение и cryosection названный Гибрид-Cut был разработан и были получены хорошие срезы ткани качества. Этот протокол решает проблему , связанную с высоким содержанием воды путем введения в парафин, а также уменьшает эффект разрывания закалкой парафина при низкой температуре в течение секционирования (рисунок 3). Таким образом, этот модифицированный протокол имеет преимущество по сравнению либо на основе парафина Sectioнин или cryosectioning для сохранения целостности тканей растений.

    Эта рукопись показывает , что метод Гибридный-Cut сохраняет целостность тканей во многих тканях Фаленопсис , таких как подмышечной почка, семена и PLB и т.д. , которые содержат высокие уровни кристаллов (рис 3-4). Кроме того, этот протокол поддается зерновых культур , таких как репродуктивных органов и листьев риса, кукурузы и пшеницы , которые содержат высокое содержание кремнезема (цифры 5-6). По-видимому, этот протокол может быть применен к древесных растений, содержащих высоким содержанием клетчатки.

    В общем, фиксируя ткань тщательно очень важно для гибридно-Cut. Мы обнаружили , что формальдегид-спирт-уксусная кислота (FAA) закрепляющий лучше , чем PFA для сохранения целостности тканей некоторых непокорных тканей , таких как аксиально почки, корни и т.д. Тем не менее, PFA работает лучше , чем ФАУ в сохранении целостности РНК. Поэтому PFA рекомендуется зафиксироватьОбразец для в гибридизация (МОГ) работы. Протокол, описанный здесь, предназначен для РНК ISH эксперимента. Таким образом, все реагенты были подготовлены, чтобы избежать деградации РНК путем устранения загрязнения РНКазы путем обработки DEPC. Если Hybrid-Cut раздел для анатомических исследований, регулярное обратного осмоса воды (RO) и его производным буфер или реагенты являются приемлемыми.

    Уменьшение размера и толщины образца до менее чем 3 мм, полезно для инфильтрации. Кроме того, увеличение времени погружения для обезвоживания и инфильтрации необходимы для твердых тканей текстуры. Ограничение этого протокола может из-за проблем, вызванных недостаточной фиксации, дегидратации и инфильтрации образца. Таким образом, регулировка времени обработки для каждого шага имеет решающее значение для получения парафинового блока хорошего качества. Как правило, труднее ткани требуется больше времени, чем обработка более мягкой ткани.

    Кроме того, мы показали, что Hybrid-Cut успешно работал в комбинации Wiго ISH , чтобы обеспечить пространственное распределение выбранных транскриптов (рисунок 7). Таким образом, этот протокол используется для изучения анатомии растений и обеспечивает тканеспецифическую РНК карту выбранных генов. Кроме того , он может быть применен к другим молекулярных исследований , таких как терминал дезоксинуклеотидтрансферазу дУТФ ник конец маркировки (TUNEL) анализа, флуоресценции в гибридизация (FISH) и методов иммунной окраски. В заключение, это улучшенный протокол ткани секционирования является полезным и полезным для исследователей в растительных сообществах.

    Materials

    Name Company Catalog Number Comments
    Embedding Center model EC780-1 CSA
    Microtome model RM2255 Leica
    Cryostat model CM 1950 Leica
    Axio Scope A1 microscope  Zeiss
    Murashige & Skoog medium including vitamins Duchefa Biochemia M0222.0050
    RNase free surface decontaminant Apex 10-228
    Diethyl pyrocarbonate (DEPC) Bio Basic Inc.  D801154
    Sodium chloride (NaCl) MDBio, Inc. 101-7647-14-5
    Potassium chloride, crystal (KCl) J.T. Baker 7447-40-7
    Sodium phosphate dibasic (Na2HPO4) Sigma-Aldrich 7558-79-4
    Potassium phosphate monobasic (KH2PO4) Sigma-Aldrich 7778-77-0
    Paraformaldehyde (PFA) Sigma-Aldrich 16005
    Sodium hydroxide (NaOH) Showa 19430160
    Sulfuric acid (H2SO4) Sigma-Aldrich 7664-93-9
    Glutaraldehyde solution Sigma-Aldrich 111-30-8
    Polyoxyethylene 20 sorbitan monolaurate (Tween 20) J.T. Baker 9005-64-5
    Octyl Phenol Ethoxylate (Triton X100) J.T. Baker 9002-93-1
    Glass scintillation vials Newastar DG60805-00020
    Desiccator vacuum Violet Bioscience Inc. TS-402030
    Rotary vane pump RZ2.5 Vacuubrand 36149406
    Ethanol J.T. Baker 64-17-5
    Sub-X  Leica Surgipath 3803670 Xylene substitute
    Paraplast Plus  Leica Surgipath 39602004 Tissue embedding paraffin
    SUPERFROST micro slide glass Matsunami S7441
    FSC 22 Clear  Leica Surgipath 3801480 Optimal Cutting Temperature compound (OCT) 
    Xylenes, Purified Leica Surgipath 3803665
    Hematoxylin Merck HX305311
    Hydrochloric acid (HCl) Sigma-Aldrich 7647-01-0
    Micromount Leica Surgipath 3801731 Mounting medium
    pGEM T-easy vector Promega A1360
    Proteinase K Roche 3115879001
    SP6/T7 DIG RNA Labeling Kit Roche 11175025910
    NBT/BCIP stock solution Roche 11681451001

    DOWNLOAD MATERIALS LIST

    References

    1. Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. Cryosectioning tissues. Cold Spring Harb Protoc. 3, 1-2 (2008).
    2. Knox, R. B. Freeze-sectioning of plant tissues. Stain Technol. 45, 265-272 (1970).
    3. Ruan, J. L., et al. An improved cryosection method for polyethylene glycol hydrogels used in tissue engineering. Tissue Eng.: Part C Methods. 19, 794-801 (2013).
    4. Prychid, C. J., Rudall, P. J. Calcium oxalate crystals in monocotyledons: A review of their structure and systematics. Ann Bot. 84, 725-739 (1999).
    5. Prychid, C. J., Rudall, P. J., Gregory, M. Systematics and biology of silica bodies in monocotyledons. Bot. Rev. 69, (4), 377-440 (2004).
    6. Arnott, H. J., Pautard, F. G. E., Steinfink, H. Structure of calcium oxalate monohydrate. Nature. 208, 1197-1198 (1965).
    7. Mitani, N., Yamaji, N., Ma, J. F. Identification of maize silicon influx transporters. Plant Cell Physiol. 50, 5-12 (2009).
    8. Hayasaka, T., Fujii, H., Ishiguro, K. The role of silicon in preventing appressorial penetration by the rice blast fungus. Phytopathology. 98, 1038-1044 (2008).
    9. Ma, J. F., Yamaji, N. Silicon uptake and accumulation in higher plants. Trends Plant Sci. 11, 392-397 (2006).
    10. Chen, W., Tang, C., YL, K. Ploidy doubling by in vitro culture of excised protocorms or protocorm-like bodies in Phalaenopsis species. Plant Cell Tiss Org. 98, 229-239 (2009).
    11. Javelle, M., Marco, C. F., Timmermans, M. In Situ Hybridization for the Precise Localization of Transcripts in Plants. J. Vis. Exp. (57), e3328 (2011).
    12. Park, D. J. E. PCR Protocols. Methods in Molecular Biology. 687, (2011).
    13. Lin, H. Y., et al. Genome-wide annotation, expression profiling, and protein interaction studies of the core cell-cycle genes in Phalaenopsis aphrodite. Plant Mol Biol. 84, 203-226 (2014).
    14. Lee, Y. -I., Yeung, E. C., Lee, N., Chung, M. -C. Embryology of Phalaenopsis amabilis var. formosa: embryo development. Bot Stud. 49, 139-146 (2008).
    15. Endo, M., Ikusima, I. Diurnal rhythm and characteristics of photosynthesis and respiration in the leaf and root of a Phalaenopsis plant. Plant Cell Physiol. 30, 43-47 (1989).
    16. Guo, W. J., Lee, N. Effect of leaf and plant age, and day/night temperature on net CO2 uptake in Phalaenopsis amabilis var. formosa. J. Amer. Soc. Hort. Sci. 131, 320-326 (2006).
    17. Lewin, J., Reimann, B. Silicon and plant growth. Ann. Rev. of Plant Physiol. 20, 289-304 (1969).
    18. Kaufman, P. B., et al. Silica in shoots of higher plants. Silicon and siliceous structures in biological systems. Simpson, T. L., Valcani, B. E. Springer-Verlag. 409-449 (1981).
    19. Lundgren, M. R., Osborne, C. P., Christin, P. A. Deconstructing Kranz anatomy to understand C4 evolution. J Exp Bot. 65, 3357-3369 (2014).
    20. Liu, W. Y., et al. Anatomical and transcriptional dynamics of maize embryonic leaves during seed germination. Proc Natl Acad Sci U S A. 110, 3979-3984 (2013).
    21. Driscoll, S. P., Prins, A., Olmos, E., Kunert, K. J., Foyer, C. H. Specification of adaxial and abaxial stomata, epidermal structure and photosynthesis to CO2 enrichment in maize leaves. J Exp Bot. 57, 381-390 (2006).
    22. Karlgren, A., Carlsson, J., Gyllenstrand, N., Lagercrantz, U., Sundström, J. F. Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species. J. Vis. Exp. (26), (2009).
    23. Hejatko, J., et al. In situ hybridization technique for mRNA detection in whole mount Arabidopsis samples. Nat Protoc. 1, 1939-1946 (2006).
    24. Javelle, M., Timmermans, M. C. In situ localization of small RNAs in plants by using LNA probes. Nat Protoc. 7, 533-541 (2012).
    25. Drea, S., et al. In situ analysis of gene expression in plants. Methods Mol Biol. 513, 229-242 (2009).
    26. Drea, S., et al. A streamlined method for systematic, high resolution in situ analysis of mRNA distribution in plants. Plant Methods. 1, 8 (2005).
    Гибрид-Cut: улучшенный Секционирование Метод непокорных растительных образцов тканей
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Chen, T. K., Yang, H. T., Fang, S. C., Lien, Y. C., Yang, T. T., Ko, S. S. Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples. J. Vis. Exp. (117), e54754, doi:10.3791/54754 (2016).More

    Chen, T. K., Yang, H. T., Fang, S. C., Lien, Y. C., Yang, T. T., Ko, S. S. Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples. J. Vis. Exp. (117), e54754, doi:10.3791/54754 (2016).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter