Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version


إعداد rAAV9 إلى بإفراط أو ضربة قاضية الجينات في قلوب ماوس

doi: 10.3791/54787 Published: December 17, 2016


السيطرة على التعبير أو نشاط جينات معينة من خلال تقديم عضلة القلب من المواد الجينية في نماذج الفئران يسمح التحقيق في وظائف الجينات. الإمكانات العلاجية في قلب كما يمكن تحديدها. هناك أساليب محدودة في الجسم الحي تدخل الجزيئي في قلب فأر. وقد استخدمت المؤتلف فيروس الغدة المرتبطة (rAAV) هندسة الجينوم المستندة كأداة أساسية في الجسم الحي التلاعب الجيني القلب. وتشمل المزايا المحددة لهذه التكنولوجيا عالية الكفاءة، والدقة العالية، وانخفاض معدل التكامل الجيني، الحد الأدنى المناعية، والحد الأدنى المرضية. هنا، يتم وصف إجراءات تفصيلية لبناء، حزمة، وتنقية ناقلات rAAV9. حقن تحت الجلد rAAV9 إلى الجراء حديثي الولادة النتائج في التعبير القوي أو ضربة قاضية كفاءة من هذا الجين (ق) من الفائدة في قلب فأر، ولكن ليس في الكبد والأنسجة الأخرى. باستخدام القلب-specifiتم الحصول ج TnnT2 المروج والتعبير عالية من الجين GFP في القلب. بالإضافة إلى ذلك، استهداف وتثبيط مرنا في القلب عندما كان يستخدم لrAAV9-U6-shRNA. العمل معرفة التكنولوجيا rAAV9 قد يكون من المفيد إجراء تحقيقات القلب والأوعية الدموية.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

أصبحت السيطرة على التعبير أو نشاط جينات معينة في الأنظمة البيولوجية المختلفة استراتيجية قيمة في دراسة وظيفة الجين 1. وسيلة مباشرة لتحقيق هذا الهدف هو التلاعب تسلسل النوكليوتيدات وتوليد أليل متحولة. وعلى الرغم من اتخاذ دقيقة، والتغيرات التي تستهدف جينوم الخلايا الحية لا تزال ووممارسة كثيفة العمالة تستغرق وقتا طويلا، وقد فتحت تنمية قوية TALEN وكريسبر / Cas9 أدوات حقبة جديدة من تحرير الجينوم 2-5. وقد ركزت طريقة المخبرية الروتينية أكثر للتلاعب الجيني على إدخال المواد الجينية (السلطات الوطنية المعينة والرنا التي تحتوي على الترميز متواليات أو الرناوات siRNAs / shRNAs) إلى خلايا للتعبير أو ضربة قاضية الجين (ق) من الفائدة 1،6.

في كثير من الحالات، وعقبة رئيسية للتلاعب الجيني هو تسليم DNA، RNA، أو البروتين في الخلايا. وفيما يتعلق الدراسات في المختبر، transfecti كفاءةعلى أنظمة أنشئت في كثير من خطوط الخلايا المستزرعة. ومع ذلك، في نموذج الفأر على وجه الخصوص، في الجسم الحي توصيل الجينات هو أكثر تحديا. وهناك سلسلة من الحواجز من خارج وداخل الخلايا التي تحتاج إلى تجاوزها من أجل تحقيق امتصاص الخلوية كفاءة من الكواشف الخارجية. وتشمل عقبات إضافية لإزالة السريع وقصر مدة المواد 7،8 تسليمها. استراتيجية واحدة للتحايل على هذه القضايا هي استخدام ناقلات فيروسية باسم "ناقلات" أو "المركبات" في الجسم الحي توصيل الجينات. خصائص التنبيغ تطورت بشكل طبيعي من الفيروسات تسمح التنفيذ الفعال لجينة من الفائدة إلى خلايا 7،9،10. وقد تم تطوير أنواع عديدة من النواقل الفيروسية وتمكين مرونة في التلاعب الجيني المجراة في أنواع مختلفة من الخلايا والأعضاء في الفئران.

وتشمل أنظمة الفيروسية الأكثر شيوعا-الارتجاعي، الفيروسة البطيئة، اتش، والغدة المرتبطة الفيروسات (AAV) 12-14. ومع ذلك، وأنواع عديدة من الفيروسات تصيب فقط تقسيم الخلايا، ومدى فعاليتها في الخلايا غير تقسيم هو منخفض جدا 15. هذا يحد من فائدتها لتوصيل الجينات. الفيروسة البطيئة هو جنس من عائلة Retroviridae. مختلفة من الفيروسات الأخرى، ويمكن الفيروسة البطيئة تصيب كلا تقسيم الخلايا وعدم تقسيم واستخدمت على نطاق واسع لنقل الجين إلى ما بعد الإنقسامية وخلايا متباينة للغاية-16. دورة حياة الفيروسة البطيئة ينطوي أيضا على دمج الحمض النووي ناقلات في الجينوم المضيف. توصيل الجينات وبالتالي، الفيروسة البطيئة بوساطة تمكن مستقرة وطويلة الأجل التعبير عن العناصر الوراثية transduced 16-18. ومع ذلك، قد تمثل هذه الميزة الإلكترونية مزدوجالسيف جهاز 'في استخدام هذه الفيروسات لمعالجة التعبير الجيني، والتكامل من الحمض النووي ناقلات قد يؤدي إلى الطفرات إقحامي في الخلايا المضيفة ويمكن أن يسبب آثار مصطنع. اتش هو آخر يستخدم على نطاق واسع نظام توصيل الجينات. على عكس الفيروسات القهقرية وlentiviruses، الغدية هي غير متكامل ولا تتعارض مع سلامة الجينوم من الخلايا المضيفة 8،10،11،19. وبالإضافة إلى ذلك، يمكن الغدية transfect الحمض النووي في العديد من أنواع الخلايا، والإصابة ليست متوقفة على انقسام الخلايا النشطة 19. وهناك سمة أخرى مهمة من الغدية هو سهولة تنقية ناقلات، نظرا إلى أن ناقلات فيروسية القدرة على أن تتكرر 19،20. ومع ذلك، فإن التحذير الرئيسي لهذا النظام هو أن عدوى اتش يمكن أن تؤدي إلى استجابات مناعية قوية في الخلايا المستهدفة والأجهزة 19، وتقييد استخدامه في العديد من التحقيقات، لا سيما في الدراسات العلاج الجيني.

مقارنة مع هذه نوع مختلفالصورة من النواقل الفيروسية، والفيروسات المرتبطة الغدة-المؤتلف (rAAV) ويبدو أن نظام توصيل الجينات المثالي 21،22. فإنه يسلك الحد الأدنى المناعية والمرضية 23،24. وبالإضافة إلى ذلك، rAAV يصيب مجموعة واسعة من أنواع الخلايا، بما في ذلك الفاصل والخلايا غير الانقسام. في معظم الحالات، لا rAAV ليس الاندماج في الجينوم المضيف؛ وبالتالي، فإن مخاطر التغيرات الوراثية أو الجينوم غير مرغوب فيها في الخلايا المستهدفة منخفض 22.

في الآونة الأخيرة، وقد استخدمت أنظمة rAAV بنجاح لفي الجسم الحي تسليم البروتينات ترميز الحمض النووي، miRNAs، shRNAs، وكريسبر-gRNAs في الماوس عضلة القلب 23،25-29. وقد سهلت هذه المنهجية التحقيقات الأساسية والدراسات العلاج الجيني في مجال أبحاث القلب والأوعية الدموية. هنا، وإجراءات مفصلة لتوليد ناقلات rAAV9 أن بإفراط بكفاءة أو ضربة قاضية لجينات الفائدة في قلوب الماوس وصفه. وينص البروتوكول طريقة بسيطة وفعالة لالتلاعب التعبير الجيني القلب في الفئران نماذج تجريبية.

Subscription Required. Please recommend JoVE to your librarian.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تم تنفيذ جميع الخطوات المذكورة تحت البروتوكولات التي وافقت عليها لجنة السلامة الأحيائية واللجنة رعاية واستخدام الحيوان المؤسسي من مستشفى الأطفال في بوسطن. مستشفى بوسطن للأطفال ومرافق الماوس خالية من مسببات الأمراض مع ضوء / دورات الظلام التنظيم والتحكم في المناخ. البيطرية ورعاية الحيوان تغيير الموظفين الأقفاص وضمان صحة الفئران. المرافق AAALAC معتمدة ولها النشطة شهادة الحيوانية ضمان الرفاهية (AAALAC الاعتماد الممنوحة في 1992/02/24 الحيوان ضمان الرعاية الاجتماعية رقم: A3303-01). الموت الرحيم كانت الفئران عن طريق CO 2 تسليمها من مصدر الغاز المضغوط. تم جمع عينات الأنسجة بعد التأكد من معدل ضربات القلب والحركة والتنفس من الحيوانات قد توقفت. القوارض الوليدية هي مقاومة للثاني 2 القتل الرحيم ووالموت الرحيم بواسطة قطع الرأس باستخدام مقص حاد. هذه الأساليب تتفق مع توصيات الفريق بشأن القتل الرحيم للالطبية البيطرية الأمريكيةجمعية لتر.

1. توليد rAAV9 التركيبات التي كتبها استنساخ [كدنا] أو shRNA التعبير كاسيت في العمود الفقري البلازميد

ملاحظة: البلازميد rAAV9، التي تحتوي على يكرر محطة مقلوب (وائح الاتصالات الدولية) من AAV2، وتستخدم ل overexpression الجين تم تعديلها لإيواء TNNT2 الدجاج المروج (rAAV9.cTNT)، والتي تمكن التعبير عن cardiomyocyte معين من الجينات transduced 25،26،29. وقد أدخلت مواقع فريدة من نوعها NheI وKpnI إلى البلازميد، المصب من المروج. شظايا [كدنا ترميز الجينات التي تهم يمكن استنساخ في العمود الفقري rAAV9 استخدام هذه المواقع تقييد اثنين 25،26،29. هنا، على سبيل المثال، تم إنشاء ناقلات rAAV9 لoverexpression من هذا الجين GFP في قلوب الماوس. يحتوي البلازميد ينتج عن ذلك من cTNT :: الكاسيت GFP يحيط بها اثنان بالميدان المواقع (الشكل 1). استخدمت بنيات rAAV9.U6 :: shRNA عن الجينات ضربة قاضية 25. تصميم shRNAs باستخدامعلى الانترنت خدمة تصميم shRNA. rAAV9.U6 :: shRNA يمكن أن تتولد إما عن طريق الصلب وligating oligos التي تحتوي على الحمض النووي تسلسل shRNA في تقييد ناقلات rAAV9 هضم انزيم إيواء المروج U6، أو عن طريق طويلة المدى PCR وداخل الجزيئية أساس التجميع جيبسون "سلس" بناء 30. يجب أن يحتوي على البلازميد الناتج الكاسيت U6-shRNA يحيط بها اثنان بالميدان المواقع (الشكل 2). هنا، على سبيل المثال، تم بناء ناقلات rAAV9.U6 :: shRNA ضربة قاضية Trbp مرنا (Trbp shRNA تسلسل: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). تم استخدام التدافع shRNA بمثابة السيطرة السلبية (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. استنساخ [كدنا أو shRNA التعبير كاسيت في البلازميد العمود الفقري rAAV9. تحويل الحمض النووي في الخلايا المختصة كولاي 25.
    ملاحظة: استخدام stbl2 أو stbl3 الخلايا كولاي للتحول rAAV9 الحمض النووي للحد غير مرغوب فيها إعادة التركيب بالميدان.
  2. التقطاستنساخ إيجابية من الخلايا كولاي تحويلها. تضخيم ثقافة في 500 مل من ليلي-بارنيت المتوسطة واستخراج البلازميد rAAV9 من الخلايا البكتيرية 25-30.
    ملاحظة: ميدي / ماكسي الإعدادية البلازميد rAAV9 للحصول على كمية عالية من الحمض النووي (> 100 ميكروغرام). قبل إنشاء فيروس، دائما تحليل سلامة تسلسل البلازميدات AAV عن طريق الهضم تقييد والاغاروز الكهربائي للهلام، كما هو موضح سابقا (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. ترنسفكأيشن من خلايا HEK293 مع rAAV9 البلازميدات

  1. إعداد 1 ميكروغرام / ميكرولتر من الخطية polyethylenimine (PEI) حل. حل مسحوق جزيرة الأمير إدوارد في DH خالية من الذيفان الداخلي 2 O الذي تم تسخينه إلى 70-80 درجة مئوية. Aftercooling وصولا الى RT، تحييد الحل لدرجة الحموضة 7.0 مع 1 M حمض الهيدروكلوريك. تعقيم فلتر (0.22 ميكرون) الحل. قسامة / ميكرولتر جزيرة الأمير إدوارد حل الأوراق المالية 1 ميكروغرام (1400 ميكرولتر / أنبوب) وتخزين solutأيون في -20 درجة مئوية.
  2. خلايا HEK293 الثقافة في Dulbecco لتعديل النسر متوسطة (DMEM) مع 10٪ مصل بقري جنيني (FBS) و 1٪ البنسلين / الستربتومايسين. ثقافة الخلايا في الحاضنة 37 درجة مئوية مع ثاني أكسيد الكربون 5 ± 0.5٪ (CO 2).
  3. في اليوم 0، لوحة خلايا HEK293 في عشرة أطباق 150 ملم 18-20 ساعة قبل ترنسفكأيشن من خلال تقسيم> خلايا متكدسة 90٪ في التخفيف 1: 2.
    ملاحظة: في يوم 1، يجب أن الخلايا تصل إلى 90٪ التقاء.
  4. في يوم 1، transfect خلايا HEK293 مع البلازميد rAAV9 (على سبيل المثال، rAAV9.cTNT :: GFP أو rAAV6.U6 :: shRNA يبني)، الإعلان، ومساعد البلازميد، والبلازميد AAV-النائب / كاب باستخدام جزيرة الأمير إدوارد 25،26،29.
    1. لمدة 10 أطباق من الخلايا في 90٪ التقاء، خلط 70 ميكروغرام من AAV-النائب / كاب البلازميد، 70 ميكروغرام الجبهة الوطنية rAAV9 البلازميد، و 200 ميكروغرام من الإعلان، ومساعد البلازميد في أنبوب الطرد المركزي 50 مل.
    2. إذا كانت الخلايا أقل متموجة، وضبط كمية الحمض النووي نسبيا. على سبيل المثال، إذا كانت الخلايا في 75٪ متموجة، والحد منكمية الحمض النووي نسبيا (75/90 من المبلغ الموضح في الخطوة 2.4.1): خلط 70 × 75/90 = 58.3 ميكروغرام من AAV-النائب / كاب البلازميد، 70 × 75/90 = 58.3 ميكروغرام من rAAV9 البلازميد، و 200 س 75/90 = 166.7 ميكروغرام من الإعلان، ومساعد البلازميد في أنبوب الطرد المركزي 50 مل.
    3. إضافة 49 مل من RT DMEM (بدون FBS) في أنبوب 50 مل وتخلط جيدا.
    4. إضافة 1360 ميكرولتر من حل جزيرة الأمير إدوارد لجعل جزيرة الأمير إدوارد: نسبة الحمض النووي (ت / ث) تكون 4: 1. اخلط جيدا. في احتضان RT ل15-30 دقيقة.
    5. إضافة 5 مل من الخليط المعد في الخطوة 2.4.4 إلى كل طبق 150 ملم (50 مل من الخليط لمدة عشرة أطباق 150 ملم).
  5. ثقافة الخلايا في الحاضنة 37 درجة مئوية مع 5 ± 0.5٪ CO 2 ل60-72 ساعة.

3. حصاد Transfected HEK293 الخلايا وتنقية rAAV9 المتجهات

  1. حصاد الخلايا 60-72 ساعة بعد ترنسفكأيشن. طرد ووقف الخلايا في أطباق من قبل pipetting صعودا وهبوطا مع مستنبت. نقل عن تعليق خلية لعقيمةأنابيب 50 مل.
  2. الطرد المركزي الخلايا في 500 x ج لمدة 5 دقائق. Resuspend وبيليه الخلية مع 5 مل من برنامج تلفزيوني في كل أنبوب والجمع بين كل تعليق الخلية في أنبوب واحد 50 مل.
  3. الطرد المركزي الخلايا في 500 x ج لمدة 5 دقائق. تجاهل طاف. في هذه الخطوة، وتخزين بيليه خلية في -80 درجة مئوية أو مباشرة تنقية AAV من بيليه، كما هو موضح في الخطوات 3،4-3،15.
  4. إعداد العازلة تحلل: 150 مم كلوريد الصوديوم، و 20 ملي تريس، حمض الهيدروكلوريك، ودرجة الحموضة 8.0. تعقيم فلتر (0.22 ميكرون). تخزين المخزن المؤقت في 4 درجات مئوية.
  5. Resuspend وبيليه مع 10 مل من تحلل العازلة.
  6. تجميد المحللة في -80 درجة مئوية أو في حمام الثلج / الايثانول الجاف، ثم ذوبان أنه عند 37 درجة مئوية. دوامة لمدة 1 دقيقة. تجميد وذوبان الجليد في المحللة 3 مرات.
  7. إضافة MgCl 2 حل لالمحللة إذابة (جعل تركيز النهائي من MgCl 2 في المحللة يكون 1 ملم). إضافة نوكلياز إلى التركيز النهائي من 250 U / مل. احتضان عند 37 درجة مئوية لمدة 15 دقيقة إلى حل DNA / البروتين aggregation.
    ملاحظة: إذا كان تجميع الحمض النووي / البروتين لا يحصل المنحل بعد نوكلياز أو نوكلياز داخلية العلاج، dounce التجانس لست] 20 مرة.
  8. الطرد المركزي العينة في 4800 x ج لمدة 20 دقيقة على 4 درجات مئوية. جمع طاف.
  9. وفي الوقت نفسه، وإعداد حل Iodixanol التدرج:
    1. إعداد 17٪ من الحل التدرج عن طريق خلط 5 مل من 10X برنامج تلفزيوني، 0.05 مل من 1 M MgCl 0.125 مل من 1 M بوكل، 10 مل من 5 M كلوريد الصوديوم، و 12.5 مل ofdensity المتوسطة الانحدار. ضبط الحجم الإجمالي إلى 50 مل باستخدام H 2 O.
    2. إعداد حل 25٪ عن طريق خلط 5 مل من 10X برنامج تلفزيوني، 0.05 مل من 1 M MgCl 0.125 مل من 1 M بوكل، 20 مل من كثافة متوسطة الانحدار، و 0.2 مل من 0.5٪ (ث / ت) الفينول الأحمر. ضبط الحجم الإجمالي إلى 50 مل باستخدام H 2 O.
    3. إعداد حل 40٪ عن طريق خلط 5 مل من 10X برنامج تلفزيوني، 0.05 مل من 1 M MgCl 0.125 مل من 1 M بوكل، و 33.3 مل من التدرج الكثافة المتوسطة. ضبط الحجم الإجمالي إلى 50 مل باستخدامH 2 O.
    4. إعداد حل 60٪ عن طريق خلط 0.05 مل من 1 M MgCl 0.125 مل من 1 M بوكل، 50 مل من كثافة متوسطة الانحدار، و 0.1 مل من 0.5٪ (ث / ت) الفينول الأحمر.
  10. مع الإبر والمحاقن، تحميل حل التدرج Iodixanol في أنبوب البولي بروبلين في حدود 5 مل من 17٪، 5 مل من 25٪، 5 مل من 40٪ و 5 مل من 60٪، بدءا من القاع. تحميل جميع المحللة التي تم الحصول عليها من الخطوة 3.8 (14-16 مل) على رأس التدرج. التدرج، المدرجة من أسفل إلى أعلى، 60٪، 40٪، 25٪، 17٪، وطبقة المحللة. ملء الأنبوب مع تحلل العازلة وتغطية ذلك مع الفلين.
  11. أجهزة الطرد المركزي في 185000 x ج لمدة 90 دقيقة في 16 درجة مئوية.
  12. حصاد جزء الفيروسي (40٪ طبقة) مع حقنة. ادخال الإبرة (21 مقياس) في تقاطع ما بين 40٪ و 60٪ كسور، فقط الشفط طبقة 40٪.
    ملاحظة: تجنب الشفط أي طبقة 25٪.
  13. خلط جزء الفيروسي مع تعقيمها البولي أوكسي إتيلين-polyoxyproحل كتلة pylene البوليمرات برنامج تلفزيوني (10٪ البولي أوكسي إتيلين-polyoxypropylene كتلة كوبوليمر الأوراق المالية 1: 10،000 المخفف في برنامج تلفزيوني) تصل إلى الحجم الكلي لل15 مل. تحميل الخليط في أنبوب فلتر (قطع ميغاواط = 100 دينار كويتي). أجهزة الطرد المركزي في 2000 x ج لمدة 30 دقيقة على 4 درجات مئوية.
  14. تجاهل الحل في القاع. إعادة ملء الأنبوب فلتر مع كتلة البولي أوكسي إتيلين-polyoxypropylene البوليمرات حل PBS إلى إجمالي حجم 15 مل. أجهزة الطرد المركزي في 2000 x ج لمدة 20 دقيقة على 4 درجات مئوية. كرر هذه الخطوة مرتين أخريين. جمع الفيروس rAAV9 تنقيته (الكسر فوق فلتر).
  15. نقل rAAV9 تنقيته في الأنبوب فلتر لأنابيب 1.7 مل. قسامة rAAV9 تنقيته (100-400 ميكرولتر / أنبوب، وهذا يتوقف على حجم وعيار من AAV) وتخزين الفيروس في -80 درجة مئوية.
    ملاحظة: تجنب تكرار تجميد يذوب.

4. قياس عيار من rAAV9

  1. إعداد عينات من الحمض النووي القياسية.
    1. تصميم PCR محددة وفعالةالاشعال لناقلات rAAV9 وتحسين حالة PCR.
      ملاحظة: الاشعال المستخدمة في هذه الدراسة هي "إلى الأمام: TCGGGATAAAAGCAGTCTGG. عكسي: TCGGACGGAGATACGTGAGT". تم إجراء تفاعل PCR مع الشروط التالية: تغيير طبيعة الأولي في 95 درجة مئوية لمدة 3 دقائق. 35 دورات من 95 درجة مئوية لمدة 20 ثانية، 60 درجة مئوية لمدة 15 ثانية، و 72 درجة مئوية لمدة 10 ثانية؛ والتمديد النهائي عند 72 درجة مئوية لمدة 10 دقيقة. ومع ذلك، الاشعال الأمثل وشروط الاسترداد هي البلازميد محددة، كما تتابع أقحم في ناقلات rAAV9 قد تؤثر على خصوصية وكفاءة PCR 31.
    2. نفذ تفاعل PCR للشروط الموضحة في الخطوة 4.1.1. تنقية المنتج PCR مع مجموعة استخراج الهلام.
    3. قياس تركيز الحمض النووي تنقيته باستخدام مقياس الطيف الضوئي. حساب تركيز بأعداد الجزيئية الحمض النووي على أساس الوزن الجزيئي / طول المنتج PCR.
      1. حساب تركيز الجزيئي باستخدام المعادلة التالية: موتركيز الجزيئية (جزيئات الحمض النووي أو شظايا / مل) = 6.23 × 10 23 مول -1 س كون. × 10 -6 / MW. ملاحظة: (6.23 × 10 23 مول -1 هو عدد Avagadro؛ وتركيز كون: الحمض النووي في ميكروغرام / مل. ميغاواط: الوزن الجزيئي في غرام / مول). على سبيل المثال، إذا كان تركيز الحصول عليها من المنتج PCR هو 100 ميكروغرام / مل وطوله 200 سنة مضت، والوزن الجزيئي من الحمض النووي المزدوج تقطعت بهم السبل هو 2 × 200 × 310 = 124،000 (متوسط ​​الوزن الجزيئي للكل النوكليوتيدات في الحمض النووي المفرد الذين تقطعت بهم السبل حوالي 310 جم / مول). التركيز الجزيئي (جزيئات الحمض النووي / مل) = 6.23 X 10 23 مول -1 × 100 ميكروغرام / مل × 10 -6 / 124000 جم / مول = 5.18 × 10 14 DNA الجزيئات / مل.
      2. تنفيذ سلسلة تخفيف جزء الحمض النووي، وإعداد العينات القياسية، مع تركيز 10 13 جزيئات / مل و 10 و 12 جزيئات / مل، 10 11 جزيئات / مل، 10 10 جزيئات / مل، 10 9 جزيئات / مل، 10 7 جزيئات / مل. استخدام 1 ميكرولتر من حل لكل عينة القياسية لالكمي PCR (QPCR، في خطوة 4.6).
  2. مزيج 5 ميكرولتر من حل rAAV9 النقي مع 5 ميكرولتر من 10X العازلة الدناز، 1 ميكرولتر من الدناز (10،000 U / مل)، و 39 ميكرولتر من ده 2 O. يجب أن يكون الحجم الكلي 50 ميكرولتر.
  3. احتضان القارورة عند 37 درجة مئوية لمدة 30 دقيقة لإزالة المتبقي غير المعبأة DNA البلازميد.
  4. إبطال نشاط الدناز في درجة حرارة 95 درجة مئوية لمدة 10 دقيقة. تهدئة الحل، إضافة 44 ميكرولتر من H 2 O و 5 ميكرولتر من 10X العازلة الدناز، و 1 ميكرولتر من الأسهم بروتين كاف (10 ملغ / مل).
  5. احتضان الحل عند 50 درجة مئوية لمدة 2 ساعة. وقف رد فعل وإبطال نشاط بروتين كاف في درجة حرارة 95 درجة مئوية لمدة 10 دقيقة.
  6. استخدام 1 ميكرولتر من العينة للفحص PCR الكمي (QPCR). حساب عيار.
    1. تشغيل الكمي PCR (QPCR) مع الاشعال مصممة في الخطوة 4.1.1 باستخدام عينات الابام خطوة 4.1.4 (عينات قياسية) ومن الخطوة 4.5 (العينات المراد قياسها).
      1. لكل رد فعل، مزيج 10 ميكرولتر من مزيج الرئيسي الأخضر 2X (التي تحتوي على طق البلمرة، مزيج dNTP، العازلة، MgCl وصبغ الأخضر)، و 0.5 ميكرولتر من التمهيدي إلى الأمام (5 ميكرومتر)، و 0.5 ميكرولتر من التمهيدي العكسي (5 ميكرومتر)، 8 ميكرولتر من H 2 O، و 1 ميكرولتر من العينة المراد قياسها. أداء QPCR فقا للشروط التالية: عقد العينات عند 50 درجة مئوية لمدة 2 دقيقة و 95 درجة مئوية لمدة 10 دقيقة. أداء 40 دورة في 95 درجة مئوية لمدة 15 ثانية، وعند 60 درجة مئوية لمدة 1 دقيقة. للمرحلة الذوبان، واحتضان العينات في درجة حرارة 95 درجة مئوية لمدة 30 ثانية و 60 درجة مئوية لمدة 15 ثانية. توليد المنحنى القياسي استنادا إلى أرقام C T من العينات القياسية (الشكل 3).
    2. حساب تركيز الجزيئي / عيار العينة AAV ضد المنحنى القياسي. وrAAV9 لديها جينوم الحمض النووي واحد حبلا، وبالتالي فإن التركيز الجزيئي تكون 2 أضعاف أعلى منالقيمة المحسوبة (السلطة 2X (10، ص)، الشكل 3B). وبالإضافة إلى ذلك، فإن عيار من rAAV9 تنقيته يكون 20 أضعاف أعلى مما تم الحصول عليها من الحساب بسبب التخفيف 1:20 من الفيروس في ردود فعل الدناز وبروتين كاف (5 ميكرولتر في 100 مجموع ميكرولتر).

5. حقن rAAV9 في الفئران حديثي الولادة وفحوصات التعبير الجيني في القلب

  1. إعداد حلول العمل rAAV9 في البولي أوكسي إتيلين-polyoxypropylene كوبوليمر كتلة الحل برنامج تلفزيوني. جعل الأسهم فيروس مع التتر من 1-7 × 10 12 الجسيمات / مل.
    ملاحظة: تسليم 50-70 ميكرولتر من محلول rAAV9 في كل ما بعد الولادة اليوم 0،5-1،5 الماوس عن طريق الحقن تحت الجلد. لتحقيق overexpression الجينات كفاءة أو ضربة قاضية، فمن المستحسن لإجراء اختبار تجريبي لكل دراسة لتحسين كمية AAV حقن. استخدام نفس الكمية من rAAV9.cTNT :: لوك أو ضوابط rAAV9.U6 :: التدافع للحصول على كل دراسة للحد من التحيز.
    ملاحظة: استخدمنا 1-1.5× 10 11 الجسيمات / الجرو ل overexpression و2،5-5 × 10 11 الجسيمات / الجرو لضربة قاضية في يوم ما بعد الولادة 0.5-1.5 ميل م).
  2. علاج الفئران حديثي الولادة مع rAAV9 في P0.5-P2.5 عن طريق الحقن تحت الجلد.
    1. قبل ملء 29G1 / 2، 0.33 س 12.7 ملم الأنسولين المحاقن مع الحل rAAV9. كن حذرا لإزالة فقاعات الهواء.
    2. عقد الجرو-تخدير البرد في يد واحدة مع الإبهام والسبابة. قبل الحقن، انتقد الجلد الخلفي للالجرو بعصا مسحة مشبعة 70٪ ايزوبروبيل للحفاظ على حالة معقمة. إدراج إبرة حقنة تحت الجلد في الأمامي الظهري الحيوان في زاوية من 5 إلى 10 درجة. حقن 50-70 ميكرولتر من محلول rAAV9 باستخدام حقنة الأنسولين.
      ملاحظة: rAAV9 يمكن أيضا أن يتم تسليمها إلى الماوس عن طريق داخل الصفاق أو في الوريد حقن 26،27. التعبير كفاءة من الجينات تسليمها في قلب ويمكن الحصول على. ومع ذلك، حقن داخل الصفاقأيون قد يؤدي في بعض الأحيان في التعبير المتسرب في الكبد. بعد الحقن، تم رصد حالة من الجراء كل يوم.
  3. يمكن رصد مستوى التعبير الجيني في القلب مع QPCR، المناعي، أو لطخة غربية (وتظهر نتائج ممثلة في الأرقام 4 و 5) 25،26.
    الموت الرحيم كانت الفئران التي CO 2 تسليمها من مصدر الغاز المضغوط: ملاحظة. تم جمع عينات الأنسجة بعد التأكد من معدل ضربات القلب والحركة والتنفس من الحيوانات قد توقفت. القوارض الوليدية هي مقاومة للثاني 2 القتل الرحيم ووالموت الرحيم بواسطة قطع الرأس باستخدام مقص حاد. هذه الطريقة متسقة مع توصيات الفريق بشأن القتل الرحيم للجمعية الأميركية للطب البيطري.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وترد الاستراتيجيات لبناء rAAV9 من rAAV9.cTNT :: GFP أو البلازميدات rAAV9.U6 :: shRNA في أرقام 1 و 2 على التوالي. كما الأمثلة، تم إنشاء ناقلات rAAV9 إلى بإفراط عن الجين GFP في قلوب الماوس. يحتوي البلازميد ينتج عن ذلك من cTNT :: الكاسيت GFP يحيط بها اثنان بالميدان المواقع (الشكل 1). تم بناء ناقلات rAAV9.U6 :: shRNA ضربة قاضية Trbp مرنا (الشكل 2)

تم إنشاء منحنى القياسية لrAAV9 المعايرة مع البيانات QPCR من الانحدار الخطي. يمثل المتغير y التلاعب في قيمة سجل 10 من الحمض النووي التركيز الجزيئي من كل عينة القياسية، والمتغير x المقابلة يمثل قيمة C تي. سجل 10 (تركيز) القيم (ص) وأرقام C T (خ) تظهر وجود علاقة خطية لطيفة (R 2 = 0.9971) و تتناسب مع المعادلة y = -0.2832x + 14،616 (الشكل 3A). حسبت التتر من عينات rAAV9 على أساس المعادلة الخطية (الشكل 3B). مع الطريقة الموضحة في (الخطوة 4.6.2 والشكل 3B) البروتوكول، عيار عال من ناقلات rAAV9 (50-200 ميكرولتر،> 6 × 10 13 الجسيمات / مل) والتي تم الحصول عليها في دراسة التمثيل.

لمراقبة كفاءة والأنسجة خصوصية ناقلات rAAV9.cTNT، تم علاج الجراء P0.5 مع نفس الكمية (1 × 10 11 الجسيمات / الجرو) من rAAV9.cTNT :: luciferase المراسل (AAV لوك) أو rAAV9.cTNT :: GFP (AAV-GFP) عن طريق الحقن تحت الجلد. بعد أسبوعين من الحقن، تم رصد إشارة GFP في أنسجة مختلفة من الفئران. تم الكشف عن التعبير القوي من GFP في القلب، ولكن ليس في الأجهزة الأخرى (الشكل 4، ن> 3). وهكذا، تم تحقيق التعبير الجيني كفاءة والقلب محددة مع ناقلات rAAV9.cTNT.

jove_content "FO: المحافظة على together.within الصفحات =" 1 "> لمراقبة كفاءة ضربة قاضية وخصوصية النسيج ناقلات rAAV9.U6، عولجت فئران P0.5 مع نفس الكمية (3 × 10 11 الجسيمات / الجرو) من rAAV9 .U6 :: التدافع (AAV-التدافع) أو rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) عن طريق الحقن تحت الجلد. وبعد أسبوعين من الحقن، والتعبير عن Trbp في أنسجة مختلفة من رصدته QPCR (الشكل 5، ن = 3 تم الكشف). وكان انخفاض كبير في مستوى مرنا من Trbp في القلب من قبل rAAV9.U6 :: shTrbp (68٪ downregulation، P = 0.0004452). أسفل تنظيم Trbp أيضا في أنسجة الكبد من rAAV9.U6 :: shTrbp المعالجة الفئران. ومع ذلك، فإن التغيير هو أقل من ذلك بكثير.

شكل 1
الشكل 1: استراتيجيات لبناء rAAV9.cTNT :: GFP البلازميد. (أ) مخطط cTNT :: الكاسيت GFP. TNNT2 الدجاج (rAAV9.cTNT) تليها اثنين من المواقع تقييد فريدة (NheI وKpnI). تم استنساخ GFP إطار القراءة المفتوحة في ناقلات rAAV9.cTNT من تقييد ربط بوساطة الموقع لتوليد البلازميد rAAV9.cTNT :: GFP. (ب) البلازميد rAAV9.cTNT :: GFP يمكن بناؤها من قبل الجمعية جيبسون. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2: استراتيجيات لبناء rAAV9.U6 :: shRNA البلازميد. (أ) مخطط U6 :: ويظهر shRNA كاسيت. هو الدافع وراء التعبير عن shRNA من قبل المروج U6 (الأزرق). (ب) أشرطة rAAV9-U6-shRNA يمكن توليدها عن طريق الصلب وتحتوي على ligating oligos الحمض النوويتسلسل جي shRNA في تقييد ناقلات rAAV9 هضم انزيم إيواء المروج U6. (C) rAAV9.U6 :: يمكن أن تتولد الكاسيت shRNA بعيد المدى PCR وداخل الجزيئي جيبسون القائم على التجميع البناء "سلس". وترد 5 'الذراع، حلقة، و 3 "ذراع shRNA باللون الأخضر والبرتقالي، والأحمر على التوالي. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الرقم 3: حساب من rAAV9 العيار الحجمي. (أ) تم إنشاء منحنى القياسية لrAAV9 المعايرة من قبل العدوان الخطي باستخدام البيانات QPCR. يمثل المتغير ص التلاعب في قيمة سجل 10 من الحمض النووي التركيز الجزيئي من كل عينة القياسية، والمتغير x المقابلةيمثل قيمة C تي. وتحسب (B) التتر من عينات rAAV9 على أساس معادلة خطية من منحنى القياسية. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (4)
الشكل 4: التعبير نمط من rAAV9.cTNT :: GFP في الأنسجة الفئران. وعولج الجراء P0.5 مع نفس الكمية (1 × 10 11 الجسيمات / الجرو) من rAAV9.cTNT :: luciferase المراسل (AAV لوك، سيطرة سلبية) أو rAAV9.cTNT :: GFP (AAV-GFP) عن طريق الحقن تحت الجلد. بعد أسبوعين من الحقن، وكانت تحصد عينات الأنسجة. تم رصد التعبير عن GFP تحت نطاق تشريح الفلورسنت. كلاهما قدم مشرق الميدان ومضان الصور. وقد التجارب تتكرر أكثر من 3 مرات (ن> 3).شريط مقياس = 2.0 مم. SKM، العضلات والهيكل العظمي. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 5
الرقم 5: ضربة قاضية التعبير الجيني مع AAV-shRNA. عولجت فئران P0.5 مع نفس الكمية (3 × 10 11 الجسيمات / الجرو) من rAAV9.U6 :: التدافع (AAV-التدافع) أو rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) عن طريق الحقن تحت الجلد. بعد أسبوعين من الحقن، تم رصد مستويات مرنا من Trbp في الأنسجة المختلفة التي QPCR (ن = 3). وتعرض البيانات مثل متوسط ​​± SEM. قيمة P قطع 0.05. NS، P> 0.05، لم تكن كبيرة. **، P <0.01. SKM، العضلات والهيكل العظمي. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ومن المهم للحد غير مرغوب فيها إعادة التركيب بالميدان خلال بناء البلازميد. قبل إنشاء الفيروس، يجب على المرء دائما مراقبة سلامة بالميدان من البلازميدات AAV باستخدام الهضم تقييد والاغاروز الكهربائي للهلام. فمن المستحيل الحصول على 100٪ البلازميدات سليمة، ولكن نسبة إعادة التركيب ينبغي التقليل قدر الإمكان. أقل من 20٪ مقبولة لنجاح التعبئة والتغليف rAAV9. وتجدر الإشارة، زراعة البكتيريا في درجة حرارة أقل (30 ° C) مع سرعة اهتزاز أقل (180-200 دورة في الدقيقة) يمكن أن تقلل من فرصة من بالميدان إعادة التركيب.

ومن الضروري التأكد من أن الخلايا HEK293 هي صحية للترنسفكأيشن ناجحة وrAAV9 التعبئة والتغليف. "صحية" الخلايا عادة التكاثري للغاية وتنمو بسرعة. ومع ذلك، والانتشار السريع ونمو الخلايا HEK293 لا يضمن بالضرورة كفاءة عالية من rAAV9 التعبئة والتغليف. وبالتالي، فمن المهم أن نبدأ التجارب مع خلايا جديدة. هذامن المستحسن استخدام المنخفض مرور HEK293 الخلايا (<10 الممرات، و passaged خلايا كل 2-3 أيام) لrAAV9 التعبئة والتغليف. من ملاحظة، قد تحتاج إلى تنقية باستخدام إجراءات مختلفة 32 الأنماط المصلية الأخرى من rAAV.

يتم منح المحقق المرونة في توليد البلازميدات rAAV9. إما ربط بوساطة الموقع قيد أو التجمع جيبسون يمكن استخدام 30. لبناء rAAV9.U6 :: shRNA، واستراتيجية داخل الجزيئي القائم على التجميع جيبسون هو وسيلة فعالة (الشكلان 1 و 2). البلازميدات AAV-shRNA متعددة أو مجمعة AAV-shRNAs يمكن بناؤها بسرعة. لبإفراط عن الجينات باستخدام rAAV9، وجود الحد من حجم لمتواليات [كدنا المدرجة. عموما، جزء حجم بين وائح الاتصالات الدولية يجب أن يكون أقل من 5 كيلو بايت 33. حفز إنتئين-الربط البروتين يمكن استخدامها للالتفاف على الحد الأقصى لحجم التعبئة والتغليف من ناقلات rAAV9 34.

نظام الفيروسية الأخرىالصورة، بما في ذلك فيروس الارتجاعي، الفيروسة البطيئة واتش، وأيضا تم تطوير وتمكين التلاعب الجيني مرونة. مقارنة مع هذه الأنواع المختلفة من ناقلات فيروسية، rAAV له مزايا محددة: الكفاءة العالية، خصوصية عالية، وانخفاض معدل التكامل الجيني، الحد الأدنى المناعية، والحد الأدنى المرضية. وهكذا، والهندسة الجينية استنادا rAAV-يبرز بوصفه أداة مثالية لفي الجسم الحي التلاعب الجيني.

وقد أظهرت الدراسات السابقة أن النظام rAAV9 يمكن التعبير كفاءة من الجينات تسليمها في الجسم الحي. مع المروج cTNT (TnnT2 الدجاج)، وتم الحصول على التعبير الجيني القلب محددة (الشكل 4) 25،26. على الرغم من أن المروج U6 نشط بتواجد مطلق في الأنسجة الماوس، وتثبيط الأكثر لفتا للهدف مرنا (Trbp) من خلال rAAV9.U6 :: وحظ shRNA في القلب، ولكن ليس في الأجهزة الأخرى (الشكل 5). الكبد هو الجهاز الأكثر شيوعا transduced من الأنماط المصلية مختلفة منrAAV 35،36. ومع ذلك، فإن فعالية ضربة قاضية (تخفيض 36٪ من مستوى مرنا) في الكبد هي أقل بكثير من تلك التي في القلب (تخفيض 68٪ من مستوى مرنا). وهذا يتفق مع الدراسة السابقة تبين أنه على الرغم من ارتفاع جود الجينوم الفيروسي في الكبد، والتسليم النظامية من shRNA التي كتبها rAAV9 يوفر الجين أكثر كفاءة ضربة قاضية في قلب 35. فمن الممكن أن خلايا الكبد هي أكثر التكاثري من العضلية وهي تخضع بنشاط أكبر انقسام الخلايا بعد تناوله rAAV9 في سن حديثي الولادة، مما يؤدي إلى تخفيف كبير ناقلات الجينوم في أنسجة الكبد. ومع ذلك، فإن هذا يشير أيضا إلى أن النمط المصلي من rAAV9 قد تنبيغ أكثر كفاءة العضلية مقارنة مع أنواع أخرى من الخلايا. كما يتبين من Lovric آخرون، في myocytes متباينة، وقمع للاستجابة الحمض النووي من التلف MRN البروتينات المعقدة. MRN بروتينات معقدة تربط الجينوم AAV وتمنع AAV تنبيغ من خلال إسكات النسخي. وهكذا، فيmissivity إلى التنبيغ AAV يمكن الناجمة عن التمايز النهائي العضلية 36، مما يجعل النظام rAAV9، مقارنة مع ناقلات فيروسية أخرى، ومناسبة جدا للتلاعب الجيني في القلب. لمزيد من تقليل آثار ضربة قاضية غير مرغوب فيها في الأجهزة الأخرى (على سبيل المثال، والكبد)، واحد ويمكن أيضا استخدام القلب محددة shmiR استنادا مير 30A يحركها المروج cTNT لقمع الجينات من الاهتمام في قلب 29. توفر هذه المخطوطة القارئ مع تقنيات محددة للاستفادة على التكنولوجيا rAAV9 في التحقيقات القلب والأوعية الدموية.

Subscription Required. Please recommend JoVE to your librarian.


Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967



  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).
إعداد rAAV9 إلى بإفراط أو ضربة قاضية الجينات في قلوب ماوس
Play Video

Cite this Article

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).More

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter