Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

से Polyketomycin का उपयोग करते हुए एक प्रदर्शन: इसकी biosynthetic जीन क्लस्टर के लिए एक प्राकृतिक उत्पाद से doi: 10.3791/54952 Published: January 13, 2017

Summary

यहाँ हम (ए) एंटीबायोटिक गतिविधि के साथ एक प्राकृतिक उत्पाद की पहचान, (बी) के परिसर की शुद्धि, (सी) ने अपनी जैव संश्लेषण की पहली मॉडल, (डी) जीनोम अनुक्रमण / -mining और की एक विस्तृत प्रोटोकॉल वर्तमान ( ई) biosynthetic जीन क्लस्टर का सत्यापन।

Abstract

Streptomyces उपभेदों उनकी क्षमता विभिन्न bioactivities के साथ अलग अलग यौगिकों की एक बहुत का उत्पादन करने के लिए जाना जाता है। अलग अलग परिस्थितियों में खेती अक्सर नए यौगिकों का उत्पादन होता है। इसलिए, उपभेदों के उत्पादन संस्कृतियों एथिल एसीटेट के साथ निकाले जाते हैं और कच्चे तेल के अर्क एचपीएलसी से विश्लेषण कर रहे हैं। इसके अलावा, अर्क विभिन्न संसाधनों द्वारा उनकी bioactivity के लिए परीक्षण कर रहे हैं। संरचना व्याख्या के लिए ब्याज की यौगिक अलग क्रोमैटोग्राफी विधियों के संयोजन के द्वारा शुद्ध होता है।

जीनोम अनुक्रमण जीनोम खनन के साथ मिलकर विभिन्न कंप्यूटर प्रोग्राम का उपयोग कर एक प्राकृतिक उत्पाद biosynthetic जीन क्लस्टर की पहचान के लिए अनुमति देता है। इस बात की पुष्टि करें कि सही जीन क्लस्टर पहचान की गई है, जीन निष्क्रियता प्रयोगों का प्रदर्शन किया जाना है। जिसके परिणामस्वरूप म्यूटेंट विशेष प्राकृतिक उत्पाद के उत्पादन के लिए विश्लेषण कर रहे हैं। एक बार सही जीन क्लस्टर निष्क्रिय कर दिया गया है,तनाव यौगिक का उत्पादन करने में विफल चाहिए।

कार्यप्रवाह जीवाणुरोधी चक्रवृद्धि polyketomycin Streptomyces diastatochromogenes Tü6028 द्वारा उत्पादित के लिए दिखाया गया है। लगभग दस साल पहले, जब जीनोम अनुक्रमण अभी भी बहुत महंगा था, क्लोनिंग और एक जीन क्लस्टर की पहचान के लिए एक बहुत समय लेने वाली प्रक्रिया थी। फास्ट जीनोम जीनोम खनन के साथ संयुक्त अनुक्रमण क्लस्टर पहचान का परीक्षण accelerates और जैव संश्लेषण का पता लगाने के लिए और आनुवंशिक तरीकों से उपन्यास प्राकृतिक उत्पादों उत्पन्न करने के लिए नए तरीके को खोलता है। इस पत्र में वर्णित प्रोटोकॉल एक Streptomyces तनाव या अन्य सूक्ष्मजीव से निकाली गई किसी भी अन्य यौगिक को सौंपा जा सकता है।

Introduction

पौधों और सूक्ष्मजीवों से प्राकृतिक उत्पादों को हमेशा नैदानिक ​​दवा के विकास और अनुसंधान के लिए एक महत्वपूर्ण स्रोत रहा है। पहली एंटीबायोटिक पेनिसिलिन अलेक्जेंडर फ्लेमिंग 1 से एक कवक से 1928 में खोज की थी। आजकल, कई और अधिक प्राकृतिक उत्पादों चिकित्सीय उपचार में किया जाता है।

एक जीनस अलग bioactivities के साथ माध्यमिक चयापचयों के विभिन्न प्रकार के निर्माण की अपनी क्षमता के लिए जाना जाता Streptomyces है। Streptomyces ग्राम पॉजिटिव बैक्टीरिया होते हैं और Actinobacteria के वर्ग और व्यवस्था Actinomycetales के हैं। चिकित्सकीय इस्तेमाल किया एंटीबायोटिक दवाओं के लगभग दो-तिहाई, Actinomycetales से निकाली गई है, मुख्य रूप से Streptomyces, amphotericin 2 की तरह, 3 या 4 टेट्रासाइक्लिन daptomycin। दो नोबेल पुरस्कार Streptomyces एंटीबायोटिक अनुसंधान के क्षेत्र में सम्मानित किया गया है। पहले एक स्ट्रेप्टोमाइसिन की खोज, पहली बार एक के लिए Selman Waksman के पास गयाtibiotic तपेदिक के खिलाफ प्रभावी है। 5 2015 में, शरीर विज्ञान और चिकित्सा में नोबेल पुरस्कार के हिस्से के रूप में, एस avermitilis से avermectin की खोज के साथ ही प्रदान किया गया। Avermectin परजीवी रोगों 6.7 के इलाज के लिए प्रयोग किया जाता है।

ऐसे Streptomyces के रूप में सूक्ष्मजीवों में प्राकृतिक उत्पादों की खोज के लिए परंपरागत दृष्टिकोण आम तौर पर विभिन्न विकास शर्तों के तहत तनाव के खेती के साथ-साथ निकासी और माध्यमिक चयापचयों का विश्लेषण शामिल है। Bioactivity assays (जीवाणुरोधी और विरोधी गतिविधि के लिए जैसे assays) परिसर की गतिविधि का पता लगाने के लिए प्रदर्शन कर रहे हैं। अंत में, ब्याज की चक्रवृद्धि अलग है और रासायनिक संरचना स्पष्ट है।

प्राकृतिक उत्पादों की संरचनाओं अक्सर एकल moieties जो जटिल अणुओं के गठन से बना रहे हैं। वहाँ कुछ है, लेकिन सीमित, प्रमुख biosynthetic रास्ते ब्लॉक के निर्माण के लिए नेतृत्व कर रहे हैंएस, जो प्राकृतिक उत्पादों के biosynthesis के लिए उपयोग किया जाता है। प्रमुख biosynthetic रास्ते polyketide रास्ते, चीनी moieties के लिए अग्रणी terpenoids और alkaloids, रास्ते अमीनो एसिड का उपयोग करने के लिए अग्रणी रास्ते, और रास्ते हैं। प्रत्येक मार्ग विशिष्ट एंजाइमों 8 के एक सेट की विशेषता है। परिसर की संरचना के आधार पर, इन biosynthetic एंजाइमों की भविष्यवाणी की जा सकती है।

आजकल, अगली पीढ़ी के अनुक्रमण और bioinformatic विश्लेषण के साथ संयोजन में एक परिसर की विस्तृत संरचनात्मक विश्लेषण जिम्मेदार biosynthetic जीन क्लस्टर की पहचान करने में मदद कर सकते हैं। क्लस्टर जानकारी आगे प्राकृतिक उत्पाद अनुसंधान के लिए नए तरीके को खोलता है। यह जीन विलोपन या परिवर्तन और अन्य रास्ते से जीन के साथ मिश्रित जैवसंश्लेषण द्वारा प्राकृतिक उत्पाद की उपज, लक्षित यौगिक संशोधन बढ़ाने के लिए heterologous अभिव्यक्ति भी शामिल है।

Polyketomycin की संस्कृति शोरबा से स्वतंत्र रूप से अलग किया गया थादो उपभेदों, Streptomyces सपा। MK277-AF1 9 और Streptomyces diastatochromogenes Tü6028 10। संरचना एनएमआर और एक्स-रे विश्लेषण से स्पष्ट किया गया था। Polyketomycin एक चतुश्चक्रीय decaketid और एक डाइमिथाइल चिरायता एसिड से बना, β-D-amicetose और α एल axenose दो deoxysugar moieties से जुड़ा हुआ है। यह साइटोटोक्सिक और एंटीबायोटिक गतिविधि प्रदर्शित करता है, यहां तक कि इस तरह के मरसा के रूप में 11 ग्राम पॉजिटिव बहुऔषध प्रतिरोधी उपभेदों के खिलाफ।

एस diastatochromogenes Tü6028 के एक जीनोमिक पुस्तकालय cosmid जनित और बहुत साल पहले दिखाई गई। विशिष्ट जीन जांच, 52.2 केबी का एक आकार के साथ polyketomycin जीन क्लस्टर का उपयोग 41 जीन से युक्त, तीव्र काम 12 के कई महीनों के बाद पहचान की थी। हाल ही में, एस diastatochromogenes का एक मसौदा जीनोम अनुक्रम polyketomycin biosynthetic जीन क्लस्टर की तेजी से पहचान करने के लिए अग्रणी प्राप्त हुई थी। इस अवलोकन में, एक विधि IDEN करने के लिए मददएक प्राकृतिक उत्पाद tify और स्पष्ट इसकी biosynthetic जीन क्लस्टर वर्णित किया जाएगा, polyketomycin एक उदाहरण के रूप में इस्तेमाल करते हैं।

यहाँ हम एक कदम है जो Streptomyces diastatochromogenes Tü6028 द्वारा उत्पादित polyketomycin के लिए दिखाया इसकी biosynthetic जीन क्लस्टर के लिए एक प्राकृतिक उत्पाद से नेतृत्व समझाओ। प्रोटोकॉल पहचान और एंटीबायोटिक गुणों के साथ एक प्राकृतिक उत्पाद की शुद्धि शामिल हैं। आगे संरचनात्मक विश्लेषण और biosynthetic जीन क्लस्टर की पहचान के लिए जीनोम खनन नेतृत्व से परिणामों के साथ तुलना। यह प्रक्रिया एक Streptomyces तनाव या किसी अन्य सूक्ष्मजीव से निकाली गई किसी भी अन्य यौगिक के लिए लागू किया जा सकता है।

Protocol

1. एंटीबायोटिक संपत्ति के साथ एक प्राकृतिक उत्पाद की पहचान

  1. विभिन्न परिस्थितियों में एक सूक्ष्मजीव (जैसे समय, तापमान, पीएच, मीडिया) के लिए "OSMAC (एक तनाव-कई यौगिकों) दृष्टिकोण" 13 पैदा करो। एक माध्यम है जिसमें एक यौगिक के उत्पादन में मनाया जाता है का चयन करें।
  2. निम्नलिखित परिस्थितियों में Streptomyces diastatochromogenes Tü6028 खेती
    1. आगे बढ़ें एमएस प्लेटों पर Streptomyces diastatochromogenes Tü6026 तनाव (सोया आटा 20 ग्राम, डी-mannitol 20 ग्राम, 2 MgCl 10 मिमी, 1.5% अगर, नल का पानी 1 एल)। एक सर्पिल के साथ एक Erlenmeyer फ्लास्क में, एक छोटी सी (preculture मध्यम नल का पानी 1 एल, पीएच 7.2 tryptic सोया शोरबा 30 ग्राम) 20 एमएल तरल टीएसबी माध्यम में इस तनाव के बीजाणुओं की पाश टीका लगाना। एक रोटरी प्रकार के बरतन (28 डिग्री सेल्सियस, 180 आरपीएम, 2 दिन) पर कुप्पी हिला।
    2. 100 एमएल हा मध्यम (ग्लूकोज 4 जी, खमीर निकालने 4 जी, माल्ट में मुख्य संस्कृति टीका लगानाpreculture के 2 एमएल के साथ 10 जी, नल का पानी 1 एल, पीएच 7.2) निकाल सकते हैं। संस्कृति 180 rpm पर एक रोटरी प्रकार के बरतन पर 6 दिनों के लिए 28 डिग्री सेल्सियस पर तनाव।
  3. कच्चे तेल निकालने की तैयारी
    1. centrifugation द्वारा हार्वेस्ट कोशिकाओं (10 मिनट, 3000 XG)।
    2. अगले कदम के लिए एक धूआं हुड के तहत कार्बनिक सॉल्वैंट्स संभाल।
    3. फुई परिसर से निकासी के लिए, एसीटोन का एक दोहरा मात्रा में resuspend कोशिकाओं और 30 मिनट, 180 आरपीएम के लिए एक ट्यूब में हिला। वाणिज्यिक फिल्टर पेपर के माध्यम से तरल फिल्टर और 40 डिग्री सेल्सियस और 550 बार में रोटरी बाष्पीकरण द्वारा एसीटोन लुप्त हो जाना। एथिल एसीटेट: 20 एमएल पानी में भंग निकालने (1: 1) और 180 rpm पर 30 मिनट के लिए एक अलग करने कीप में इसे हिला।
    4. संस्कृति के माध्यम से परिसर निकासी के लिए, 1 एम एचसीएल के अलावा द्वारा पीएच 4.0 संस्कृति शोरबा समायोजित करें। 100 एमएल एथिल एसीटेट जोड़ें और 30 मिनट, 180 आरपीएम के लिए एक अलग करने कीप में इसे हिला।
    5. एथिल एसीटेट चरण ले लीजिए और सड़ांध से लुप्त हो जाना 40 डिग्री सेल्सियस और 240 बार में Ary वाष्पीकरण।
  4. एचपीएलसी द्वारा कच्चे तेल निकालने का विश्लेषण
    1. , 1 एमएल MeOH में अर्क भंग एक 0.45 माइक्रोन रोमकूप आकार फिल्टर के माध्यम से उन्हें फिल्टर और उच्च प्रदर्शन तरल क्रोमैटोग्राफी (एचपीएलसी) 14 चला रहे हैं।
    2. Polyketomycin के मामले में, एक C18 precolumn (4.6 x 20 मिमी 2) और एक C18 स्तंभ (4.6 x 100 मिमी 2) के साथ एचपीएलसी प्रणाली से लैस। एच में 20% से 95% को लेकर acetonitrile + 0.5% एसिटिक एसिड की एक रेखीय ढाल का प्रयोग करें 2 ओ + 0.5% एसिटिक एसिड (प्रवाह की दर: 0.5 एमएल मिनट -1)।
      नोट: Polyketomycin 25.9 मिनट की एक अवधारण समय है (चित्रा 1 ए देखें)। यूवी / विज़ स्पेक्ट्रम 242 एनएम, 282 एनएम, 446 एनएम और न्यूनतम 262 एनएम और 359 एनएम पर Maxima है (देखें चित्रा 1 बी)। नकारात्मक ढंग से 863.2 [महाराष्ट्र] एक मास में - (देखें चित्र 1 सी) detectable है।

"Src: =" / files / ftp_upload / 54952 / 54952fig1.jpg "/>
चित्रा 1: Polyketomycin की नियंत्रण रेखा / एमएस विश्लेषण। (ए) एचपीएलसी वर्णलेख कच्चे तेल निकालने के 6 दिन के लिए Streptomyces diastatochromogenes Tü6028 की खेती के बाद (λ = 430 एनएम)। Polyketomycin के 25.9 मिनट (बी) यूवी एक अवधारण समय Polyketomycin का / की तुलना स्पेक्ट्रा है। (सी) मास नकारात्मक ढंग में Polyketomycin के स्पेक्ट्रा। मी / z 863.2 के साथ मुख्य शिखर [महाराष्ट्र] -। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

  1. एंटीबायोटिक गतिविधि की पहचान डिस्क प्रसार परख का उपयोग
    1. ग्राम पॉजिटिव बैक्टीरिया बेसिलस subtilis तरह परीक्षण उपभेदों टीका लगाना (पौंड माध्यम में; पौंड 20 ग्राम, पानी के नल 1 एल, 7.4 पीएच) और अन्य Streptomyces उपभेदों (टीएसबी माध्यम में; tryptic सोया शोरबा 30 ग्राम, पानी के नल 1 एल, पीएच 7.2), ग्राम नकारात्मक बैक्टीरिया कोलाई (लेग माध्यम में) और इस तरह के माध्यम के रूप में YPD फंगल उपभेदों (मीडिया में, खमीर निकालने 10 ग्राम, 20 ग्राम peptone, ग्लूकोज 20 ग्राम, पानी के नल 1 एल, 7.4 पीएच)। परीक्षण तनाव preculture के 100 μL ले लो और उन्हें संबंधित अगर प्लेट पर फैल गया।
    2. बाँझ कागज डिस्क पर मेथनॉल (वैकल्पिक रूप से पानी या DMSO) और पिपेट 20-50 μL के 500 μL में कच्चे तेल निकालने या शुद्ध यौगिक भंग। काम बेंच के तहत 30 मिनट के लिए सूखी कागज डिस्क और उन्हें परीक्षा संस्कृतियों के साथ प्लेटों पर डाल दिया। एक नकारात्मक नियंत्रण (विलायक) और एक सकारात्मक नियंत्रण तैयार (एंटीबायोटिक, जैसे apramycin [1 मिलीग्राम])।
    3. पर्याप्त शर्तों के तहत प्लेटें सेते हैं जब तक परीक्षण उपभेदों दिख बड़े हो रहे हैं और निषेध क्षेत्र का निर्धारण, अगर स्पष्ट। ई कोलाई और बेसिलस सपा सेते हैं। 16 घंटे के लिए 37 डिग्री सेल्सियस, Streptomyces सपा पर। 2-4 दिनों के लिए 28 डिग्री सेल्सियस पर, फंगल तनाव (मुख्य रूप से सटीक परीक्षण तनाव पर निर्भर) एकटी 2 दिनों के लिए 30 डिग्री सेल्सियस)।

2. बड़े स्केल निष्कर्षण, शोधन और संरचना यौगिक के व्याख्या

  1. खेती 5 एल हा माध्यम में एस diastatochromogenes (ग्लूकोज 4 जी, खमीर निकालने 4 जी, माल्ट निकालने 10 ग्राम, पानी 1 एल, पीएच 7.2 नल)। 30 x 500 एमएल Erlenmeyer 150 एमएल हा मध्यम युक्त बोतल में preculture के 2 एमएल टीका लगाना। 180 rpm पर एक रोटरी प्रकार के बरतन पर 6 दिनों के लिए 28 डिग्री सेल्सियस पर तनाव को सेते हैं।
  2. centrifugation द्वारा हार्वेस्ट कोशिकाओं (10 मिनट, 15,000 XG, आरटी) और निकालने यौगिकों एथिल एसीटेट का उपयोग कर (खंड 1.3 देखें)।

चित्र 2
चित्रा 2: संरचना व्याख्या के लिए कार्यप्रवाह। प्रक्रिया (1) तनाव की खेती, (2) निकासी, (3) ठोस चरण निष्कर्षण (एसपीई), पतली परत क्रोमैटोग्राफी (टीएलसी), प्रारंभिक उच्च प्रदर्शन तरल क्रोमैटोग्राफी (एचपीएलसी), आकार द्वारा शुद्धि शामिलअपवर्जन क्रोमैटोग्राफी (एसईसी) और (4) संरचना व्याख्या बड़े पैमाने पर विश्लेषण (एमएस), परमाणु चुंबकीय अनुनाद (एनएमआर) और एक्स-रे मापन द्वारा। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

  1. Polyketomycin की शुद्धि
    नोट: शुद्धि और संरचना व्याख्या करने की प्रक्रिया चित्रा 2 में दिखाया गया है।
    1. एच 2 ओ में 30% से 100% MeOH को लेकर एक 10% -stepwise MeOH ढाल, हर हालत के लिए 100 एमएल का उपयोग कर एक C18 ठोस चरण निष्कर्षण (एसपीई) स्तंभ से कच्चे तेल निकालने fractionate।
    2. (: 1 से 7) के रूप में क्षालन प्रणाली प्रारंभिक पतली परत क्रोमैटोग्राफी (टीएलसी) 15 सीएच का उपयोग कर 2 सीएल 2 / MeOH से आगे यौगिक युक्त अंश शुद्ध।
    3. प्रारंभिक एचपीएलसी 16 से यौगिक शुद्ध। और एक, एक C18 precolumn (9.4 x 20 मिमी 5 माइक्रोन) के साथ एचपीएलसी प्रणाली से लैसमुख्य स्तंभ (5 माइक्रोन; 9.4 x 150 मिमी)। 2 ओ + 0.5% एसिटिक एसिड एच में 20% से 95% को लेकर acetonitrile + 0.5% एसिटिक एसिड के एक ढाल का उपयोग करें (के प्रवाह दर: 2.0 एमएल / मिनट)।
    4. सॉल्वैंट्स और अन्य छोटे अशुद्धियों को दूर करने के लिए, MeOH 17 में एक स्तंभ का उपयोग आकार अपवर्जन क्रोमैटोग्राफी द्वारा एक अंतिम शुद्धि कदम प्रदर्शन करते हैं। अंतिम शुद्ध यौगिक लीजिए और 40 डिग्री सेल्सियस और 240 बार में रोटरी वाष्पीकरण द्वारा MeOH लुप्त हो जाना।
  2. संरचना व्याख्या
    1. DMSO- डी 6 के 600-700 μL में शुद्ध यौगिक (अधिक से अधिक 2 मिलीग्राम) (मशीन पर निर्भर), रिकॉर्ड -1 डी एनएमआर (1 एच 13 सी) और 2 डी एनएमआर (HSQC, HMBC, 1 एच 1 एच भंग COSY) एक एनएमआर स्पेक्ट्रोमीटर 18 पर स्पेक्ट्रा। Δ मूल्यों (पीपीएम) में रासायनिक पारियों एक्सप्रेस DMSO- डी 6 का उपयोग करके।
    2. उच्च संकल्प लिए बड़े पैमाने पर स्पेक्ट्रम (HRESI एमएस) एक उच्च संकल्प का प्रयोग कर polyketomycin के 19 रिकॉर्डमास स्पेक्ट्रोमीटर।
    3. एनएमआर और एमएस डेटा विश्लेषण 10 के परिणामों की व्याख्या द्वारा संरचना को स्पष्ट।

3. प्रस्ताव न्यू पृथक यौगिक की biosynthetic मॉडल

  1. पृथक यौगिक की संरचना का विश्लेषण और एंजाइमों, जो अपनी biosynthesis में शामिल किया जा सकता है की भविष्यवाणी। उन्हें polyketide (प्रकार मैं, द्वितीय या तृतीय), गैर ribosomal पेप्टाइड संश्लेषण, lantipeptide, terpenoid, या चीनी चयापचय मार्ग से 8 निरुपित।
  2. उदाहरण polyketomycin
    1. चतुश्चक्रीय आधा भाग, दो monosaccharides और डाइमिथाइल चिरायता एसिड: स्पष्ट एकल moieties में संरचना प्रतिभाग।
    2. बाहर का पता लगाएं जहां moieties से प्राप्त किया जा सकता है: चतुश्चक्रीय आधा भाग एक polyketide synthase प्रकार से प्राप्त किया जा सकता द्वितीय और डाइमिथाइल चिरायता एसिड आधा भाग चलने polyketide synthase प्रकार I. द्वारा प्राप्त किया जा सकता है दो चीनी moieties, जो 6-deoxysugars हैं , synthesi किया जा सकता हैजेड एक जैव संश्लेषण के दौरान तेदेपा ग्लूकोज-4,6-dehydratase और दो glycosyltransferases से शायद संलग्न शामिल ग्लूकोज से (चित्रा 3 देखें) 8।
    3. क्लस्टर में ख्यात जीन का अनुमान है। एंजाइम जो इकाइयों को जोड़ने में, साथ ही संशोधित करने और अणु सिलाई में, एकल moieties के संश्लेषण में शामिल कर रहे हैं के बारे में सोचो। Polyketomycin की biosynthetic जीन क्लस्टर सबसे शायद (भरनेवाला इकाइयों को जोड़ने के लिए इसलिए कम से कम एक एसीपी, के एस α und केएस β) एक polyketide synthase प्रकार द्वितीय एन्कोडिंग जीन, जिसमें एक चलने का polyketide synthase प्रकार मैं (कम से कम एसीपी, एटी, के एस), एक तेदेपा ग्लूकोज-4,6-dehydratase (कदम के लिए आवश्यक: ग्लूकोज → deoxyglucose) और दो glycosyltransferases (aglycone के लिए दो चीनी monomers संलग्न) 8।

चित्र तीन
चित्रा 3: Polyketomycin divid की संरचनाएकल बिल्डिंग ब्लॉक्स में एड। Polyketomycin, एक चतुश्चक्रीय decaketid (पीकेएस प्रकार द्वितीय) और एक डाइमिथाइल चिरायता एसिड (चलने का पीकेएस प्रकार मैं) से बना है दो deoxysugar moieties द्वारा β-D-amicetose और α एल axenose (एनडीपी ग्लूकोज-4,6- जुड़े dehydratase और दो glycosyltransferase आवश्यक)। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

4. जीनोम अनुक्रमण / खनन

  1. अगली पीढ़ी के अनुक्रमण
    1. Illumina, 454 pyrosequencing या ठोस 20 जैसे अगली पीढ़ी के अनुक्रमण प्रौद्योगिकियों के द्वारा जीनोमिक डीएनए अनुक्रम। एकल संरेखित एक संदर्भ अनुक्रम को पढ़ता है या इकट्ठा नए सिरे से।
      नोट: एस diastatochromogenes Tü6028 के जीनोम बर्लिन में विश्वविद्यालय में जैव प्रौद्योगिकी के लिए केंद्र (CeBiTec) में अनुक्रम था। सभी एक मसौदा जीनोम के लिए इकट्ठे हुए थे पढ़ता7.9 MB की।
  2. जीनोम खनन
    1. खुला पढ़ने फ्रेम (ORFs) उदाहरण के एन सी बी आई prokaryotic जीनोम एनोटेशन पाइपलाइन 21,22 के लिए, RAST 23,24,25, Prokka (रैपिड प्रोकार्योटिक जीनोम एनोटेशन) 26 या 27 GenDB (सब-सिस्टम प्रौद्योगिकी का उपयोग तेजी से एनोटेशन) के उपयोग द्वारा लिए खोजें। इन कार्यक्रमों में भी उनके कार्यों का प्रस्ताव। एस के विश्लेषण diastatochromogenes Tü6028 मसौदा जीनोम अनुक्रम 7,000 से अधिक ORFs की पहचान करने के लिए नेतृत्व किया।
    2. भागो विशिष्ट ब्लास्ट (बेसिक स्थानीय संरेखण खोज उपकरण) विश्लेषण अन्य इसी तरह के जीन और उत्प्रेरक डोमेन 28,29,30 के साथ संरेखण की तरह और अधिक जानकारी प्राप्त करने के लिए।
    3. AntiSMASH 31,32,33, 34 और NaPDoS NRPSpredictor 35,36 तरह माध्यमिक मेटाबोलाइट जीन क्लस्टर चलाए जा रहे कार्यक्रमों की पहचान के लिए। Streptomyces diastatochromogenes antiSMASH 31,32,33 पहचान का मसौदा जीनोम में22 जीन समूहों fied।
    4. उनकी एंजाइमी मार्ग (ओं) के लिए ख्यात जीन समूहों (polyketide synthase (प्रकार मैं, द्वितीय या तृतीय), गैर ribosomal पेप्टाइड synthetase, lanthipeptide, terpenoid, चीनी चयापचय ...) का विश्लेषण। क्लस्टर (s) जीन जो परिसर के संश्लेषण में शामिल किया जा सकता युक्त लिए खोज (धारा 3 देखें)। एस diastatochromogenes में एनोटेट क्लस्टर 2 polyketide synthase प्रकार द्वितीय जीन, तीन polyketide synthase प्रकार मैं जीन, एक तेदेपा ग्लूकोज-4,6-dehydratase जीन और दो glycosyltransferase जीन (चित्रा 4 देखें) शामिल हैं।
    5. क्लस्टर के भीतर एकल जीन पर ध्यान दें। पीकेएस प्रकार मैं और NRPS acyltransferases और adenylation डोमेन की विशिष्टता, और इस प्रकार एकल भरनेवाला इकाइयों के समावेश के लिए, भविष्यवाणी की जा सकती है। इसके अलावा अणु के साथ शामिल भरनेवाला की इकाई के आदेश की तुलना करें। antiSMASH 31,32,33 भी MIBiG डेटाबेस 37 के लिंक के साथ, पहले से ही जाना जाता यौगिकों के समान समूहों से पता चलता है। इन अन्य यौगिकों के साथ परिसर की संरचना की तुलना करें और समानता के लिए जाँच करें।

चित्रा 4
चित्रा 4: एस में Polyketomycin biosynthetic जीन क्लस्टर और अन्य समूहों का अवलोकन की antiSMASH आउटपुट Tü6028 diastatochromogenes। (ए) एस के जीनोम में भविष्यवाणी की biosynthetic जीन समूहों का अवलोकन Tü6028 diastatochromogenes; (बी) क्लस्टर 2 Polyketomycin biosynthetic जीन लक्षित जीन के साथ क्लस्टर। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

5. biosynthetic जीन क्लस्टर का सत्यापन

  1. परिसर के biosynthesis के लिए स्पष्ट और महत्वपूर्ण (आवश्यक) कार्यों के साथ एक जीन की खोज करें। polyketo के सत्यापन के लिएmycin जीन क्लस्टर जीन pokPI, पीकेएस प्रकार द्वितीय से ketosynthase α के लिए कोडिंग, चयनित और फ्रेम -deletion की एक बाहर (देखें चित्र 5 ब) द्वारा निष्क्रिय किया गया था। वैकल्पिक रूप से, एक आंतरिक टुकड़ा क्लोनिंग द्वारा जीन में व्यवधान डाला (देखें चित्र 5C)।

चित्रा 5
चित्रा 5: एकल विदेशी द्वारा एक जीन क्लस्टर का सत्यापन। (ए) मूल निवासी जीन एक कार्यात्मक प्रोटीन का अनुवाद करने के लिए होता; (बी) के एक आत्मघाती वेक्टर में आंतरिक विलोपन के साथ जीन की क्लोनिंग एक भी विदेशी लक्षित जीन और गैर कार्यात्मक प्रोटीन के बाद के अनुवाद में एक फ्रेम पारी में जिसके परिणामस्वरूप की ओर जाता है; (सी) एक आत्मघाती वेक्टर में जीन की एक आंतरिक टुकड़ा की क्लोनिंग जीन और एक गैर कार्यात्मक प्रोटीन के बाद के अनुवाद का एक ट्रंकेशन की ओर जाता है। Orit: टी की उत्पत्तिransfer; एंटीबायोटिक आर: एंटीबायोटिक प्रतिरोध। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

  1. एकल विदेशी निर्माण की क्लोनिंग
    1. एक टुकड़ा पीसीआर 38 से pokPI युक्त प्राइमरों pokPI_for और pokPI_rev के साथ बढ़ाना।
    2. आत्महत्या वेक्टर में क्लोन पीसीआर उत्पाद pKC1132 39 (आर apramycin [50 मिलीग्राम / एमएल])। आत्महत्या वेक्टर Streptomyces तनाव में दोहराने में सक्षम नहीं है और इस तरह मुताबिक़ पुनर्संयोजन द्वारा लक्षित जीन में एकीकृत करने के apramycin प्रतिरोध प्रदान करने के लिए है। गर्मी झटका परिवर्तन 40 से मेजबान क्लोनिंग ई कोलाई में वेक्टर स्थानांतरण।
    3. क्षारीय सेल 41 से वेक्टर अलग।
    4. एक भी कटर प्रतिबंध एंजाइम है कि टुकड़ा के भीतर कटौती के साथ वेक्टर डीएनए डाइजेस्ट। pokPI जनरलई के साथ पचा गया था एंजाइम Kpn I.
    5. समझो बड़े डीएनए पोलीमरेज़ मैं (Klenow) टुकड़ा है, जो 5 '→ 3' पोलीमर्स गतिविधि और 3 '→ 5' exonuclease-गतिविधि है के साथ पचा वेक्टर डीएनए। चिपचिपा समाप्त होता है के blunting और बाद religation चार ठिकानों का नुकसान होता है। ई कोलाई XL1 ब्लू में कदम परिवर्तन से इन अड्डों के नुकसान के लिए जाँच करें, एकल कालोनियों उठा, उनके प्लास्मिड डीएनए, 41 अलग-थलग करने और प्रतिबंध पाचन और अनुक्रमण द्वारा आगे का विश्लेषण।
  2. एकल क्रॉसओवर के विकार Streptomyces में निर्माण
    1. ई कोलाई ET12567 pUZ8002 42 (केनामाइसिन आर) में गर्मी झटका परिवर्तन 40 से आत्महत्या विलोपन के साथ pokPI जीन (pKC1132_ pokPI डेल) युक्त वेक्टर स्थानांतरण। 100 एमएल लेग मीडिया में कोशिकाओं को सेते (केनामाइसिन 50 ग्राम मिलीलीटर -1, apramycin 50 ग्राम मिलीलीटर -1
    2. मिक्स 500 μL ई कोलाई pUZ8002 pKC1132_ pokPI डेल 500 μL Streptomyces diastatochromogenes संस्कृति के साथ (वैकल्पिक रूप से बीजाणुओं का उपयोग करें)। एमएस प्लेटों पर मिश्रण (सोया आटा 20 ग्राम, डी-mannitol 20 ग्राम, 2 MgCl 10 मिमी, 1.5% अगर, नल का पानी 1 एल) बिखरा हुआ है। 28 डिग्री सेल्सियस पर 20 घंटे के लिए प्लेटें सेते हैं।
    3. apramycin (1.25 मिलीग्राम) और fosfomycin (5 मिलीग्राम) पानी के 1 एमएल में भंग के साथ एक थाली ओवरले और उन्हें सूखी। 28 डिग्री सेल्सियस पर कई दिनों के लिए प्लेटें सेते हैं जब तक exconjugants दिखाई दे रहे हैं।
  3. एकल विदेशी म्यूटेंट की जाँच करें
    1. 20 एमएल टीएसबी मध्यम (apramycin 50 मिलीग्राम एमएल -1) में एकल exconjugants टीका लगाना और तीन दिन और 180 आरपीएम के लिए 28 डिग्री सेल्सियस पर उन्हें सेते हैं।
    2. जीनोमिक डीएनए 43 अलग करने और पीसीआर द्वारा pokPI जीन की रुकावट की जाँच करें।
    3. 100 एमएल हा माध्यम में सत्यापित जीन रुकावट और Streptomyces wildtype तनाव के साथ एकल क्लोन टीका लगाना और 28 डिग्री सेल्सियस और 180 rpm पर 6 दिनों के लिए उन्हें सेते हैं। कच्चे तेल निकालने (धारा 1.3 देखें) निकालें। एचपीएलसी एमएस विश्लेषण द्वारा यौगिक उत्पादन की जाँच करें (खंड 1.4 देखें)। एचपीएलसी वर्णलेख में इसी चोटी और यौगिक के बड़े पैमाने पर किसी भी अधिक detectable नहीं होना चाहिए (6 चित्रा देखें)।

चित्रा 6
चित्रा 6: निष्क्रिय pokPI जीन के साथ एस diastatochromogenes का एचपीएलसी विश्लेषण। एचपीएलसी एस के कच्चे तेल निकालने के वर्णलेख (λ = 430 एनएम) बाधित pokPI -Gen (नीचे) के साथ डब्ल्यूटी (ऊपर) और उत्परिवर्ती तनाव diastatochromogenes। उत्परिवर्ती तनाव अब और polyketomycin उत्पादन नहीं करता है।यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Representative Results

इस अवलोकन में हम एक एंटीबायोटिक अपनी biosynthetic जीन क्लस्टर के लिए अग्रणी की पहचान से ही कदम का वर्णन है। कई साल पहले हम एक cosmid पुस्तकालय, उन्हें फगेस में पैक क्लोन, ई कोलाई मेजबान कोशिकाओं transduced, और कालोनियों के हजारों स्क्रीन करने के लिए polyketomycin क्लस्टर की ओवरलैपिंग क्षेत्रों होने क्लोन की पहचान के लिए किया था। Cosmids का अनुक्रमण भी एक कठिन और महंगी प्रक्रिया 12 थी।

आदेश में तनाव पर आगे के अध्ययन का संचालन करने के लिए हम Streptomyces diastatochromogenes Tü6028 के पूरे जीनोम अनुक्रम। मसौदा जीनोम अनुक्रम के साथ हम आसानी से polyketomycin और अन्य समूहों के होनहार यौगिकों एन्कोडिंग के biosynthetic जीन क्लस्टर की पहचान की। चित्रा 7 एक cosmid पुस्तकालय और elaborative स्क्रीनिंग की क्लोनिंग द्वारा biosynthetic क्लस्टर की पहचान करने का "" पुराने विधि की तुलना, और'नई' किसी न किसी समय के पैमाने पर बाद में जीनोम खनन के साथ पूरे जीनोम अनुक्रमण द्वारा विधि। नई अनुक्रमण प्रौद्योगिकियों और नए जीनोम खनन कार्यक्रमों पूरी प्रक्रिया में तेजी लाने के।

चित्रा 7
चित्रा 7: "पुराने" और "नया" एक biosynthetic जीन क्लस्टर बताए की विधि की तुलना। "" पुराने विधि सकारात्मक क्लोन के चयन और संबंधित cosmid (एस) के साथ एक अनुक्रमण cosmid पुस्तकालय की क्लोनिंग (ऊपर) शामिल हैं; 'नई' विधि पूरे जीनोम अनुक्रमण और तनाव (नीचे) के जीनोम पर स्थित सभी माध्यमिक मेटाबोलाइट जीन समूहों की पहचान करने के -mining भी शामिल है। एकल कदम की अवधि को किसी न किसी समय के पैमाने पर दिखाए जाते हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Discussion

इस प्रयोगशाला में Streptomyces diastatochromogenes की एक जीनोमिक cosmid पुस्तकालय उत्पन्न होता है और कई साल पहले जांच की, एक बहुत समय लेने वाली प्रक्रिया के माध्यम से polyketomycin जीन क्लस्टर की पहचान में जिसके परिणामस्वरूप था। एकल जीन की विशेषता लक्षित जीन विलोपन और जिसके परिणामस्वरूप म्यूटेंट 12 के विश्लेषण का उपयोग संभव हो गया है। हाल ही में, एस diastatochromogenes का एक मसौदा जीनोम अनुक्रम polyketomycin biosynthetic जीन क्लस्टर की तेजी से पहचान की अनुमति प्राप्त हुई थी। हम आसानी से biosynthetic जीन का पता लगा सकता है, हालांकि मसौदा जीनोम अनुक्रम अभी भी कई contigs शामिल हैं। वर्णित प्रक्रिया महीने के भीतर प्राप्त किया जा सकता है। हालांकि, प्रक्रिया में कई कदम शामिल हैं। एकल कदम कई बार विफल हो सकता है, बाद के चरणों को बढ़ने से रोकने:

जीनस Streptomyces अपनी क्षमता बायोएक्टिव यौगिकों का निर्माण करने के लिए जाना जाता है। वे अक्सर अधिक से अधिक 20 BIOS ले, जबकिynthetic जीन समूहों, आमतौर पर केवल एक या दो यौगिकों प्रयोगशाला परिस्थितियों में उत्पादित कर रहे हैं। OSMAC दृष्टिकोण (अलग अलग परिस्थितियों में एक तनाव की खेती) चुप जीन समूहों को जागृत करने के आवेदन कभी कभी पर्याप्त नहीं हो सकता। ऐसे pleiotropic नियामक जीन adpA 44 और bldA 45,46 के रूप में नियामक जीन, के आनुवंशिक हेरफेर, यह भी अन्य माध्यमिक चयापचयों के उत्पादन को सक्रिय करने के लिए एक प्रभावी तरीका है।

परिसर की संरचना की व्याख्या, एनएमआर विश्लेषण द्वारा उदाहरण के लिए, आम तौर पर शुद्ध परिसर के अधिक से अधिक 2 मिलीग्राम आवश्यक है। इसलिए, 10 से अधिक एल संस्कृति के किण्वन अक्सर आवश्यक है। एक किण्वक है कि ऑक्सीजन, पीएच और तापमान की स्थिति बनाए रखने में सक्षम है बिना, यह एक छोटी सी प्रयोगशाला संस्कृति और बाद निकासी की इस राशि को संभालने के लिए चुनौतीपूर्ण हो सकता है। शुद्धि के दौरान, यौगिक ऑक्सीकरण, विकिरण या तापमान के कारण बदला जा सकता है।इसके अलावा, अधिक शुद्धि चरणों इस्तेमाल कर रहे हैं, उच्च गिरावट की संभावना।

जब प्राकृतिक उत्पाद की संरचना और जीनोम में समूहों का विश्लेषण करने, कभी कभी यह है कि उचित क्लस्टर की पहचान करने के लिए आसान नहीं है। सबसे पहले, अगर वहाँ केवल एक मसौदा जीनोम अनुक्रम क्लस्टर का कुछ हिस्सा लापता हो सकता है। दूसरे, नहीं तो सब जीन जो जैव संश्लेषण के लिए आवश्यक हैं क्लस्टर में हैं। तीसरा, कभी कभी एक क्लस्टर कई kilobases द्वारा एक दूसरे से अलग दो भागों में विभाजित है। चौथे, यह जो एक उचित जीन क्लस्टर है तय करना मुश्किल हो सकता है। बड़े पीकेएस प्रकार मैं या NRPS प्रणाली, जहां यह मॉड्यूल की संख्या के आधार पर भरनेवाला इकाइयों की संख्या की गणना, या यहां तक ​​कि चयन डोमेन के विश्लेषण द्वारा एकल भरनेवाला इकाइयों की पहचान करने के लिए संभव है के मामले में, यह आसानी से बदल जाता है। हालांकि, iteratively काम करने के मामले में एंजाइमों संश्लेषित यौगिकों की भविष्यवाणी अक्सर संभव नहीं है, विशेष रूप से रणनीति यदिमें 40 से अधिक जीन समूहों है। पांचवें क्रम में, प्रकृति अत्यधिक जटिल और अभी तक अज्ञात यौगिकों से भरा है। अक्सर जैवसंश्लेषण अलग रास्ते का एक मिश्रण है। नया परिसर अभी तक पहचान नहीं है, तो या नहीं एक और परिसर से संबंधित है, यह क्लस्टर की पहचान करने के लिए, एक जैवसंश्लेषण मॉडल का प्रस्ताव करने के लिए है और यह साबित करने के लिए मुश्किल हो सकता है।

एक बार क्लस्टर की पहचान की है, एकल विदेशी तकनीक परिकल्पना सत्यापित करने के लिए एक अच्छा और त्वरित तरीका है। पीसीआर, एक आत्मघाती वेक्टर, विकार, सकारात्मक क्लोन के चयन, और उत्पादन परख में क्लोनिंग केवल आवश्यक कदम उठाए हैं। इस तकनीक का एक नुकसान यह है कि गुणसूत्र में वेक्टर के एकीकरण के आगे पुनर्संयोजन घटनाओं के कारण स्थिर नहीं है। इसलिए, ताकि आगे की एकल जीन का विश्लेषण करने के लिए, सटीक जीन विलोपन के लिए आवश्यक हैं। इसके अलावा यह आनुवंशिक स्तर पर Streptomyces उपभेदों हेरफेर करने के लिए मुश्किल हो सकता है।

वर्णित प्रक्रिया टी सौंपा जा सकता हैओ किसी अन्य यौगिक एक Streptomyces तनाव या अन्य सूक्ष्मजीव द्वारा उत्पादन किया। एक biosynthetic जीन क्लस्टर और उसके संश्लेषित परिसर के बारे में ज्ञान हमें बहुऔषध प्रतिरोधी रोगजनकों के खिलाफ लड़ाई के लिए उन्हें सुधार लाने के उद्देश्य के साथ पहले से ही विद्यमान अणुओं को संशोधित करने के लिए आगे अवसर देता है।

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
से Polyketomycin का उपयोग करते हुए एक प्रदर्शन: इसकी biosynthetic जीन क्लस्टर के लिए एक प्राकृतिक उत्पाद से<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter