Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Da un prodotto naturale al suo grappolo Biosynthetic Gene: Una dimostrazione che utilizzino Polyketomycin da doi: 10.3791/54952 Published: January 13, 2017

Summary

Presentiamo qui un protocollo dettagliato di (A) l'identificazione di un prodotto naturale con attività antibiotica, (B) la purificazione del composto (C) il primo modello della sua biosintesi, (D) sequenziamento del genoma / -mining e ( E) la verifica del cluster genico biosintetico.

Abstract

Ceppi Streptomyces sono noti per la loro capacità di produrre un sacco di composti diversi con vari bioattività. La coltivazione in condizioni diverse, spesso porta alla produzione di nuovi composti. Pertanto, culture produzione dei ceppi vengono estratti con acetato di etile e gli estratti grezzi vengono analizzati mediante HPLC. Inoltre, gli estratti sono testati per la loro bioattività dai saggi differenti. Per struttura delucidazione il composto di interesse viene purificato mediante una combinazione di diversi metodi di cromatografia.

Il sequenziamento del genoma accoppiato con genoma mining permette l'identificazione di un cluster prodotto naturale biosintetico del gene utilizzando diversi programmi per computer. Per confermare che il gene cluster corretta è stato identificato, esperimenti gene inattivazione devono essere eseguiti. I mutanti risultanti vengono analizzati per la produzione del particolare prodotto naturale. Una volta che il cluster genico corretto è stato inattivato, lasforzo non dovesse produrre il composto.

Il flusso di lavoro viene mostrata per la polyketomycin composto antibatterico prodotto da Streptomyces diastatochromogenes Tü6028. Circa dieci anni fa, quando sequenziamento genomico era ancora molto costoso, la clonazione e l'identificazione di un gene cluster era un processo molto tempo. Veloce sequenziamento del genoma combinato con genoma mineraria accelera il processo di identificazione del cluster e apre nuovi modi per esplorare biosintesi e di generare i prodotti naturali romanzo di metodi genetici. Il protocollo descritto in questo documento può essere attribuito ad un altro composto derivato da un ceppo Streptomyces o altro microrganismo.

Introduction

Prodotti naturali di piante e microrganismi sono sempre stati una fonte importante per lo sviluppo di farmaci clinica e di ricerca. Il primo antibiotico penicillina è stata scoperta nel 1928 da un fungo da Alexander Fleming 1. Oggi, molti prodotti più naturali sono utilizzati nel trattamento clinico.

Un genere noto per la sua capacità di produrre vari tipi di metaboliti secondari con diversi bioattività è Streptomyces. Streptomyces sono batteri Gram-positivi e appartengono alla classe dei Actinobacteria e l'ordine Actinomycetales. Quasi due terzi degli antibiotici clinicamente utilizzati sono derivati da Actinomycetales, soprattutto da Streptomyces, come amfotericina 2, 3 o daptomicina tetraciclina 4. Due premi Nobel sono stati assegnati nel campo della ricerca Streptomyces antibiotico. Il primo è andato a Selman Waksman per la scoperta della streptomicina, la prima di unantibiotica efficace contro la tubercolosi. 5 Nel 2015, come parte del Premio Nobel per la Fisiologia e la Medicina, la scoperta di avermectin da S. avermitilis è stato assegnato pure. Avermectin è usato per il trattamento di malattie parassitarie 6,7.

L'approccio tradizionale per la scoperta di prodotti naturali in microrganismi come Streptomyces generalmente coinvolge la coltivazione del ceppo in diverse condizioni di crescita, così come l'estrazione e l'analisi dei metaboliti secondari. Saggi bioattività (es saggi per l'attività antibatterica e antitumorale) vengono eseguiti per rilevare l'attività del composto. Infine, il composto di interesse è isolato e la struttura chimica è chiarito.

Le strutture di prodotti naturali sono spesso composti di singole porzioni che stanno formando molecole complesse. Ci sono alcuni, ma limitate, le principali vie biosintetiche che portano alla costruzione di bloccoks, che vengono utilizzati per la biosintesi di prodotti naturali. Le principali vie biosintetiche sono i percorsi Polichetide, sentieri che conducono a terpenoidi e alcaloidi, percorsi utilizzando aminoacidi, e le vie che conducono a frazioni di zucchero. Ogni percorso è caratterizzata da un insieme di enzimi specifici 8. Sulla base della struttura del composto, questi enzimi biosintetici possono essere previsti.

Al giorno d'oggi, l'analisi strutturale dettagliata di un composto, in combinazione con il sequenziamento di nuova generazione e analisi bioinformatica può aiutare a identificare il gene cluster biosintetico responsabile. Le informazioni gruppo apre nuove strade per ulteriori ricerche prodotto naturale. Questo include espressione eterologa per aumentare la resa del prodotto naturale, la modifica composto di mira da delezione del gene o l'alterazione e la biosintesi combinatoria con geni provenienti da altri percorsi.

Polyketomycin stato isolato indipendentemente dal brodo di coltura didue ceppi, Streptomyces sp. MK277-AF1 9 e Streptomyces diastatochromogenes Tü6028 10. La struttura è stata chiarita mediante analisi NMR e raggi X. Polyketomycin è composto da un decaketid tetraciclici e un acido salicilico dimetil, collegati da due porzioni deossizuccheri beta-D-amicetose e α-L-axenose. Esso mostra citotossica e attività antibiotica, anche contro ceppi multiresistenti Gram-positivi come l'MRSA 11.

Una libreria genomica cosmid di S. diastatochromogenes Tü6028 è stato generato e proiettato molti anni fa. Utilizzando gene specifico sonde gene cluster polyketomycin con una dimensione di 52,2 kb, contenente 41 geni, è stato identificato dopo diversi mesi di intenso lavoro 12. Recentemente, una sequenza progetto genoma di S. diastatochromogenes è stata ottenuta che porta alla rapida identificazione del gene cluster biosintetico polyketomycin. In questa panoramica, un metodo per aiutare a idenduare un prodotto naturale e chiarire suo gene cluster biosintetico sarà descritta utilizzando polyketomycin come esempio.

Qui spieghiamo i singoli passaggi che portano da un prodotto naturale al suo gruppo di geni biosintetica mostrato per polyketomycin prodotto da Streptomyces diastatochromogenes Tü6028. Il protocollo comprende l'identificazione e la purificazione di un prodotto naturale con proprietà antibiotiche. Ulteriori analisi strutturale e confronto con risultati ottenuti piombo mineraria genoma per l'identificazione del gene cluster biosintetico. Questa procedura può essere applicata a qualsiasi altro composto derivato da un ceppo Streptomyces o altro microrganismo.

Protocol

1. Identificazione di un prodotto naturale con proprietà antibiotico

  1. Coltivare un microrganismo in condizioni diverse (ad esempio, tempo, temperatura, pH, media) in seguito alla "OSMAC (un ceppo-molti composti) approccio" 13. Selezionare un mezzo in cui si osserva la produzione di un composto.
  2. Coltivare Streptomyces diastatochromogenes Tü6028 nelle seguenti condizioni
    1. Grow Streptomyces diastatochromogenes ceppo Tü6026 su piastre MS (farina di soia 20 g, D-mannitolo 20 g, MgCl 2 a 10 mm, agar 1,5%, l'acqua del rubinetto 1 L). Seminare un piccolo anello delle spore di questo ceppo in 20 ml di media TSB liquido (Tryptic Soy brodo 30 g, l'acqua del rubinetto 1 L, pH 7,2; media precoltura) in una beuta con una spirale. Agitare il recipiente su un agitatore rotante (28 ° C, 180 rpm, 2 giorni).
    2. Seminare la cultura principale a 100 ml di mezzo HA (glucosio 4 g, estratto di lievito 4 g, maltoestrarre 10 g, acqua di rubinetto 1 L, pH 7.2) con 2 mL di precoltura. Culture ceppo a 28 ° C per 6 giorni su un agitatore rotante a 180 rpm.
  3. Preparazione dell'estratto grezzo
    1. Celle di raccolta mediante centrifugazione (10 min, 3000 XG).
    2. Per passi successivi gestire solventi organici sotto una cappa aspirante.
    3. Per l'estrazione composto dal micelio, risospendere le cellule in un duplice volume di acetone e agitare con un tubo per 30 min, 180 rpm. Filtrare il liquido attraverso carta da filtro commerciale e si evapora l'acetone da evaporatore rotante a 40 ° C e 550 bar. Sciogliere l'estratto in 20 mL di acqua: acetato di etile (1: 1) e agitare in un imbuto separatore per 30 min a 180 rpm.
    4. Per l'estrazione composti dal mezzo di coltura, regolare il brodo di coltura a pH 4,0 mediante aggiunta di 1 M HCl. Aggiungere 100 mL di acetato di etile e agitarla in un imbuto separatore per 30 min, 180 giri al minuto.
    5. Raccogliere fase di acetato di etile e far evaporare da marciume evaporazione ary a 40 ° C e 240 bar.
  4. Analisi dell'estratto grezzo mediante HPLC
    1. Sciogliere gli estratti in 1 ml MeOH, filtrarli attraverso un filtro con 0,45 micron pori ed eseguire la cromatografia liquida ad alta prestazione (HPLC) 14.
    2. Nel caso di polyketomycin, dotare il sistema HPLC con una precolonna C18 (4,6 x 20 mm 2) ed una colonna C18 (4,6 x 100 mm 2). Utilizzare un gradiente lineare di acetonitrile + 0,5% di acido acetico che vanno dal 20% al 95% in H (portata: 0,5 mL min -1) acetico 2 O + 0,5%.
      NOTA: Polyketomycin ha un tempo di ritenzione 25,9 min (vedere Figura 1A). Lo spettro UV / vis ha massimi a 242 nm, 282 nm, 446 nm e minimi a 262 nm e 359 nm (vedere Figura 1B). Nel modus negativo una massa di 863,2 [MH] - è rilevabile (vedi Figura 1C).

"Src =" / files / ftp_upload / 54952 / 54952fig1.jpg "/>
Figura 1: LC / MS Analisi Polyketomycin. (A) HPLC cromatogramma (λ = 430 nm) dell'estratto grezzo dopo coltura di Streptomyces diastatochromogenes Tü6028 per 6 giorni. Polyketomycin ha un tempo di ritenzione 25,9 min (B) UV / vis spettri di Polyketomycin. (C) Massa spettri Polyketomycin nel modus negativo. Picco principale con m / z 863,2 [MH] -. Clicca qui per vedere una versione più grande di questa figura.

  1. Identificazione della attività antibiotica mediante saggio disco diffusion
    1. Seminare i ceppi di test come Gram-positivi subtilis batteri Bacillus (in terreno LB; LB 20 g, l'acqua del rubinetto 1 L, pH 7,4) e altri ceppi Streptomyces (in media TSB; brodo di soia trittico 30 g, l'acqua del rubinetto 1 L, pH 7.2), Batteri Gram-negativi Escherichia coli (in terreno LB) e ceppi fungini (in media come mezzo YPD; estratto di lievito 10 g, 20 g peptone, glucosio 20 g, rubinetto 1 L, pH 7,4). Prendete 100 ml di prova ceppo precoltura e diffonderli su rispettive piastre di agar.
    2. Sciogliere l'estratto grezzo o composto purificato in 500 ml di metanolo (in alternativa acqua o DMSO) e pipetta 20-50 microlitri su dischi di carta sterili. dischi di carta a secco per 30 minuti sotto il banco di lavoro e metterle sulle piastre con colture di prova. Preparare un controllo negativo (solvente) e un controllo positivo (antibiotici, per esempio AMP [1 mg]).
    3. Incubare le piastre in condizioni adeguate fino a quando i ceppi di test sono cresciuti visibilmente e determinare la zona di inibizione, se apparente. Incubare E. coli e Bacillus sp. a 37 ° C per 16 h, Streptomyces sp. a 28 ° C per 2-4 giorni, ceppo fungino (prevalentemente a carico esatto ceppo di prova) unat 30 ° C per 2 giorni).

2. Large Scale di estrazione, purificazione e struttura chiarimento del Compound

  1. Coltivare S. diastatochromogenes in media 5 L HA (glucosio 4 g, estratto di lievito 4 g, estratti di malto 10 g, l'acqua del rubinetto 1 L, pH 7,2). Seminare 2 ml del precoltura a 30 x 500 ml Erlenmeyer palloni contenenti 150 ml HA media. Incubare la deformazione a 28 ° C per 6 giorni su un agitatore rotante a 180 rpm.
  2. Celle di raccolta mediante centrifugazione (10 min, 15.000 XG, RT) ei composti estratto utilizzando acetato di etile (vedere paragrafo 1.3).

figura 2
Figura 2: Flusso di lavoro per la struttura chiarimento. Il procedimento comprende (1) la coltivazione del ceppo, (2) estrazione, (3) la purificazione mediante estrazione in fase solida (SPE), cromatografia su strato sottile (TLC), cromatografia liquida preparativa ad alta prestazione (HPLC), dimensionecromatografia di esclusione (SEC) e (4) Struttura delucidazione mediante analisi di massa (MS), la risonanza magnetica nucleare (NMR) e le misure X-ray. Clicca qui per vedere una versione più grande di questa figura.

  1. Purificazione di Polyketomycin
    NOTA: Il processo di purificazione e struttura delucidazione è mostrata in figura 2.
    1. Frazionare estratto grezzo da una colonna di estrazione in fase solida C18 (SPE) utilizzando un gradiente di -stepwise MeOH 10% dal 30% al 100% MeOH in H 2 O, 100 mL per ogni condizione.
    2. Purificare la frazione compound contenente ulteriormente mediante cromatografia preparativa su strato sottile (TLC) 15 usando CH 2 Cl 2 / MeOH (7: 1) come sistema di eluizione.
    3. Purificare il composto mediante HPLC preparativo 16. Dotare il sistema HPLC con una precolonna C18 (5 micron; 9,4 x 20 mm) e uncolonna principale (5 micron; 9,4 x 150 mm). Utilizzare un gradiente di acido acetico acetonitrile + 0,5% dal 20% al 95% in acido acetico H 2 O + 0,5% (portata: 2,0 mL / min).
    4. Per rimuovere solventi e altre piccole impurità, eseguire un ultimo passo purificazione mediante cromatografia ad esclusione sterica utilizzando una colonna in MeOH 17. Raccogliere il composto puro finale ed evaporare MeOH per evaporazione rotante a 40 ° C e 240 bar.
  2. struttura delucidazione
    1. Sciogliere il composto puro (più di 2 mg) in 600-700 ml (a seconda della macchina) di DMSO d 6, registrare 1D NMR (1 H, 13 C) e 2D NMR (HSQC, HMBC, 1 H 1 H COSY) spettri su uno spettrometro NMR 18. Esprimere spostamenti chimici nei valori δ (ppm) utilizzando DMSO d 6.
    2. Registrare un spettro di massa ad alta risoluzione (HRESI-MS) 19 di polyketomycin con una ad alta risoluzionespettrometro di massa.
    3. Chiarire la struttura per l'interpretazione dei risultati di analisi dati NMR e MS 10.

3. Proporre Biosynthetic modello della nuova composto isolato

  1. Analizzare la struttura del composto isolato e predire enzimi, che possono essere coinvolti nella biosintesi. Assegnarli a Polichetide (tipo I, II o III), sintesi di peptidi non ribosomiale, lantipeptide, terpenoid, o zucchero metabolismo percorso 8.
  2. esempio polyketomycin
    1. Suddividere la struttura in evidenti singole frazioni: frazione tetraciclici, due monosaccaridi e l'acido salicilico dimetil.
    2. Scopri, dove le frazioni possono essere derivate da: La porzione tetraciclici potrebbe essere derivato da un tipo polyketide sintasi II e la frazione dimetil acido salicilico potrebbe essere derivato da un iterativo Polichetide tipo sintetasi I. Le due frazioni di zucchero, che sono 6-deoxysugars , potrebbe essere SynthesiZed dal glucosio che coinvolge un TDP-glucosio-4,6-dehydratase durante la biosintesi e fissato probabilmente da due glicosiltransferasi (vedi figura 3) 8.
    3. Prevedere geni putativi del cluster. Si pensi enzimi coinvolti nella sintesi delle singole porzioni, nel collegare le unità, nonché nel modificare e personalizzare la molecola. Il cluster genico biosintetico di Polyketomycin contiene la maggior parte probabilmente geni che codificano un tipo polyketide sintasi II (quindi almeno un ACP, KS α und KS β per il collegamento di unità di estensione), un iterativo di tipo Polichetide sintasi I (almeno ACP, AT, KS), una TDP-glucosio-4,6-deidratasi (necessario per il passo: il glucosio → deossiglucosio) e due glicosiltransferasi (allegando due monomeri di zucchero verso l'aglicone) 8.

Figura 3
Figura 3: Struttura di Polyketomycin Dividcato in singoli blocchi di costruzione. Polyketomycin è composto da un decaketid tetraciclici (PKS tipo II) e un acido salicilico dimetil (iterativo PKS tipo I), collegati da due porzioni deossizuccheri β-D-amicetose e α-L-axenose (NDP-glucosio-4,6- dehydratase e due glycosyltransferase richiesto). Clicca qui per vedere una versione più grande di questa figura.

4. Genome Sequencing / Mining

  1. Generazione sequenziamento di prossima
    1. Sequenziare il DNA genomico da tecnologie di sequenziamento di nuova generazione, come Illumina, 454 pyrosequencing o solido 20. Allineare singolo si legge in una sequenza di riferimento o assemblare de novo.
      NOTA: Il genoma di S. diastatochromogenes Tü6028 è stato sequenziato presso il Centro di Biotecnologie (CeBiTec) presso l'Università di Bielefeld. Tutte le letture sono state assemblate a un progetto di genomadi 7,9 Mb.
  2. genoma mineraria
    1. Cerca open reading frame (ORF) per l'uso di, per esempio NCBI Prokaryotic annotazione genomica Pipeline 21,22, RAST (rapida annotazione utilizzando la tecnologia del sottosistema) 23,24,25, Prokka (rapido procariotico annotazione del genoma) 26 o 27 GenDB. Questi programmi propongono anche le loro funzioni. L'analisi del S. diastatochromogenes Tü6028 sequenza del genoma progetto portato all'identificazione di oltre 7.000 ORF.
    2. Eseguire BLAST specifico (Base locale Allineamento strumento di ricerca) di analisi per ottenere ulteriori informazioni come allineamenti con altri geni simili e domini catalitici 28,29,30.
    3. Per l'identificazione del gene metabolita eseguire programmi di cluster secondari come antiSMASH 31,32,33, 34 e NaPDoS NRPSpredictor 35,36. Nel progetto genoma di Streptomyces diastatochromogenes antiSMASH 31,32,33 identicato 22 cluster di geni.
    4. Analizzare i cluster di geni putativi per la loro via enzimatica (s) (Polichetide sintasi (tipo I, II o III), non ribosomiale peptide sintetasi, lanthipeptide, terpenoidi, metabolismo degli zuccheri ...). Ricerca di cluster (s) contenente geni che potrebbero essere coinvolti nella sintesi del composto (vedi punto 3). A S. diastatochromogenes annotata gruppo 2 contiene Polichetide tipo sintasi II geni, tre Polichetide tipo sintasi I geni, un gene TDP-glucosio-4,6-deidratasi e due geni glicosiltransferasi (vedi Figura 4).
    5. Focus su singoli geni all'interno del cluster. Per PKS tipo I e NRPS la specificità di aciltransferasi e domini adenylation, e quindi l'incorporazione di unità singola diluenti, può essere previsto. confronta anche dell'ordine dell'unità extender incorporato con la molecola. antiSMASH 31,32,33 mostra anche gruppi simili di composti già noti, con un link al database di MIBiG 37. Confrontare la struttura del composto con questi composti e controllare somiglianze.

Figura 4
Figura 4: Uscita antiSMASH di Polyketomycin Biosynthetic Gene Cluster e panoramica dei altri cluster a S. diastatochromogenes Tü6028. (A) Presentazione di cluster di geni biosintetici previsti nel genoma di S. diastatochromogenes Tü6028; (B) Cluster 2 Polyketomycin cluster di geni biosintetico con i geni mirati. Clicca qui per vedere una versione più grande di questa figura.

5. Verifica del Cluster Biosynthetic Gene

  1. Ricerca di un gene con funzioni ovvie e importanti (essenziali) per la biosintesi del composto. Per la verifica della polyketomycin gene cluster gene pokPI, che codifica per la α ketosynthase dal tipo PKS II, è stato selezionato e inattivato da un fuori della cornice -deletion (vedi Figura 5B). In alternativa, interrompere il gene clonando un frammento di interno (vedi Figura 5C).

Figura 5
Figura 5: Verifica di un cluster di geni dal singolo Crossover. (A) gene nativo porta alla definizione di una proteina funzionale; (B) Clonaggio del gene con delezione interna in un vettore suicida conduce ad un singolo incrocio con un conseguente spostamento fotogramma nel gene bersaglio e la conseguente definizione di proteina non funzionale; (C) La clonazione di un frammento interna del gene in un vettore suicida porta ad un troncamento del gene e conseguente definizione di una proteina non funzionale. orit: origine delle transfer; antibiotico R: resistenza agli antibiotici. Clicca qui per vedere una versione più grande di questa figura.

  1. Clonazione del costrutto singolo crossover
    1. Amplificare un frammento contenente pokPI mediante PCR 38 con primer pokPI_for e pokPI_rev.
    2. Prodotto Clone PCR al suicidio vettore pKC1132 39 (apramicina R [50 mg / ml]). Il vettore suicidio non è in grado di replicare nel ceppo Streptomyces e deve integrarsi nel gene bersaglio di ricombinazione omologa per fornire AMP-resistenza così. Trasferire il vettore in E. coli clonazione ospite da shock termico trasformazione 40.
    3. Isolare il vettore da alcalina lisi 41.
    4. Digerire il DNA di vettore con un singolo enzima di restrizione taglierina che taglia all'interno del frammento. Il pokPI gene stato digerito con enzima Kpn I.
    5. Trattare DNA vettore digerito con grande DNA polimerasi I (Klenow) frammento, che ha 5 '→ 3' attività della polimerasi e 3 '→ 5' esonucleasi-attività. Ottundimento delle estremità appiccicose e successiva religation porta alla perdita di quattro basi. Controllare per la perdita di queste basi per la trasformazione passi in E. coli XL1 Blu, raccogliendo singole colonie, isolando il loro DNA plasmide, 41 e analizzare ulteriormente restrizione digestione e sequenziamento.
  2. Coniugazione del singolo incrocio costruire in Streptomyces
    1. Trasferire il vettore contenente il gene suicida pokPI (pKC1132_ pokPI del) con delezione in E. coli ET12567 pUZ8002 42 (kanamicina R) da shock termico trasformazione 40. Incubare le cellule in 100 ml di LB mezzi (kanamicina 50 mg mL -1, AMP 50 mg mL -1
    2. Mescolare 500 ml di E. coli pUZ8002 pKC1132_ pokPI del con la cultura 500 microlitri di Streptomyces diastatochromogenes (in alternativa utilizzare le spore). Stendere l'impasto su piastre MS (farina di soia 20 g, D-mannitolo 20 g, MgCl 2 a 10 mm, agar 1,5%, l'acqua del rubinetto 1 L). Incubare le piastre per 20 ore a 28 ° C.
    3. Sovrapposizione ogni piatto con AMP (1,25 mg) e fosfomicina (5 mg) disciolti in 1 ml di acqua e lasciare asciugare. Incubare le piastre per diversi giorni a 28 ° C fino a quando exconjugants sono visibili.
  3. Controllare mutanti singolo di crossover
    1. Seminare singoli exconjugants in 20 mL TSB medio (AMP 50 mg mL -1) e incubare a 28 ° C per tre giorni e 180 giri al minuto.
    2. Isolare il DNA genomico 43 e verificare l'interruzione del gene pokPI mediante PCR.
    3. Seminare cloni singoli con interruzione del gene verificato e Streptomyces ceppo di tipo selvatico in 100 ml di mezzo HA e incubare per 6 giorni a 28 ° C e 180 giri al minuto. Estrarre il estratto grezzo (vedi paragrafo 1.3). Controllare la produzione di compound mediante analisi HPLC-MS (vedi paragrafo 1.4). Il picco corrispondente nel cromatogramma HPLC e la massa del composto non dovrebbero essere rilevabili più (vedere Figura 6).

Figura 6
Figura 6: Analisi HPLC di S. diastatochromogenes con inattivato pokPI Gene. HPLC cromatogramma (λ = 430 nm) di greggio estratto di S. diastatochromogenes WT (in alto) e ceppo mutante con interrotto pokPI Ge (qui di seguito). Il ceppo mutante non produce polyketomycin più.Clicca qui per vedere una versione più grande di questa figura.

Representative Results

In questa panoramica vengono descritti i singoli passi dalla individuazione di un antibiotico che porta alla sua gene cluster biosintetico. Molti anni fa abbiamo clonato una biblioteca cosmid, li confezionato in fagi, trasdotte cellule ospiti di E. coli, e ha dovuto schermo migliaia di colonie per identificare i cloni che hanno sovrapposte regioni del grappolo polyketomycin. Il sequenziamento dei cosmidi era anche un difficile e costoso processo 12.

Al fine di condurre ulteriori studi sul ceppo abbiamo sequenziato l'intero genoma di Streptomyces diastatochromogenes Tü6028. Con il progetto di sequenza del genoma abbiamo facilmente identificato il gene cluster biosintetico di polyketomycin e altri cluster che codificano composti promettenti. Figura 7 confronta il metodo "vecchio" di individuare cluster biosintetica per clonazione di una biblioteca cosmid e lo screening elaborative, eil metodo "nuova" di sequenziamento dell'intero genoma con conseguente mineraria genoma su una scala temporale di massima. Le nuove tecnologie di sequenziamento del genoma e nuovi programmi di estrazione accelerare l'intero processo.

Figura 7
Figura 7: Confronto tra il "vecchio" e "nuovo" metodo di assegnazione di un biosintetico Gene Cluster. Il metodo "vecchio" comprende la clonazione di una libreria cosmid con selezione di cloni positivi e sequenziamento del rispettivo cosmide (s) (sopra); Il metodo "nuovo" include sequenziamento dell'intero genoma e -mining per identificare tutti i cluster di geni metabolici secondari situati sul genoma del ceppo (in basso). Durata di singoli passi sono presenti su una scala temporale ruvida. Clicca qui per vedere una versione più grande di questa figura.

Discussion

In questo laboratorio una libreria genomica di Streptomyces cosmid diastatochromogenes stato generato e proiettato molti anni fa, causando l'identificazione del gene cluster polyketomycin attraverso un processo estremamente-tempo. Caratterizzazione dei singoli geni fosse possibile utilizzando gene delezioni mirate e analisi dei mutanti risultanti 12. Recentemente, una sequenza progetto genoma di S. diastatochromogenes è stato ottenuto consentendo la rapida identificazione del gene cluster biosintetico polyketomycin. Si potrebbe facilmente rilevare i geni biosintetici, anche se la sequenza progetto genoma contiene ancora molti contigs. Il processo descritto può essere realizzato in pochi mesi. Tuttavia, il procedimento comprende molti passi. gradini singoli possono non riuscire più volte, prevenire la progressione di passi successivi:

Il genere Streptomyces è noto per la sua capacità di produrre composti bioattivi. Mentre portano spesso più di 20 bioscluster di geni ynthetic, di solito solo uno o due composti sono prodotti in condizioni di laboratorio. L'applicazione del metodo OSMAC (coltivazione di un ceppo in condizioni diverse) per svegliare cluster di geni silenti non può a volte essere sufficiente. La manipolazione genetica di geni regolatori, come i geni regolatori pleiotropici ADPA 44 e bldA 45,46, è anche un metodo efficace per attivare la produzione di altri metaboliti secondari.

Per la spiegazione della struttura del composto, ad esempio mediante analisi NMR, solitamente più di 2 mg di composto purificato è necessario. Pertanto, la fermentazione della cultura più di 10 L è spesso richiesto. Senza un fermentatore che è in grado di mantenere condizioni di ossigeno, pH e temperatura, potrebbe essere difficile in un piccolo laboratorio per gestire questa quantità di coltura e successiva estrazione. Durante la purificazione, il composto può essere cambiata a causa di ossidazione, radiazioni o temperatura.Inoltre, vengono utilizzati i più stadi di purificazione, maggiore è la possibilità di degradazione.

Analizzando la struttura del prodotto naturale, ed i cluster nel genoma, a volte non è così facile per identificare il cluster appropriata. In primo luogo, se vi è solo una sequenza progetto genoma una parte del cluster può mancare. In secondo luogo, non tutti i geni che sono necessari per la biosintesi sono nel cluster. In terzo luogo, a volte un cluster è diviso in due parti separate l'una dall'altra da molti kilobasi. In quarto luogo, può essere difficile decidere quale è gene cluster appropriata. In caso di grande tipo PKS I o sistemi PNR, dove è possibile calcolare il numero di unità extender in base al numero di moduli, o addirittura identificare le unità extender singoli mediante analisi dei domini di selezione, risulta facilmente. Tuttavia, nel caso di iterativamente lavorare enzimi la previsione dei composti sintetizzati spesso non è possibile, specialmente se la strain ha più di 40 cluster di geni. In quinto luogo, la natura è molto complessa e piena di composti ancora sconosciute. Spesso la biosintesi è una miscela di percorsi diversi. Se il nuovo composto non è stato ancora identificato, o non connesso ad un altro composto, può essere difficile identificare il cluster, di proporre un modello biosintesi e per provarlo.

Una volta che il cluster è identificato, la tecnica singola crossover è un buon metodo e veloce per verificare l'ipotesi. PCR, clonazione in un vettore suicida, coniugazione, selezione di cloni positivi, e test di produzione sono i soli passi necessari. Uno svantaggio di questa tecnica è che l'integrazione del vettore nel cromosoma non è stabile a causa di ulteriori eventi di ricombinazione. Pertanto, al fine di analizzare ulteriormente singoli geni, sono richiesti gene delezioni precise. Anche se può essere difficile da manipolare i ceppi Streptomyces a livello genetico.

La procedura descritta può essere assegnato to qualsiasi altro composto prodotto da un ceppo Streptomyces o altro microrganismo. La conoscenza di un cluster di geni di biosintesi ed il suo composto sintetizzato ci offre ulteriori opportunità di modificare già molecole esistenti con l'obiettivo di migliorare per la lotta contro gli agenti patogeni multiresistenti.

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
Da un prodotto naturale al suo grappolo Biosynthetic Gene: Una dimostrazione che utilizzino Polyketomycin da<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter