Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

dan Polyketomycin kullanma A Gösteri: Its Biyosentetik Gen kümesi için bir Doğal Ürün dan doi: 10.3791/54952 Published: January 13, 2017

Summary

Burada, (A), antibiyotik aktivitesi ile doğal ürünün belirlenmesi, (B) bileşiği ile saflaştırılması, (c) biyosentezinin ilk modeli, (D), genom dizileme / -Maden ve detaylı bir protokol mevcut ( E) biyosentetik gen kümesinin doğrulanması.

Abstract

Streptomyces suşları, çeşitli biyolojik aktivitelerinin farklı bileşiklerin bir çok üretmek için yeteneği bilinmektedir. Farklı koşullar altında yetiştirme genellikle yeni bileşikler üretimine yol açar. Bu nedenle, suşların üretim kültürleri, etil asetat ile ekstre edilir ve ham ekstreler HPLC ile analiz edilmiştir. Ayrıca, ekstreler farklı deney kendi biyolojik etkinlik için test edilmiştir. yapısının aydınlatılması için ilgili bileşik, farklı kromatografi yöntemlerin bir kombinasyonu ile saflaştırılmıştır.

genom madenciliği ile birleştiğinde genom dizileme farklı bilgisayar programları kullanarak doğal bir ürün biyosentetik gen kümesinin belirlenmesini sağlar. gen inaktivasyonu deneyleri yapılması gereken, doğru gen kümesi tespit edilmiştir onaylamak için. Elde edilen mutantlar, özellikle doğal bir ürün üretimi için analiz edilir. Doğru gen kümesi deaktive edildikten sonra,suş bileşik üretmek için başarısız.

Iş akışı Streptomyces diastatochromogenes Tü6028 tarafından üretilen antibakteriyel bileşik polyketomycin gösterilir. genom dizileme hala çok pahalı iken yaklaşık on yıl önce, bir gen küme klonlanması ve kimlik çok zaman alıcı bir süreç oldu. genom madenciliği ile birlikte hızlı genom dizileme küme kimlik deneme hızlandırır ve yeni yollar biyosentezini keşfetmek ve genetik yöntemlerle yeni doğal ürünler üretmek için açılır. Bu yazıda tarif edilen protokol Streptomyces suşu ya da başka bir mikroorganizmadan türetilmiş herhangi bir başka bileşik atanabilir.

Introduction

bitkiler ve mikroorganizmalar Doğal ürünler her zaman klinik ilaç geliştirme ve araştırma için önemli bir kaynak olmuştur. İlk antibiyotik Penisilin Alexander Fleming 1 tarafından bir mantar 1928 yılında keşfedildi. Günümüzde bir çok doğal ürün, klinik tedavisinde kullanılır.

Farklı bioactivities ikincil metabolitlerin çeşitli üreten onun yeteneği için bilinen bir cins Streptomyces olduğunu. Streptomyces Gram-pozitif bakteriler ve Actinobacteria'lar sınıfından ve sipariş Actinomycetales aittir. Klinik olarak kullanılan antibiyotiklere yaklaşık üçte ikisi 3 ya da tetrasiklin 4 daptomisin, amfoterisin 2 gibi özellikle Streptomyces, Actinomycetales türetilmiştir. İki Nobel ödülleri Streptomyces antibiyotik araştırma alanında verildi. İlki Streptomisin keşfi, ilk bir için Selman Waksman gittitüberküloza karşı etkili tibiotic. 5 2015 yılında, Nobel Fizyoloji veya Tıp Ödülü parçası olarak, S. avermitilis 'dan avermektin keşfi de layık görüldü. Avermektin parazitik hastalıkların 6,7 tedavisi için kullanılır.

Örneğin Streptomyces gibi mikroorganizmalar doğal ürünlerin keşfi için geleneksel bir yaklaşım, genellikle, farklı büyüme koşulları altında suşunun kültivasyonunda, hem de çıkarma ve ikincil metabolitlerin analizini içerir. Biyoaktivite tahlilleri (antibakteriyel ve anti-kanser etkinlik için örneğin deneyleri) bileşik aktivitesi tespit etmek için gerçekleştirilir. Son olarak, ilgi konusu bileşiği izole edilir ve kimyasal yapısı açıklanacaktır.

Doğal ürünlerin yapıları genellikle karmaşık molekülleri oluşturan tek kısımların oluşmaktadır. Bloğa bina lider birkaç, ancak sınırlı, büyük biyosentez yolları vardırdoğal ürünlerin sentezi için kullanılan ks. büyük biyosentez yolları şeker kısımları giden poliketit yolları, amino asitler kullanılarak terpenoid ve alkaloidler, yollar giden yollar ve yollar vardır. Her yol, belirli enzimlerin 8 bir dizi ile karakterize edilir. bileşiğin yapısına bağlı olarak, bu biyosentetik enzimleri tahmin edilebilir.

Günümüzde, yeni nesil dizileme ve biyoinformatik analizi ile birlikte bir bileşiğin ayrıntılı yapısal analiz sorumlu biyosentetik gen kümesi tanımlamak için yardımcı olabilir. Küme bilgiler daha doğal ürün araştırma için yeni yollar açıyor. Bu gen, silme ya da değiştirme ve diğer yollardan gelen genler ile kombinasyon biyosentezi doğal ürün verimini, hedeflenen bileşik modifikasyonu geliştirmek için heterolog ekspresyonunu içerir.

Polyketomycin kültür sıvısından, bağımsız olarak izole edilmiştiriki suş, Streptomyces sp. MK277-AF1 9 ve Streptomyces diastatochromogenes Tü6028 10. Yapı, NMR ve X-ışını analizi ile açıklığa kavuşturulmuştur. Polyketomycin β-D-amicetose ve α-L-axenose iki deoksi şeker kısımları ile bağlantılı bir tetrasiklik decaketid ve dimetil salisilik asit oluşmaktadır. Hatta MRSA 11 gibi Gram-pozitif çok ilaca dirençli suşlara karşı, sitotoksik antibiyotik aktivitesi gösterir.

S. diastatochromogenes Tü6028 bir genomik kozmid kütüphanesi oluşturulur ve yıllar önce tarandı. 41 genleri ihtiva eden, 52.2 kb bir boyuta sahip polyketomycin gen kümesini belirli bir gen probları kullanılarak, yoğun çalışma 12 birkaç ay sonra tespit edilmiştir. Son zamanlarda, S. diastatochromogenes taslak genom sekansı polyketomycin biyosentetik gen kümesinin hızlı tanımlama giden elde edildi. Bu genel olarak, bir yöntem iden yardımcıdoğal bir ürün Tify ve biyosentetik gen kümesinin bir örnek olarak polyketomycin kullanılarak, tarif edilecektir açıklamaktadır.

Burada Streptomyces diastatochromogenes Tü6028 tarafından üretilen polyketomycin için gösterilen kendi biyosentetik gen kümesi doğal üründen yol tek adımları açıklar. Protokol antibiyotik özelliklere sahip doğal bir ürün belirlenmesini ve saflaştırılmasını içermektedir. Daha fazla yapısal analiz ve biyosentetik gen kümesinin belirlenmesi için genom madencilik kurşun elde edilen sonuçlar ile karşılaştırılması. Bu prosedür, bir Streptomyces türü veya herhangi bir başka mikroorganizmadan türetilmiş herhangi bir başka bileşik uygulanabilir.

Protocol

Antibiyotik Mülkiyet ile Doğal Ürün 1. Kimlik

  1. "OSMAC (bir suş-çok bileşikleri) yaklaşımı" 13 aşağıdaki farklı koşullar altında bir mikroorganizmanın (örneğin zaman, sıcaklık, pH, medya) Yetiştirmek. bir bileşiğin üretimi gözlendiği bir orta seçin.
  2. Aşağıdaki koşullar altında Streptomyces diastatochromogenes Tü6028 yetiştirmek
    1. MS plakaları üzerinde Streptomyces diastatochromogenes Tü6026 suşu büyütün (soya unu 20 g D-mannitol, 20 g, MgCl2 10 mM,% 1.5 ağar, musluk suyu 1 L). bir spiral bir Erlenmeyer şişesi içinde, küçük bir 20 mL sıvı TSB ortamı içinde, bu soyu sporlarının döngü (ön kültür ortamı triptik soya suyu 30 g, musluk suyu 1 L, pH 7.2) aşılamak. bir döner sallayıcı (28 ° C, 180 rpm, 2 gün) çalkalanır.
    2. 100 ml HA ortamında (glükoz 4 g, maya ekstresi, 4 g, malt ana kültürü inoküleön kültürün 2 mL, 10 g, musluk suyu 1 L, pH 7.2) ekstrakte edin. Kültür, 180 rpm'de bir döner sallayıcı üzerinde 6 gün boyunca 28 ° C 'de streyn.
  3. Ham ekstrenin hazırlanması
    1. santrifüj Hasat hücreleri (10 dk, 3000 xg).
    2. Bir sonraki adımlar için bir davlumbaz altında organik çözücüler anlaştım.
    3. miselyumdan bileşiği ekstre için, tekrar süspansiyon aseton iki kat hacminde hücre ve 30 dakika, 180 rpm'de bir tüp içinde çalkalanır. Ticari filtre kağıdından sıvı filtre edin ve 40 ° C ve 550 bar, döner bir buharlaştırıcı ile aseton buharlaştırılır. : etil asetat, 20 mL su içinde çözülür özü (1: 1) ve 180 rpm'de 30 dakika için bir ayırma hunisi içerisinde çalkalayın.
    4. kültür ortamından bileşiği ekstre için, 1 N HCI ilave edilerek pH 4.0 kültür suyu ayarlayın. 100 ml etil asetat ilave edin ve 30 dakika, 180 rpm'de bir ayırma hunisinde sallayın.
    5. Etil asetat fazı toplayın ve çürüme ile buharlaşması 40 ° C'de ve 240 barda li buharlaştırma.
  4. HPLC ile yapılan ham ekstrakt analizi
    1. , 1 mL MeOH içinde çözülür özleri 0.45 um gözenek boyutlu filtre içinden filtre ve yüksek performanslı sıvı kromatografisi (HPLC) 14 çalıştırın.
    2. Polyketomycin durumunda, bir C18 Kolon öncesi (4.6 x 20 mm 2) ve bir C18 kolonu (4.6 x 100 mm x 2) HPLC sistemi donatılması. H% 20 ile% 95 arasında değişen asetonitril +% 0.5 asetik asit arasındaki bir doğrusal eğimi kullanarak 2 O +% 0.5 asetik asit (akış hızı: 0.5 ml dak-1).
      Not: Polyketomycin 25.9 dakikalık bir tutma süresine sahip (Şekil 1A bakınız). UV / vis spektrumu 262 nm ve 359 nm 242 nm, 282 nm, 446 nm ve minimum de maksimumu vardır (Şekil 1B bakınız). Negatif modus 863,2 [MH] + bir kitle - (Şekil 1C bakınız) tespit edilebilir.

"Src =" / files / ftp_upload / 54952 / 54952fig1.jpg "/>
Şekil 1: Polyketomycin LC / MS analizi. 6 gün Streptomyces diastatochromogenes Tü6028 büyütüldükten sonra ham ekstre (A) olarak hazırlanmıştır HPLC kromatogramı (λ = 430 nm). Polyketomycin / vis spektrumları Polyketomycin 25.9 dakika (B), bir UV Tutma süresi vardır. Negatif yöntemlerinde de Polyketomycin (C) Kütle spektrumu. M / z 863,2 ile ana pik [MH] + -. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

  1. Antibiyotik aktivitesinin tanımlanması disk difüzyon deneyi kullanılarak
    1. Gram-pozitif bakteriler, Bacillus subtilis gibi test suşları inoküle (LB ortamında LB 20 g, musluk suyu 1 L pH 7.4) ve TSB ortamı diğer Streptomyces soyları (; triptik soya suyu 30 g, musluk suyu 1 L, pH 7.2), Gram-negatif bakteriler Escherichia LB ortamında coli () ve YPD ortamı olarak ortam mantar suşları (; maya özü, 10 g, pepton 20 g, glukoz 20 g, musluk suyu 1 L, pH 7,4). Test suşu ön kültürün 100 mcL alın ve ilgili agar plakaları üzerine onları yayıldı.
    2. steril kağıt diskler üzerinde metanol (alternatif olarak, su ya da DMSO) ve pipet 20-50 uL 500 uL ham ekstresi ya da saflaştırılmış bileşik içinde çözülür. tezgaha altında 30 dakika süreyle kuru kağıt diskler ve test kültürleri ile plakalar üzerine koydu. Bir negatif kontrol (çözücü) ve pozitif kontrol hazırlanması (antibiyotik, örneğin apramisin [1 mg]).
    3. Test suşları gözle görülür yetiştirilen kadar yeterli koşullar altında inkübe ve belirgin olursa, inhibisyon zonu belirler. E. coli ve Bacillus sp inkübe edin. 16 saat 37 ° C'de, Streptomyces sp. 2-4 gün süreyle 28 ° C 'de, mantar soyu (kesin testi soy esas bağlıdır)t, 2 gün boyunca 30 ° C).

Bileşik 2. Büyük çaplı ekstraksiyon, arıtılması ve yapısının açıklanması

  1. (Suya 1 L, pH 7.2 dokunun glikoz 4 g, maya özü 4 g, malt özü 10 g) 5 L HA ortamında S. diastatochromogenes Yetiştirmek. 150 ml HA ihtiva eden ortam 30 x 500 mL'lik Erlenmeyer şişelerinde ön-kültüre bırakılmıştır 2 mL inoküle. 180 rpm'de döner çalkalayıcıda, 6 gün boyunca 28 ° C'de soy inkübe edin.
  2. santrifüj Hasat hücreleri (10 dk, 15.000 xg, RT) ve etil asetat kullanılarak özü bileşikleri (bölüm 1.3).

şekil 2
Şekil 2: yapı aydınlatmalarında için iş akışı. proses soyunun (1) işleme, (2) ekstraksiyon, katı faz ekstraksiyonu (SPE), ince tabaka kromatografisi (TLC), preparatif yüksek performanslı sıvı kromatografisi (HPLC), boyut (3) ile saflaştırma içermesidirkütle analizi (MS), nükleer manyetik rezonans (NMR) ve X-ışını ölçümleri ile dışlama kromatografisi (SEC) ve (4) yapısının açıklanması,. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

  1. Polyketomycin saflaştırılması
    Not: arıtılması ve yapısının açıklanması işlemi, Şekil 2'de gösterilmektedir.
    1. H2O içinde% 30 ila% 100 MeOH kadar% 10 -stepwise MeOH gradyanı, her durum için, 100 mL kullanılarak bir C 18 katı faz ekstraksiyonu (SPE), kolon Ham özü fraksiyonlanması.
    2. (1: 7) ve elüsyon sistemi hazırlayıcı ince-tabaka kromatografisi (TLC), 15 ile CH2C! 2 / MeOH ayrıca, bileşimin ihtiva fraksiyonu saflaştırılır.
    3. Hazırlayıcı HPLC 16 ile bileşiğin saflaştınlır. ve, bir C18 Kolon öncesi (9.4 x 20 mm 5 um) ile HPLC sistemi donatmakAna kolonu (5 um, 9.4 x 150 mm). H% 20 ila% 95 2 O +% 0.5 asetik asit kadar asetonitril +% 0.5 asetik asit meyili kullanarak (akış hızı: 2.0 mL / dakika).
    4. Çözücüler ve diğer küçük safsızlıkları uzaklaştırmak için, MeOH 17 bir kolon kullanılarak boyut dışlama kromatografisi ile son saflaştırma adımı gerçekleştirmek. Nihai saf bileşiği toplamak ve 40 ° C ve 240 bar, döner buharlaştırma ile MeOH buharlaşır.
  2. yapı aydınlatılması
    1. DMSO-d6 içinde (makineye bağlı olarak) 600-700 uL saf bileşiği (en fazla 2 mg), kayıt 1D NMR (1H, 13 ° C) ve 2D NMR (HSQC, HMBC, 1H 1 H çözülür bir NMR spektrometresi 18 COSY) spektrumları. DMSO-d6 kullanılarak δ değerleri (ppm) cinsinden kimyasal deplasmanlar ifade eder.
    2. Yüksek çözünürlüklü kütle spektrumu (HRESI-MS) yüksek çözünürlük kullanarak polyketomycin 19. kaydedinkütle spektrometresi.
    3. NMR ve MS veri analizi 10 sonuçlarının yorumlanması ile yapısını aydınlatmak.

3. Yeni İzole Bileşik Biyosentetik Modeli Propose

  1. İzole bileşiğin yapısını analiz ve biyosentezi dahil olabilir enzimler, tahmin. Poliketid (tip I, II ya da III), ribozomal olmayan peptid sentezi, lantipeptide terpenoid veya şeker metabolizması yolu 8 bunları atar.
  2. Örnek polyketomycin
    1. tetrasiklik parçasının, iki monosakkaritler ve dimetil salisilik asit: bariz tek kısımlarının içine yapısını Subdivide.
    2. kısımlardan türetilen durumunda, bu bul: tetrasiklik kısmı bir poliketit sentaz türünden türetilmiş olabilir II ve dimetil salisilik asit yarımı yinelemeli bir poliketit sentaz tip I ile elde edilebilir 6-deoxysugars iki şeker bölümlerine, , synthesi olabilirZed biyosentez sırasında TDP-glukoz-4,6-dehidrataz ve iki glikosiltransferazların muhtemelen bağlanmış ilgili glikozdan (bakınız Şekil 3) 8.
    3. kümede varsayılan genleri tahmin. birimlerini bağlayan olarak, hem de değiştirme ve molekül dikiş olarak, tek kısımların sentezinde rol oynayan enzimlerin düşünün. Polyketomycin biyosentetik gen kümesi muhtemelen (genişletici birimleri bağlamak için bu nedenle en az bir ACP, KS α und KS β) bir poliketid sentaz tip II kodlayan genleri içeren bir iteratif poliketid sentaz tip I (en azından ACP, AT, KS), bir TDP-glukoz-4,6-dehidrataz (adım için gerekli: glikoz → deoksiglukoz) ve iki glıkosıltransferaz (aglikona iki şeker monomerleri bağlayan) 8.

Şekil 3,
Şekil 3: Polyketomycin divId deki YapıTek Yapı Taşları içine ed. Polyketomycin β-D-amicetose ve α-L-axenose (MDP-glukoz-4,6, iki deoksi şeker kısımları ile bağlantılı bir tetrasiklik decaketid (PKS tip II) ve dimetil salisilik asit (yinelemeli PKS tip I) oluşmaktadır ) dehidrataz ve iki glikosiltransferaz gerektirir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

4. Genomu Sıralama / Madencilik

  1. Yeni nesil dizileme
    1. Illumina, 454, piro veya katı 20 gibi gelecek nesil dizileme teknolojileri ile genomik DNA sekansı. Tek hizalayın bir referans dizisi okur veya de novo araya.
      NOT: S. diastatochromogenes Tü6028 genomu Bielefeld Üniversitesi Biyoteknoloji Merkezi (CeBiTec) de sıralandı. Tüm taslak genomuna monte edilmiştir okur7.9 Mb.
  2. genom madenciliği
    1. Örnek NCBI Prokaryotik Genom Açıklaması Boru Hattı 21,22 için, RAST 23,24,25, Prokka (hızlı prokaryotik genom açıklama) 26 veya GenDB 27 (hızlı açıklama alt teknolojisini kullanarak) kullanımı ile açık okuma çerçeveleri (ORF) ara. Bu programlar da onların işlevlerini öneriyoruz. S. analizi 7.000 'den fazla ORF belirlenmesine yol açmıştır Tü6028 taslak genom dizisi diastatochromogenes.
    2. Run özel BLAST (Temel Lokal Hizalama Arama Aracı) analizi, diğer benzer genlerin ve katalitik etki 28,29,30 ile hizalanmalarda gibi daha fazla bilgi almak için.
    3. AntiSMASH 31,32,33, NaPDoS 34 ve NRPSpredictor 35,36 gibi ikincil metabolit gen küme çalışma programlarının belirlenmesi için. Streptomyces diastatochromogenes antiSMASH 31,32,33 kimliğin taslak genomunda22 gen kümeleri fied.
    4. enzimatik yol (lar) için olası bir gen kümeleri (poliketid sintazı (tip I, II ya da III), ribozomal olmayan peptid sintetaz, lanthipeptide terpenoid, şeker metabolizması ...) analiz eder. bileşiğin sentezinde rol oynayabilecek genleri içeren küme (ler) ara (Bölüm 3). S. diastatochromogenes açıklamalı küme 2 poliketid sentaz tip II genleri, üç poliketid sentaz tip I genleri, bir TDP-glikoz-4,6-dehidrataz gen ve iki glıkosıltransferaz genleri (bakınız Şekil 4) içerir.
    5. küme içinde tek genler odaklanın. PKS tip I ve NRPS açiltransferazlar ve adenylation etki özgüllüğü ve böylece tek genişletici birimleri dahil edilmesi için, tahmin edilebilir. Ayrıca molekülü ile birleşmiş genişletici biriminin sırasını karşılaştırın. antiSMASH 31,32,33 ayrıca MIBiG veritabanına 37 bir bağlantı ile, zaten bilinen bileşiklerin benzer kümeleri gösterir. bu bileşikler ile bileşiğin yapısını karşılaştırmak ve benzerlikleri kontrol edin.

Şekil 4,
Şekil 4: S. Polyketomycin Biyosentetik Gen Kümesi ve Diğer Kümeleri Genel Bakış antiSMASH Çıktı Tü6028 diastatochromogenes. (A) S. genomu tahmin biyosentetik gen kümeleri genel Tü6028 diastatochromogenes; Hedeflenen genleri ile (B) Küme 2 Polyketomycin biyosentetik gen kümesi. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Biyosentetik Gen Cluster 5. Doğrulama

  1. bileşiğin biyosentezi için açık ve önemli (esansiyel) fonksiyonları ile bir genin arayın. polyketo doğrulanması içinPKS tip II ketosintaz a kodlayan gen pokPI bil gen kümesi, çerçeve -deletion dışı bir (Şekil 5B bakınız) tarafından seçilen ve inaktive edildi. Seçenek olarak ise, bir iç fragmanının klonlanmasıyla geni kesme (Şekil 5C bakınız).

Şekil 5,
Şekil 5: Tek Crossover tarafından Gen Kümesi doğrulanması. (A), yerel genin işlevsel bir protein çevirisi yol açar; Intihar vektörü içine içi silme olan genin (B) klonlanması hedeflenen gen ve fonksiyonel olmayan proteininin bunu takip eden çeviride bir çerçeve kayması ile sonuçlanan tek bir geçit yol; Intihar vektörü içine genin bir iç fragmanının (C) klonlanması geni ve işlevsel olmayan bir protein daha sonra bir çeviri kesme yol açar. oriT: t kökeniransfer; antibiyotik R: antibiyotik direnci. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

  1. Tek geçiş yapısının klonlanması
    1. Primerleri pokPI_for ve pokPI_rev ile PCR 38 tarafından pokPI ihtiva eden bir parça yükseltmek.
    2. İntihar vektörüne klon PCR ürünü, pKC1132 39 (R apramisin [50 mg / ml]). Intihar vektörü Streptomyces suşu içinde replike mümkün değildir ve bu nedenle apramisin karşı koymak için homolog rekombinasyon ile hedef gen içine entegre sahiptir. Isı şok dönüşümü 40 tarafından host klonlama E. coli içine vektör aktarın.
    3. Alkalin lizis 41 ile vektör izole edin.
    4. fragmanı içinde kesen bir tek kesici kısıtlama enzimi ile vektör DNA sindiremez. pokPI genE ile sindirildi Enzim Kpn I
    5. 5 '→ 3' polimeraz aktivitesi ve 3 '→ 5' eksonükleaz aktivitesi olan büyük DNA polimeraz I (Klenow) fragmanı ile sindirilmiş vektör DNA'sı tedavi edin. Yapışkan uçların kuntleştırılmesını ve sonra religasyon dört bazdan kaybına neden olur. Plazmid DNA, 41 yalıtma ve sınırlama sindirim ve sıralama ile daha analiz, tek koloniler toplama, E. coli XL1 Blue içine adımlar dönüşüm bu üslerin kaybı olup olmadığını kontrol edin.
  2. Tek geçit çekimi Streptomyces içine inşa
    1. Isı şok dönüşümü 40 E. coli ET12567 pUZ8002 42 (kanamisin R) içine silinmesi ile pokPI genini (pKC1132_ pokPI del) içeren intihar vektörü aktarın. 100 mL LB ortamında inkübe hücreleri (kanamisin 50 ug ml -1, apramisin 50 mg ml -1
    2. Mix 500 uL E. coli pUZ8002 pKC1132_ pokPI del 500 uL Streptomyces diastatochromogenes kültürü ile (alternatif sporlar kullanın). MS plakaları üzerinde karışım (soya unu 20 g D-mannitol, 20 g, MgCl2 10 mM,% 1.5 ağar, musluk suyu 1 L) yayıldı. 28 ° C'de 20 saat süreyle inkübe edin.
    3. apramisin (1.25 mg) ve 1 mL su içinde çözülmüş fosfomisin (5 mg) ile her plaka Yerleşimi ve kurumaya bırakın. exconjugants görünene kadar 28 ° C 'de pek çok gün süre ile inkübe edin.
  3. Tek geçiş mutantlar kontrol
    1. 20 ml TSB ortamı (50 mg mL apramisin-1) tek exconjugants inoküle ve üç gün boyunca 180 rpm'de 28 ° C'de inkübe.
    2. Genomik DNA 43 yalıtmak ve PCR ile pokPI geninin kesintiye kontrol edin.
    3. 100 ml HA ortam içinde belirlenmiş gen kesintisiz Streptomyces vahşi tip suş ile tek klonlar inoküle ve 28 ° C ve 180 rpm'de 6 gün süreyle inkübe edilir. Ham özü (bölüm 1.3) ayıklayın. HPLC-MS analizi ile bileşik üretimini kontrol edin (bölüm 1.4). HPLC kromatogramı karşılık gelen tepe ve bileşik kütlesi daha fazla tespit olmamalıdır (bakınız Şekil 6).

Şekil 6,
Şekil 6: İnaktif pokPI Gene S. diastatochromogenes HPLC analizi. S. ham ekstre HPLC kromatogramıdır (λ = 430 nm) kesintiye pokPI -gen (aşağıda) WT (üst) ve mutant suşu diastatochromogenes. mutant suş artık polyketomycin üretmez.Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Representative Results

Bu genel olarak biz onun biyosentetik gen kümesi giden bir antibiyotiğin belirlenmesi gelen tek adımları açıklar. Bir çok yıl önce faj içine ambalajlanmış bir kozmid kütüphanesi, klonlanmış E. coli konakçı hücreleri transdüse ve polyketomycin kümenin üst üste bölgelerine sahip klonları tanımlamak için koloni binlerce taranması için vardı. Kozmid sıralaması da zor ve pahalı bir süreç 12 idi.

Suşu üzerinde ileri çalışmalar yapmak üzere biz Streptomyces diastatochromogenes Tü6028 bütün genom dizisi. Taslak genom dizisi ile kolayca polyketomycin ve gelecek vaat eden bileşikleri kodlayan diğer kümelerin biyosentetik gen kümesi belirledi. Şekil 7 genetik materyali ve elaborative tarama klonlanması ile biyosentetik küme belirleme "eski" yöntemi karşılaştırır vekaba bir zaman ölçeğinde sonraki genom madenciliği ile tüm genom dizileme ile "yeni" yöntemi. Yeni sıralama teknolojiler ve yeni genom madenciliği programları tüm süreci hızlandırmak.

Şekil 7,
Şekil 7: Bir Biyosentetik Gen küme atama ve "Eski" ve "Yeni" Yöntem Karşılaştırılması. "Eski" yöntemi pozitif klonların seçilmesi ve söz konusu kozmid (ler) sekanslanması ile kozmid kitaplığı klonlanmasını (yukarıda) ihtiva eder; "Yeni" yöntemi, tüm genom sekanslama ve gerginlik (aşağıda) genomu üzerinde bulunan tüm ikincil metabolit gen kümeleri tespit etmek -Maden içerir. Tek adımlar Süresi kaba bir zaman ölçeğinde gösterilir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Discussion

Bu laboratuvarda Streptomyces diastatochromogenes bir genomik kosmid kütüphanesi oluşturulur ve bir son derece zaman alıcı bir işlem yoluyla polyketomycin gen kümesinin tanımlanması ile sonuçlanan, birçok yıl önce elenmiştir. Tek gen karakterizasyonu hedefli gen silme ve elde edilen mutantlar 12 analizi ile mümkün oldu. Son zamanlarda, S. diastatochromogenes bir taslak genom dizisi polyketomycin biyosentetik gen kümesinin hızlı tanımlanmasına olanak elde edilmiştir. Taslak genom dizisi hala birçok kontig içermesine rağmen biz kolayca, biyosentetik genleri tespit olabilir. Tarif edilen işlem ay içinde elde edilebilir. Bununla birlikte, işlem bir çok aşamaları içerir. Tek adımlar sonraki aşamalara ilerlemesini engelleyen, birkaç kez başarısız olabilir:

Streptomyces cinsinin biyolojik olarak aktif bileşiklerin üretimi için kapasitesi ile tanınır. genellikle 20'den fazla bios taşırkengenellikle, bir ya da iki bileşiğin laboratuar koşullarında üretilen ynthetic gen kümeleri. Sessiz gen kümeleri uyanmak OSMAC yaklaşımı (farklı koşullar altında bir gerginlik ekimi) uygulaması bazen yeterli olmayabilir. Böyle pleiotropik regülatör genlerin ADPA 44 ve bldA 45,46 gibi düzenleyici genlerin, genetik manipülasyon, diğer sekonder metabolitlerin üretimini aktive etmek için etkili bir yöntemdir.

NMR analizi ile, örneğin bileşiğin yapısının aydınlatılması için, arıtılmış, bileşiğin, genellikle en fazla 2 mg gereklidir. Bu nedenle, en fazla 10 L fermentasyon sıklıkla gerekmektedir. oksijen, pH ve sıcaklık koşulları sağlamak için mümkün olan bir fermentasyon olmadan, kültür ve daha sonra ekstre bu miktar ele küçük laboratuarda zor olabilir. saflaştırma sırasında bileşiğin, oksidasyonu, radyasyon ya da ısı ile değiştirilebilir.Ayrıca, daha çok arıtma aşamaları daha yüksek degradasyon şansı kullanılır.

doğal bir ürün yapısını ve genomunda kümeleri analiz ederken, bazen uygun kümeyi tanımlamak o kadar kolay değildir. sadece bir taslak genom dizisi varsa Birincisi, kümenin bir kısmı eksik olabilir. İkincisi, biyosentezi için gerekli olan tüm genler kümede değildir. Üçüncü olarak, zaman zaman, bir küme çok sayıda kilobaz birbirinden ayrılan iki parçaya bölünür. Dördüncüsü, uygun gen kümesi olan bir karar vermek zor olabilir. modüllerin sayısına göre genişletme birimleri sayısını hesaplamak ya da seçerek etki analizi ile tek genişletici birimlerini tanımlamak mümkündür büyük PKS tipi I veya NRPS sistemleri durumunda, kolayca ortaya çıkar. Bununla birlikte, lineer olmayan çalışma durumunda sentezlenen bileşiklerin tahmini, özellikle stra ise, genellikle mümkün değildir enzimleri40'dan fazla gen kümeleri vardır. Beşinci olarak, doğal oldukça karmaşık ve henüz bilinmeyen bileşikler doludur. Genellikle biyosentez farklı yollar bir karışımıdır. Yeni bileşik başka bileşiğe ilişkin henüz tespit veya değilse, bir biyosentez modeli önermek ve bunu kanıtlamak için, kümeyi tanımlamak zor olabilir.

küme tespit edildikten sonra, tek geçit tekniği hipotezi doğrulamak için bir iyi ve hızlı bir yöntemdir. PCR, bir intihar vektörü, konjugasyon, pozitif klonların seçimi ve üretim tahlil klonlama gereken tek adımlardır. Bu tekniğin bir dezavantajı, kromozomuna vektörü bütünleştirilmesi nedeniyle daha da rekombinasyon olayları stabil değildir olmasıdır. Bu nedenle, daha fazla tek genler analiz etmek amacıyla, hassas gen silme gerekmektedir. Ayrıca genetik düzeyde Streptomyces suşları manipüle etmek zor olabilir.

açıklanan prosedür t atanabilirStreptomyces suşu ya da başka bir mikroorganizma tarafından üretilen herhangi bir O bileşiği. Bir biyosentetik gen küme ve sentezlenen bileşik hakkında bilgi bize çok ilaca dirençli patojenlere karşı mücadele için onları geliştirmek amacıyla mevcut molekülleri değiştirmek için daha fazla fırsat verir.

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
dan Polyketomycin kullanma A Gösteri: Its Biyosentetik Gen kümesi için bir Doğal Ürün dan<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter