Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

من المنتج الطبيعي إلى Its العنقودية السكروز جين: تظاهرة طريق Polyketomycin من doi: 10.3791/54952 Published: January 13, 2017

Summary

هنا نقدم بروتوكول مفصلة من (أ) تحديد نتاج طبيعي مع النشاط المضاد الحيوي، (ب) تطهير المجمع (C) النموذج الأول من الحيوي لها، (D) تسلسل الجينوم / -mining و( E) التحقق من الكتلة التخليق الحيوى الجينات.

Abstract

ومن المعروف أن سلالات السبحية لقدرتها على إنتاج الكثير من مركبات مختلفة مع مختلف bioactivities. زراعة في ظل ظروف مختلفة وغالبا ما يؤدي إلى إنتاج مركبات جديدة. لذلك، يتم استخراج الثقافات إنتاج سلالات مع خلات الإيثيل ويتم تحليل المستخلصات الخام بواسطة HPLC. وعلاوة على ذلك، يتم اختبار مقتطفات عن النشاط الحيوي من خلال فحوصات مختلفة. لبنية توضيح وتنقية مجمع الفائدة عن طريق مزيج من أساليب اللوني مختلفة.

تسلسل الجينوم جانب التعدين الجينوم يسمح بتحديد مجموعة المنتجات الطبيعية التخليق الحيوى الجينات باستخدام برامج الكمبيوتر المختلفة. لتأكيد أن تم التعرف على مجموعة الجينات الصحيحة، والتجارب تثبيط الجين يجب أن تؤديها. ويتم تحليل المسوخ الناتجة عن إنتاج منتج طبيعي معين. مرة واحدة وقد تم المعطل الكتلة الجينات الصحيحة،يجب أن تفشل سلالة لإنتاج مركب.

يظهر العمل للpolyketomycin مركب مضاد للجراثيم التي تنتجها السبحية diastatochromogenes Tü6028. منذ حوالي عشر سنوات، عندما كان تسلسل الجينوم لا تزال مكلفة للغاية، وكان الاستنساخ وتحديد مجموعة الجينات عملية تستغرق وقتا طويلا جدا. سريع تسلسل الجينوم جنبا إلى جنب مع التعدين الجينوم يسرع محاكمة تحديد العنقودية ويفتح طرق جديدة لاستكشاف الحيوي وتوليد المنتجات الطبيعية رواية بالطرق الوراثية. بروتوكول وصفها في هذه الورقة يمكن أن تسند إلى أي مركب آخر المستمدة من سلالة السبحية أو الكائنات الحية الدقيقة آخر.

Introduction

وكانت منتجات الطبيعية من النباتات والكائنات الحية الدقيقة دائما مصدرا هاما لتطوير العقاقير السريرية والبحوث. تم اكتشاف أول البنسلين المضادات الحيوية في عام 1928 من فطر بواسطة الكسندر فليمنغ 1. في الوقت الحاضر، وتستخدم العديد من منتجات طبيعية أكثر في العلاج السريري.

واحد جنس المعروف عن قدرته على إنتاج أنواع مختلفة من المركبات الثانوية مع bioactivities المختلفة هو السبحية. السبحية هي إيجابية الجرام البكتيريا وتنتمي إلى فئة من شعاويات والنظام الشعاوات. وتستمد ما يقرب من ثلثي من المضادات الحيوية المستخدمة سريريا من الشعاوات، ومعظمهم من السبحية، مثل أمفوتيريسين daptomycin 3 أو التتراسيكلين (4). وقد تم منح جائزتي نوبل في مجال السبحية البحوث المضادات الحيوية. ذهب أول من سلمان واكسمان لاكتشاف الستبرتوميسين، وعلى الأولtibiotic فعالة ضد مرض السل. 5 في عام 2015، كجزء من جائزة نوبل في علم وظائف الأعضاء والطب، وحصل على اكتشاف أفيرميكتين من avermitilis S. كذلك. يستخدم أفيرميكتين لعلاج الأمراض الطفيلية 6،7.

النهج التقليدي لاكتشاف المنتجات الطبيعية في الكائنات الحية الدقيقة مثل السبحية ينطوي عموما زراعة سلالة في ظل ظروف النمو المختلفة، وكذلك استخراج وتحليل المركبات الثانوية. يتم إجراء فحوصات النشاط الحيوي (على سبيل المثال فحوصات للنشاط مضاد للبكتيريا ومضاد للسرطان) للكشف عن نشاط المجمع. وأخيرا، يتم عزل مجمع الفائدة وإجمال التركيب الكيميائي.

وغالبا ما تتكون هياكل المنتجات الطبيعية من الأنصاف واحدة والتي تشكل الجزيئات المعقدة. وهناك عدد قليل، ولكن محدودة، مسارات السكروز الرئيسية المؤدية إلى بناء كتلةكانساس، والتي تستخدم لالحيوي من المنتجات الطبيعية. مسارات السكروز الرئيسية هي مسارات متعدد الكيتيد والممرات المؤدية إلى تيربينويدس وقلويدات والممرات باستخدام الأحماض الأمينية، والممرات المؤدية إلى الأنصاف السكر. ويتميز كل مسار من قبل مجموعة من إنزيمات معينة (8). وبناء على هيكل المركبة، هذه الإنزيمات السكروز يمكن التنبؤ بها.

في الوقت الحاضر، فإن التحليل الهيكلي التفصيلي للمجمع في تركيبة مع تسلسل الجيل القادم وتحليل بيوينفورمتيك يمكن أن تساعد على تحديد الكتلة الجين السكروز المسؤولة. يفتح المعلومات العنقودية طرقا جديدة لإجراء مزيد من البحوث المنتجات الطبيعية. وهذا يشمل تعبير مغايرة لزيادة الغلة من المنتجات الطبيعية، وتعديل المجمع الذي استهدفته الغارة بالحذف الجينات أو التعديل والحيوي اندماجي مع جينات من المسارات الأخرى.

تم عزل Polyketomycin بشكل مستقل من مرق ثقافةسلالتين، السبحية ليرة سورية. MK277-AF1 9 و السبحية diastatochromogenes Tü6028 10. تم توضيح الهيكل من خلال تحليل الرنين المغناطيسي والأشعة السينية. يتكون Polyketomycin من decaketid tetracyclic وحمض الصفصاف ثنائي ميثيل، وترتبط من قبل اثنين من الأنصاف deoxysugar β-D-amicetose وα-L-axenose. فإنه يعرض السامة للخلايا ونشاط المضادات الحيوية، حتى ضد سلالات البكتيريا إيجابية الغرام المقاوم للأدوية المتعددة مثل هذه الجرثومة 11.

تم إنشاء مكتبة كوزميد الجينومية س diastatochromogenes Tü6028 وفحص منذ سنوات عديدة. باستخدام جين معين تحقيقات الكتلة الجين polyketomycin بحجم 52.2 كيلوبايت، التي تحتوي على 41 الجينات، وتبين بعد عدة أشهر من العمل المكثف 12. مؤخرا، تم الحصول على تسلسل مشروع جينوم diastatochromogenes س تؤدي إلى تحديد سريع من الكتلة الجين السكروز polyketomycin. في هذا الاستعراض، وهي طريقة تساعد في الاتساعمنظمة حددت منتج طبيعي وتوضيح وسوف نتناول مجموعة الجين السكروز، وذلك باستخدام polyketomycin كمثال على ذلك.

نحن هنا شرح الخطوات واحدة والتي تؤدي من نتاج طبيعي لمجموعة لها الجين السكروز تعرض لpolyketomycin التي تنتجها السبحية diastatochromogenes Tü6028. ويضم بروتوكول تحديد وتنقية نتاج طبيعي مع خصائص المضادات الحيوية. التحليل البنيوي أخرى، ومقارنة مع النتائج من الجينوم التعدين تؤدي إلى تحديد مجموعة الجينات السكروز. ويمكن تطبيق هذا الإجراء على أي مركبة أخرى مستمدة من سلالة السبحية أو أي الكائنات الحية الدقيقة الأخرى.

Protocol

1. تحديد نتاج طبيعي مع المضادات الحيوية الملكية

  1. زراعة الكائنات الحية الدقيقة في ظل ظروف مختلفة (مثل الوقت ودرجة الحرارة، ودرجة الحموضة، وسائل الإعلام) في أعقاب "OSMAC (سلالة واحدة، العديد من المركبات) نهج" 13. اختر واحدة متوسطة الذي لوحظ إنتاج مركب.
  2. زراعة السبحية diastatochromogenes Tü6028 وفقا للشروط التالية
    1. تنمو السبحية diastatochromogenes سلالة Tü6026 على لوحات MS (طحين الصويا 20 غراما، D-مانيتول 20 غراما، MgCl 2 10 ملم، أجار 1.5٪، صنبور الماء 1 لتر). تطعيم حلقة صغيرة من الجراثيم من هذه السلالة إلى 20 مل TSB السائل المتوسطة (فول الصويا زيتية مرق 30 ز، ماء الصنبور 1 لتر، ودرجة الحموضة 7.2، preculture المتوسطة) في دورق مخروطي مع دوامة. هز قارورة على شاكر دوارة (28 درجة مئوية، 180 دورة في الدقيقة، 2 أيام).
    2. تطعيم ثقافة الرئيسية في 100 مل المتوسطة HA (الجلوكوز 4 ز، خلاصة الخميرة 4 ز، الشعيراستخراج 10 غرام، صنبور الماء 1 لتر، ودرجة الحموضة 7.2) مع 2 مل من preculture. ثقافة السلالة في 28 درجة مئوية لمدة 6 أيام على شاكر دوارة في 180 دورة في الدقيقة.
  3. إعداد استخراج النفط الخام
    1. حصاد الخلايا بواسطة الطرد المركزي (10 دقيقة، 3000 x ج).
    2. للخطوات التالية التعامل مع المذيبات العضوية تحت غطاء الدخان.
    3. لاستخراج المركب من المشيجة، وخلايا resuspend في حجم مزدوج من الأسيتون ويهز في أنبوب لمدة 30 دقيقة، 180 دورة في الدقيقة. تصفية السائل من خلال ورقة مرشح التجارية وتتبخر الأسيتون بواسطة المبخر الدوار عند 40 درجة مئوية و 550 بار. حل استخراج في 20 مل من الماء: خلات الإيثيل (1: 1) والتخلص منه في قمع فصل لمدة 30 دقيقة في 180 دورة في الدقيقة.
    4. لاستخراج المركب من مستنبت، وضبط مرق الثقافة لدرجة الحموضة 4.0 بإضافة 1 M حمض الهيدروكلوريك. إضافة 100 مل خلات الإيثيل والتخلص منه في قمع فصل لمدة 30 دقيقة، 180 دورة في الدقيقة.
    5. جمع مرحلة خلات الإيثيل وتتبخر قبل تعفن تبخر آرى عند 40 درجة مئوية و 240 بار.
  4. تحليل استخراج النفط الخام من قبل HPLC
    1. حل مقتطفات في 1 مل MeOH، تصفية لهم من خلال مرشح حجم 0.45 ميكرون المسام وتشغيل عالية الأداء اللوني السائل (HPLC) 14.
    2. في حالة polyketomycin، تجهيز نظام HPLC مع precolumn C18 (4.6 × 20 ملم 2) وعمود C18 (4.6 × 100 مم 2). استخدام الانحدار الخطي من الأسيتونتريل + 0.5٪ حامض الخليك تتراوح ما بين 20٪ إلى 95٪ في H 2 O + 0.5٪ (معدل التدفق: 0.5 مل دقيقة -1) حامض الخليك.
      ملاحظة: Polyketomycin لديه الوقت الإبقاء على 25.9 دقيقة (انظر الشكل 1A). الطيف للأشعة فوق البنفسجية / فيما ديه ماكسيما في 242 نانومتر و 282 نانومتر و 446 نانومتر والدنيا في 262 نانومتر و 359 نانومتر (انظر الشكل 1B). في عمل سلبي كتلة من 863.2 [MH] - يمكن كشفها (انظر الشكل 1C).

"SRC =" / ملفات / ftp_upload / 54952 / 54952fig1.jpg "/>
الشكل 1: LC / MS تحليل Polyketomycin. (A) HPLC اللوني (λ = 430 نانومتر) من استخراج النفط الخام بعد زراعة السبحية diastatochromogenes Tü6028 لمدة 6 أيام. Polyketomycin لديه الوقت الإبقاء على 25.9 دقيقة (B) للأشعة فوق البنفسجية / فيما أطياف Polyketomycin. (C) قداس أطياف Polyketomycin في عمل سلبي. ذروة الرئيسي مع م / ض 863.2 [MH] -. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

  1. التعرف على النشاط المضاد الحيوي باستخدام القرص نشر فحص
    1. تطعيم سلالات اختبار مثل الرقيقة إيجابية الجرام البكتيريا العصوية (في LB المتوسطة، LB 20 غراما، صنبور الماء 1 لتر، ودرجة الحموضة 7.4) وغيرها من السلالات المتسلسلة (في TSB المتوسطة. زيتية مرق الصويا 30 غراما، صنبور الماء 1 لتر، ودرجة الحموضة 70.2)، والبكتيريا سالبة الجرام كولاي (في LB المتوسطة) والسلالات الفطرية (في وسائل الإعلام مثل YPD المتوسطة، خلاصة الخميرة 10 ز، ببتون 20 غراما، الجلوكوز 20 غراما، صنبور الماء 1 لتر، ودرجة الحموضة 7.4). أخذ 100 ميكرولتر من اختبار سلالة preculture ونشرها على لوحات أجار منها.
    2. حل استخراج النفط الخام أو المركب النقي في 500 ميكرولتر من الميثانول (بدلا من الماء أو DMSO) وماصة 20-50 ميكرولتر على أقراص رقة معقمة. أقراص ورقية جافة لمدة 30 دقيقة تحت مقاعد البدلاء العمل ووضعها على لوحات مع الثقافات اختبار. إعداد سيطرة سلبية (المذيبات) والسيطرة الايجابية (المضادات الحيوية، مثل أبراميسين [1 ملغ]).
    3. احتضان لوحات في ظل ظروف مناسبة حتى تزرع سلالات اختبار واضح وتحديد منطقة التثبيط، إذا اضحة. احتضان E. coli و س العصوية. عند 37 درجة مئوية لمدة 16 ساعة، السبحية ليرة سورية. عند 28 درجة مئوية لمدة 2-4 أيام، سلالة الفطرية (التي تعتمد أساسا على سلالة اختبار دقيق) لر 30 درجة مئوية لمدة 2 أيام).

2. كبير استخراج مقياس وتنقية والبنية توضيح من مجمع

  1. زراعة diastatochromogenes س في 5 L المتوسطة HA (الجلوكوز 4 ز، خلاصة الخميرة 4 ز، الشعير استخراج 10 غرام، ماء الصنبور 1 لتر، ودرجة الحموضة 7.2). تطعيم 2 مل من preculture في 30 × 500 قوارير مل مخروطي يحتوي على 150 مل HA المتوسطة. احتضان سلالة عند 28 درجة مئوية لمدة 6 أيام على شاكر دوارة في 180 دورة في الدقيقة.
  2. حصاد الخلايا بواسطة الطرد المركزي (10 دقيقة، 15000 x ج، RT) واستخراج المركبات باستخدام خلات الإيثيل (انظر القسم 1.3).

الشكل 2
الشكل 2: سير العمل لبنية التوضيح. وتشمل عملية (1) زراعة سلالة، (2) استخراج، (3) تنقية عن طريق استخراج الصلبة مرحلة (SPE)، طبقة رقيقة اللوني (TLC)، إعدادي عالية الأداء اللوني السائل (HPLC)، وحجماللوني الاستبعاد (SEC) و (4) توضيح الهيكل عن طريق التحليل الشامل (MS)، الرنين النووي المغناطيسي (NMR) وقياسات الأشعة السينية. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

  1. تنقية Polyketomycin
    ملاحظة: عملية تنقية وبنية التوضيح هو مبين في الشكل 2.
    1. يجزئ استخراج النفط الخام بحسب هذا العامود C18 الصلبة مرحلة الاستخراج (SPE) باستخدام 10٪ -stepwise التدرج MeOH تتراوح ما بين 30٪ إلى 100٪ MeOH في H 2 O، 100 مل لكل حالة.
    2. تنقية جزء التي تحتوي على مركب مزيد من إعدادي اللوني طبقة رقيقة (TLC) 15 باستخدام CH 2 الكلورين 2 / MeOH (7: 1) كنظام شطف.
    3. تنقية المركب من قبل HPLC إعدادي 16. تجهيز نظام HPLC مع precolumn C18 (5 ميكرون، 9.4 × 20 ملم) والعمود الرئيسي (5 ميكرون، 9.4 X 150 مم). استخدام التدرج من حمض الخليك الأسيتونتريل + 0.5٪ تتراوح بين 20٪ إلى 95٪ في H حامض الخليك 2 O + 0.5٪ (معدل التدفق: 2.0 مل / دقيقة).
    4. لإزالة المذيبات وغيرها من الشوائب الصغيرة، وإجراء تنقية الخطوة الأخيرة قبل استبعاد حجم اللوني باستخدام عمود في MeOH 17. جمع المركب النقي النهائي وتتبخر MeOH عن طريق التبخر دوار عند 40 درجة مئوية و 240 بار.
  2. توضيح هيكل
    1. حل المركب النقي (أكثر من 2 ملغ) في 600-700 ميكرولتر (هذا يعتمد على الجهاز) من DMSO- د سجل 1D NMR (113 C) و 2D NMR (HSQC، HMBC، 1 ح 1 ح مريح) الأطياف على مطياف الرنين المغناطيسي النووي (18). التعبير عن التحولات الكيميائية في القيم δ (جزء في المليون) باستخدام DMSO- د 6.
    2. تسجيل الطيف الكتلي عالية الدقة (HRESI-MS) 19 من polyketomycin باستخدام عالية الدقةمطياف الكتلة.
    3. توضيح الهيكل من خلال تفسير نتائج تحليل البيانات الرنين المغناطيسي النووي وMS 10.

3. اقتراح السكروز نموذج للمجمع معزولة جديد

  1. تحليل بنية مجمع معزول والتنبؤ والإنزيمات، والتي قد يكون متورطا في التركيب الحيوي لها. التنازل عنها لمتعدد الكيتيد (النوع الأول أو الثاني أو الثالث)، الببتيد التوليف غير الريباسي، lantipeptide، terpenoid، أو السكر الأيض المسار 8.
  2. مثال polyketomycin
    1. تقسيم الهيكل إلى الأنصاف واضحة واحدة: شاردة tetracyclic، واثنين من السكريات الأحادية وحمض الصفصاف ثنائي ميثيل.
    2. معرفة، حيث يمكن أن تستمد الأنصاف من: يمكن أن تستمد شاردة tetracyclic من نوع متعدد الكيتيد سينسيز الثاني ويمكن أن تستمد شاردة حمض الساليسيليك ثنائي ميثيل قبل تكرارية متعدد الكيتيد نوع سينسيز أولا الأنصاف السكر اثنين، والتي هي 6 deoxysugars ، قد يكون synthesiزد من الجلوكوز التي تنطوي على TDP-الجلوكوز 4،6-نازعة الماء أثناء الحيوي وتعلق على الأرجح من قبل اثنين من glycosyltransferases (انظر الشكل 3) 8.
    3. التنبؤ الجينات المفترضة في الكتلة. اعتقد من الانزيمات التي تشارك في توليف الأنصاف واحدة، في ربط وحدة، وكذلك في تعديل وتكييف الجزيء. الكتلة التخليق الحيوى الجينات من Polyketomycin على الأرجح يحتوي على جينات ترميز نوع متعدد الكيتيد سينسيز الثاني (وبالتالي الحد الأدنى لACP، KS α اوند KS β لربط وحدات الموسع)، والتكرار نوع متعدد الكيتيد سينسيز أنا (على الأقل ACP، AT، KS)، وهو TDP-الجلوكوز 4،6-نازعة الماء (ضروري للخطوة: الجلوكوز → deoxyglucose) واثنين من glycosyltransferases (ربط اثنين أحادية السكر إلى الجزء اللاسكري) 8.

الشكل (3)
الرقم 3: هيكل Polyketomycin Dividإد في واحدة لبنات البناء. يتكون Polyketomycin من decaketid tetracyclic (PKS النوع الثاني) وثنائي ميثيل حمض الصفصاف (تكرارية PKS النوع الأول)، ويربطها به الأنصاف deoxysugar اثنين β-D-amicetose وα-L-axenose (الحاكم الجلوكوز-4،6- نازعة الماء واثنين من ناقلة الغليكوزيل المطلوبة). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

4. تسلسل الجينوم / التعدين

  1. الجيل القادم التسلسل
    1. تسلسل الحمض النووي الجيني من تقنيات التسلسل الجيل القادم مثل البورشيد، 454 سلسلة البايرو أو الصلبة 20. محاذاة احد يقرأ لتسلسل إشارة أو التجمع من جديد.
      ملاحظة: تم التسلسل الجينوم س diastatochromogenes Tü6028 في مركز التكنولوجيا الحيوية (CeBiTec) في جامعة بيليفيلد. جميع يقرأ تم تجميعها لمشروع الجينوم7.9 ميجا بايت.
  2. التعدين الجينوم
    1. البحث عن أطر القراءة المفتوحة (ORFS) عن استخدام على سبيل المثال NCBI بدائيات النوى الجينوم الشرح خط 21،22، راست (الشرح السريع باستخدام تكنولوجيا الفرعي) 23،24،25، Prokka (السريع في بدائيات النواة الجينوم الشرح) 26 أو GenDB 27. كما تقترح هذه البرامج وظائفهم. تحليل S. diastatochromogenes Tü6028 مشروع الجينوم تسلسل أدى إلى التعرف على أكثر من 7000 ORFS.
    2. تشغيل انفجار معين (أساسي المحلية محاذاة البحث أداة) تحليل للحصول على المزيد من المعلومات مثل التحالفات مع جينات أخرى مماثلة والمجالات الحفازة 28،29،30.
    3. للتعرف على البرامج العنقودية المدى الثانوية الأيض الجينات مثل antiSMASH 31،32،33، NaPDoS 34 و NRPSpredictor 35،36. في مشروع جينوم السبحية diastatochromogenes antiSMASH 31،32،33 هوية منذfied 22 مجموعات الجينات.
    4. تحليل مجموعات الجينات المفترضة للمسار على الأنزيمي (ق) (متعدد الكيتيد سينسيز (النوع الأول أو الثاني أو الثالث)، غير الريبوسومي مخلقة الببتيد، lanthipeptide، terpenoid، التمثيل الغذائي للسكر ...). البحث عن الكتلة (ق) التي تحتوي على الجينات التي قد يكون متورطا في تركيب المركب (انظر القسم 3). في diastatochromogenes S. المشروح المجموعة 2 تحتوي متعدد الكيتيد نوع سينسيز الثاني الجينات، ثلاثة متعدد الكيتيد نوع سينسيز أنا الجينات، الجينات TDP-الجلوكوز 4،6-نازعة الماء واثنين من الجينات ناقلة الغليكوزيل (انظر الشكل 4).
    5. التركيز على جينات مفردة داخل الكتلة. لنوع PKS الأول وNRPS خصوصية acyltransferases والمجالات adenylation، وبالتالي إدراج وحدات الموسع واحد، ويمكن التنبؤ بها. أيضا مقارنة أجل وحدة الموسع تدمج مع الجزيء. يظهر antiSMASH 31،32،33 أيضا مجموعات مماثلة من مركبات معروفة، مع وصلة الى قاعدة بيانات MIBiG 37. قارن هيكل المركب مع هذه المركبات الأخرى، وتحقق من أوجه التشابه.

الشكل (4)
الشكل 4: إخراج antiSMASH من Polyketomycin السكروز جين العنقودية ونظرة عامة على مجموعات أخرى في S. diastatochromogenes Tü6028. (أ) لمحة عامة عن مجموعات الجينات السكروز توقع في جينوم S. diastatochromogenes Tü6028. (ب) المجموعة 2 Polyketomycin مجموعة التخليق الحيوى الجينات مع الجينات المستهدفة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

5. التأكيد من الكتلة السكروز جين

  1. بحث عن الجينات مع وظائف واضحة ومهمة (الأساسية) لالحيوي للمجمع. للتحقق من polyketoمجموعة الجينات mycin وpokPI الجينات، والترميز للα ketosynthase من نوع PKS الثاني، وقد تم اختيار والمعطل من قبل خارج الإطار -deletion (انظر الشكل 5B). بدلا من ذلك، يقطع الجينات عن طريق الاستنساخ شظية الداخلي (انظر الشكل 5C).

الرقم 5
الرقم 5: التحقق من كتلة جين واحد من قبل كروس. (A) الجينات الأصلية يؤدي إلى ترجمة بروتين فعال. (ب) الاستنساخ من الجينات مع حذف الداخلي في ناقلات انتحاري يؤدي إلى تقاطع واحد مما أدى إلى تحول الإطار في الجينات المستهدفة والترجمة اللاحقة للبروتين غير وظيفية. (ج) الاستنساخ لجزء الداخلي من الجينات في ناقلات انتحاري يؤدي إلى اقتطاع من الجين وترجمته لاحقة من بروتين غير وظيفية. أوريت: أصل رransfer. R المضادات الحيوية: المقاومة للمضادات الحيوية. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

  1. استنساخ للبناء-كروس واحد
    1. تضخيم جزء يحتوي على pokPI بواسطة PCR 38 مع الاشعال pokPI_for وpokPI_rev.
    2. pKC1132 المنتج استنساخ PCR إلى ناقلات انتحاري 39 (أبراميسين R [50 ملغ / مل]). متجه الانتحار ليس قادرا على تكرار في سلالة السبحية، وبالتالي يجب أن الاندماج في الجينات المستهدفة من إعادة التركيب مثلي لتوفير أبراميسين المقاومة. نقل متجه إلى كولاي استنساخ المضيف عن طريق الحرارة صدمة التحول 40.
    3. عزل ناقلات التي كتبها قلوية تحلل 41.
    4. هضم الحمض النووي ناقلات مع واحد قطع انزيم التقييد الذي يمر داخل شظية. وpokPI جنرالتم هضمها ه مع انزيم كبن أولا
    5. علاج هضم الحمض النووي ناقلات مع كبير البلمرة DNA الأول (klenow) جزء، التي لديها 5 '→ 3 "النشاط البلمرة و3' → 5" نوكلياز خارجية النشاط. تصد من نهايات لزجة وreligation اللاحقة يؤدي إلى فقدان أربع قواعد. تحقق من فقدان هذه القواعد عن طريق تحويل الخطوات إلى كولاي XL1 الأزرق، واختيار المستعمرات واحد، وعزل DNA البلازميد، و41 و تحليل مزيد من الهضم التقييد والتسلسل.
  2. الإقتران للعبور واحد بناء في السبحية
    1. نقل ناقلات الانتحارية التي تحتوي على الجين pokPI (pKC1132_ pokPI ديل) مع الحذف في كولاي ET12567 pUZ8002 42 (كانامايسين R) عن طريق الحرارة صدمة التحول 40. احتضان الخلايا في 100 مل الإعلام LB (كانامايسين 50 ميكروغرام مل -1، أبراميسين 50 ميكروغرام مل -1
    2. مزيج 500 ميكرولتر كولاي pUZ8002 pKC1132_ pokPI ديل مع الثقافة 500 ميكرولتر السبحية diastatochromogenes (بدلا من استخدام الجراثيم). نشر الخليط على لوحات MS (طحين الصويا 20 غراما، D-مانيتول 20 غراما، MgCl 2 10 ملم، أجار 1.5٪، ماء الصنبور 1 لتر). احتضان لوحات لمدة 20 ساعة عند 28 درجة مئوية.
    3. تراكب كل لوحة مع أبراميسين (1.25 ملغ) وفوسفوميسين (5 ملغ) الذائبة في 1 مل من الماء والسماح لهم الجافة. احتضان لوحات لعدة أيام عند 28 درجة مئوية حتى exconjugants تكون مرئية.
  3. تحقق طفرات-كروس واحد
    1. تطعيم exconjugants واحدة في 20 مل المتوسطة TSB (أبراميسين 50 ملغ مل -1)، واحتضان لهم عند 28 درجة مئوية لمدة ثلاثة أيام و 180 دورة في الدقيقة.
    2. عزل الحمض النووي الجيني 43 وتحقق انقطاع الجين pokPI بواسطة PCR.
    3. تطعيم الحيوانات المستنسخة واحدة مع انقطاع الجينات التحقق منها والسبحية سلالة wildtype في 100 مل المتوسطة HA واحتضان لهم لمدة 6 أيام في 28 درجة مئوية و 180 دورة في الدقيقة. استخراج استخراج النفط الخام (انظر القسم 1.3). تحقق إنتاج المجمع من خلال تحليل HPLC-MS (انظر القسم 1.4). ذروة المقابلة في اللوني HPLC وكتلة المجمع لا ينبغي أن يكون اكتشاف أي أكثر (انظر الشكل 6).

الشكل (6)
الشكل 6: تحليل HPLC من diastatochromogenes S. مع المعطل pokPI جين. HPLC اللوني (λ = 430 نانومتر) من استخراج النفط الخام س diastatochromogenes WT (أعلى) وسلالة متحولة مع توقف pokPI -Gen (أدناه). سلالة متحولة لا ينتج polyketomycin بعد الآن.الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Representative Results

في هذا الاستعراض وصفنا الخطوات واحدة من التعرف على مضاد حيوي يؤدي إلى مجموعة لها الجين السكروز. قبل عدة سنوات ونحن المستنسخة مكتبة كوزميد، وتعبئتها لهم في فاجات، transduced E. القولونية الخلايا المضيفة، وكان لفحص الآلاف من المستعمرات للتعرف على الحيوانات المستنسخة وجود مناطق متداخلة من مجموعة polyketomycin. كان تسلسل cosmids أيضا عملية صعبة ومكلفة 12.

من أجل إجراء المزيد من الدراسات على سلالة نحن التسلسل الجينوم كله من السبحية diastatochromogenes Tü6028. مع مشروع تسلسل الجينوم حددنا بسهولة الكتلة الجين السكروز من polyketomycin والمجموعات الأخرى ترميز مركبات واعدة. يقارن الشكل 7 طريقة "القديم" من تحديد الكتلة السكروز عن طريق الاستنساخ من مكتبة كوزميد وفحص مسهب، والطريقة "الجديدة" من قبل تسلسل الجينوم كله مع التعدين الجينوم لاحقا على نطاق ووقت عصيب. تقنيات التسلسل الجديدة والبرامج التعدين الجينوم جديدة تسريع العملية برمتها.

الرقم 7
الرقم 7: مقارنة بين "القديم" وأسلوب "جديد" من تعيين لجين العنقودية السكروز. ويتألف أسلوب "القديمة" استنساخ مكتبة كوزميد مع نخبة من الحيوانات المستنسخة الإيجابية وتسلسل كوزميد منها (ق) (أعلاه)؛ يتضمن أسلوب "الجديد" كامل تسلسل الجينوم و-mining لتحديد جميع مجموعات الجينات الأيض الثانوية تقع على الجينوم من سلالة (أدناه). وترد مدة من الخطوات واحدة على نطاق ووقت عصيب. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Discussion

في هذا المختبر تم إنشاء مكتبة كوزميد الجينومية من diastatochromogenes السبحية وفحص قبل سنوات عديدة، مما أدى إلى تحديد الكتلة polyketomycin الجينات من خلال عملية للغاية تستغرق وقتا طويلا. كان توصيف جينات مفردة من الممكن استخدام الحذف الجينات المستهدفة وتحليل المسوخ الناتج 12. مؤخرا، تم الحصول على تسلسل مشروع جينوم diastatochromogenes S. السماح تحديد سريع من الكتلة الجين السكروز polyketomycin. نحن يمكن بسهولة اكتشاف جينات السكروز، على الرغم من أن تسلسل مشروع الجينوم يحتوي يزال العديد من contigs. عملية وصفها لا يمكن أن يتحقق في غضون أشهر. ومع ذلك، يشتمل الإجراء العديد من الخطوات. قد تفشل الخطوات واحدة عدة مرات، ومنع التقدم إلى الخطوات اللاحقة:

ومن المعروف أن جنس السبحية لقدرتها على إنتاج المركبات الحيوية النشطة. في حين أنها تحمل في كثير من الأحيان أكثر من 20 السيرمجموعات الجينات ynthetic، وعادة ما يتم إنتاج مركبات احد أو اثنين فقط تحت ظروف المختبر. تطبيق نهج OSMAC (زراعة سلالة واحدة في ظل ظروف مختلفة) أن يستيقظ مجموعات الجينات الصامتة أحيانا قد لا يكون كافيا. التلاعب الجيني للجينات التنظيمية، مثل الجينات منظم عديد المظاهر adpA 44 و bldA 45،46، هو أيضا وسيلة فعالة لتنشيط إنتاج المركبات الثانوية الأخرى.

للتوضيح لهيكل المجمع، مثلا عن طريق تحليل الرنين المغناطيسي، عادة ما تكون أكثر من 2 ملغ من مجمع تنقية ضروري. لذلك، غالبا ما يتطلب تخمر الثقافة أكثر من 10 لتر. بدون تخمير قادرة على الحفاظ على الأكسجين، ودرجة الحموضة ودرجة الحرارة الظروف، قد يكون تحديا في مختبر صغير للتعامل مع هذا القدر من الثقافة واستخراج لاحق. خلال تنقية، قد يتم تغيير المجمع بسبب الأكسدة والإشعاع أو درجة الحرارة.أيضا، يتم استخدام مزيد من الخطوات لتنقية، وارتفاع فرصة للتدهور.

عند تحليل هيكل المنتجات الطبيعية، ومجموعات في الجينوم، وأحيانا ليس من السهل تحديد الكتلة المناسبة. أولا، إذا كان هناك ليست سوى سلسلة مشروع الجينوم جزء من الكتلة قد يكون في عداد المفقودين. ثانيا، ليست كل الجينات التي مطلوبة من أجل الحيوي هي في الكتلة. ثالثا، وأحيانا يتم تقسيم مجموعة إلى قسمين فصلها عن بعضها البعض من خلال العديد من kilobases. رابعا، قد يكون من الصعب تحديد واحد الذي هو الكتلة الجينات المناسبة. في حالة كبيرة نوع PKS أنا أو أنظمة NRPS، حيث أنه من الممكن لحساب عدد الوحدات الموسع استنادا إلى عدد من وحدات، أو حتى تحديد وحدات الموسع واحدة من خلال تحليل المجالات اختيار، فإنه يتحول بسهولة. ومع ذلك، في حالة العمل بشكل متكرر الانزيمات التنبؤ من المركبات توليفها في كثير من الأحيان غير ممكن، وخاصة إذا كان سترافي أكثر من 40 مجموعات الجينات. خامسا، والطبيعة هي معقدة للغاية ومليئة المركبات غير معروف حتى الآن. في كثير من الأحيان الحيوي هو خليط من مسارات مختلفة. إذا لم يتم تحديد المركب الجديد بعد، أو لا علاقة لمركب آخر، قد يكون من الصعب تحديد الكتلة، إلى اقتراح نموذج الحيوي ولاثبات ذلك.

بعد أن يتم تحديد الكتلة، وتقنية كروس واحد هو وسيلة جيدة وسريعة للتحقق من فرضية. PCR، استنساخ في ناقلات الانتحار، الاقتران، واختيار من الحيوانات المستنسخة إيجابية، وفحص الانتاج هي الخطوات المطلوبة فقط. عيب واحد من هذه التقنية هو أن التكامل بين ناقلات في كروموسوم غير مستقر بسبب المزيد من الأحداث إعادة التركيب. ولذلك، من أجل مواصلة تحليل الجينات واحدة، يطلب حذف الجينات دقيقة. كما أنها قد تكون صعبة للتلاعب سلالات السبحية على المستوى الجيني.

الإجراء الموضح يمكن تعيين رس أي مركبة أخرى تنتجها سلالة السبحية أو الكائنات الحية الدقيقة آخر. المعرفة حول مجموعة الجين السكروز ومجمعها توليفها يعطينا مزيدا من الفرص لتعديل بالفعل الجزيئات الموجودة بهدف تحسينها لمكافحة الجراثيم المقاومة للأدوية المتعددة.

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
من المنتج الطبيعي إلى Its العنقودية السكروز جين: تظاهرة طريق Polyketomycin من<em&gt; السبحية diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter