Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

A partir de um produto natural para seu cluster de genes biossintéticos: Uma demonstração utilizando Polyketomycin de doi: 10.3791/54952 Published: January 13, 2017

Summary

Aqui é apresentado um protocolo detalhado de (A) a identificação de um produto natural com actividade antibiótica, (B) a purificação do composto, o primeiro modelo da sua biossintese (C), (D) a sequenciação do genoma / -mining e o ( E) a verificação do grupo de genes de biossíntese.

Abstract

As estirpes de Streptomyces são conhecidos pela sua capacidade de produzir uma grande quantidade de diferentes compostos com várias bioactividades. O cultivo sob condições diferentes, muitas vezes leva à produção de novos compostos. Assim, culturas de produção das estirpes são extraídos com acetato de etilo e os extractos brutos foram analisados ​​por HPLC. Além disso, os extractos são testados quanto à sua bioactividade por ensaios diferentes. Para elucidação da estrutura do composto de interesse é purificado por uma combinação de diferentes métodos de cromatografia.

sequenciamento do genoma juntamente com a mineração genoma permite a identificação de um conjunto de genes biossintéticos produto natural utilizando diferentes programas de computador. Para confirmar que o aglomerado de genes correcta tenha sido identificado, experiências de inactivação de gene tem que ser executada. Os mutantes resultantes são analisadas para a produção do produto natural particular. Uma vez que o aglomerado de genes correcta foi inactivado, oestirpe deve deixar de produzir o composto.

O fluxo de trabalho é mostrado para o polyketomycin composto antibacteriano produzido por Streptomyces diastatochromogenes Tü6028. Cerca de dez anos atrás, quando sequenciação do genoma ainda era muito caro, a clonagem e identificação de um grupo de genes foi um processo muito demorado. sequenciamento rápido do genoma combinado com a mineração genoma acelera o julgamento de identificação cluster e abre novas maneiras de explorar a biossíntese e gerar novos produtos naturais por métodos genéticos. O protocolo descrito no presente documento pode ser atribuído a qualquer outro composto derivado de uma estirpe de Streptomyces ou outro microrganismo.

Introduction

produtos naturais de plantas e microrganismos sempre foram uma fonte importante para o desenvolvimento de medicamentos clínicos e de pesquisa. O primeiro antibiótico penicilina foi descoberta em 1928, a partir de um fungo por Alexander Fleming 1. Hoje em dia, muitos produtos mais naturais são utilizadas no tratamento clínico.

Um gênero conhecido por sua capacidade de produzir vários tipos de metabólitos secundários com diferentes bioatividades é Streptomyces. Streptomyces são bactérias Gram-positivas e pertencem à classe de Actinobactérias e da ordem Actinomycetales. Quase dois terços dos antibióticos utilizados clinicamente são derivados de Actinomycetales, principalmente a partir de Streptomyces, como anfotericina 2, 3 daptomicina ou tetraciclina 4. Dois prêmios Nobel foram concedidos no domínio dos Streptomyces pesquisa antibiótico. O primeiro foi para Selman Waksman para a descoberta da estreptomicina, o primeiro de umatibiotic eficaz contra a tuberculose. 5 Em 2015, como parte do Prêmio Nobel de Fisiologia e Medicina, a descoberta de avermectina de S. avermitilis foi premiado também. Avermectina é utilizado para o tratamento de doenças parasitárias 6,7.

A abordagem tradicional para a descoberta de produtos naturais em microorganismos tais como Streptomyces envolve geralmente a cultura da estirpe, sob diferentes condições de crescimento, bem como a extracção e análise de metabolitos secundários. Testes de bioactividade (por exemplo, ensaios para a actividade anti-bacteriana e anti-cancro) são realizados para detectar a actividade do composto. Finalmente, o composto de interesse é isolado e a estrutura química é elucidado.

As estruturas dos produtos naturais são muitas vezes composta de porções individuais, que estão a formar moléculas complexas. Existem alguns, mas limitados principais vias biossintéticas, levando a construção de blocoKS, que são utilizados para a biossíntese de produtos naturais. As principais vias biossintéticas são os caminhos de policétido, vias que levam à terpenóides e alcalóides, vias utilizando aminoácidos, e as vias que levam a porções de açúcar. Cada caminho é caracterizada por um conjunto de enzimas específicas 8. Com base na estrutura do composto, estas enzimas biossintéticas podem ser previstos.

Hoje em dia, a análise estrutural detalhada de um composto em combinação com a próxima geração de sequenciação e análise bioinformática pode ajudar a identificar o agrupamento de genes de biossíntese responsável. As informações de cluster abre novos caminhos para novas pesquisas produto natural. Isto inclui a expressão heteróloga para aumentar o rendimento do produto natural, modificação composto alvo por deleção ou alteração de genes e biossíntese combinatória com genes de outras vias.

Polyketomycin foi isolado independentemente a partir do caldo de cultura deduas estirpes, Streptomyces sp. MK277-AF1 9 e Streptomyces diastatochromogenes Tü6028 10. A estrutura foi elucidada por análise de RMN e de raios-X. Polyketomycin é composto de um decaketid tetracíclico e um ácido salicílico de dimetilo, ligados por as duas porções deoxysugar p-D-amicetose e α-L-axenose. Ele exibe citotóxica e actividade antibiótica, mesmo contra estirpes Gram-positivas multirresistentes, como a MRSA 11.

Uma biblioteca de cosmídeos genómica de S. diastatochromogenes Tü6028 foi gerado e rastreados há muitos anos. Usando gene específico sondas cluster gene polyketomycin com um tamanho de 52,2 kb, contendo 41 genes, foi identificada depois de vários meses de trabalho intenso 12. Recentemente, uma sequência de projecto de genoma de S. diastatochromogenes foi obtido levando à identificação rápida do agrupamento de genes de biossíntese polyketomycin. Nesta visão geral, um método de ajudar a identificar um produto natural e elucidar o seu agrupamento de genes de biossíntese será descrito, usando polyketomycin como um exemplo.

Aqui nós explicamos os passos simples que levam de um produto natural ao seu conjunto de genes biossintéticos mostrado para polyketomycin produzido por Streptomyces diastatochromogenes Tü6028. O protocolo compreende a identificação e a purificação de um produto natural com propriedades antibióticas. Outras análises estruturais e comparação com os resultados de chumbo genoma de mineração para a identificação do grupo de genes de biossíntese. Este procedimento pode ser aplicado a qualquer outro composto derivado de uma estirpe de Streptomyces ou qualquer outro microorganismo.

Protocol

1. Identificação de um produto natural com Antibiótico Property

  1. Cultivar um microorganismo sob diferentes condições (por exemplo, tempo, temperatura, pH, media) na sequência da "abordagem OSMAC (uma estirpe de muitos compostos)" 13. Seleccionar um meio em que se observa a produção de um composto.
  2. Cultive Streptomyces diastatochromogenes Tü6028 sob as seguintes condições
    1. Cresça Streptomyces diastatochromogenes Tü6026 estirpe em placas MS (farinha de soja 20 g, de D-manitol 20 g, MgCl 2 10 mM, 1,5% de agar, água da torneira 1 L). Inocular um pequeno laço dos esporos desta estirpe em 20 ml de meio TSB líquido (soja tríptico caldo de 30 g, a água da torneira 1 L, pH 7,2; meio de pré-cultura) em uma garrafa de Erlenmeyer com uma espiral. Agitar o frasco num agitador rotativo (28 ° C, 180 rpm, 2 dias).
    2. Inocular cultura principal, em 100 mL de meio HA (glucose 4 g, extrato de levedura 4 g, malteextrair 10 g, água da torneira 1 L, pH 7,2) com 2 mL de pré-cultura. Cultura da estirpe a 28 ° C durante 6 dias num agitador rotativo a 180 rpm.
  3. Preparação do extracto bruto
    1. Células colheita por centrifugação (10 min, 3000 xg).
    2. Para os próximos passos lidar com solventes orgânicos sob uma coifa.
    3. Para a extracção composto a partir do micélio, Ressuspender as células em um duplo volume de acetona e agitar num tubo durante 30 min, 180 rpm. Filtra-se o líquido através de papel de filtro comercial e evapora-se a acetona num evaporador rotativo a 40 ° C e 550 bar. Dissolve-se o extracto em 20 ml de água: acetato de etilo (1: 1) e agitá-lo em uma ampola de decantação de 30 min a 180 rpm.
    4. Para a extracção do composto do meio de cultura, ajustar o caldo de cultura a pH 4,0 por adição de HCl 1M. Adicionar 100 mL de acetato de etilo e agitá-lo em uma ampola de decantação de 30 min, 180 rpm.
    5. Recolha fase de acetato de etilo e evaporar pela podridão Ary evaporação a 40 ° C e 240 bar.
  4. A análise do extracto em bruto por HPLC
    1. Dissolve-se os extractos em 1 mL de MeOH, filtrá-los através de um filtro de tamanho de poro de 0,45 um e executar a cromatografia líquida de alto desempenho (HPLC) 14.
    2. No caso de polyketomycin, equipar o sistema de HPLC com uma pré-coluna C18 (4,6 x 20 mm 2) e uma coluna C18 (4,6 x 100 mm 2). Usar um gradiente linear de acetonitrilo + 0,5% de ácido acético que vão desde 20% a 95% em H 2 O + 0,5% (caudal: 0,5 mL min -1) de ácido acético.
      NOTA: Polyketomycin tem um tempo de retenção de 25,9 min (ver Figura 1A). O espectro de UV / VIS tem máximos a 242 nm, 282 nm, 446 nm e mínimos a 262 nm e 359 nm (ver Figura 1B). No modus negativo uma massa de 863,2 [MH] - é detectável (ver Figura 1C).

"Src =" / files / ftp_upload / 54952 / 54952fig1.jpg "/>
Figura 1: LC / MS Análise de Polyketomycin. (A) Cromatograma de CLER (λ = 430 nm) do extracto em bruto depois de cultivo de Streptomyces diastatochromogenes Tü6028 durante 6 dias. Polyketomycin tem um tempo de retenção de 25,9 min, (B) de UV / VIS espectros de Polyketomycin. (C) Os espectros de massa de Polyketomycin no modus negativo. Pico principal com m / z 863,2 [MH] -. Por favor clique aqui para ver uma versão maior desta figura.

  1. Identificação da actividade antibiótica utilizando o ensaio de difusão em disco
    1. Inocular estirpes de teste como bactérias Bacillus subtilis Gram-positivos (em meio LB; LB 20 g, água da torneira 1 L, pH 7,4) e outras estirpes de Streptomyces (em meio TSB; tryptic soy broth 30 g, água da torneira 1 L, pH 70,2), bactérias Gram-negativas de Escherichia coli (em meio LB) e estirpes de fungos (tais como em meios de meio YPD; extracto de levedura 10 g, 20 g de peptona, 20 g de glucose, água da torneira 1 L, pH 7,4). Tome 100 mL de teste de tensão pré-cultura e espalhá-los sobre as respectivas placas de ágar.
    2. Dissolve-se o extracto em bruto ou purificado de composto 500 ul de metanol (alternativamente água ou DMSO) e pipeta de 20-50 uL em discos de papel estéreis. discos de papel seco para 30 min sob a bancada de trabalho e colocá-los sobre as placas com culturas de ensaio. Preparar um controlo negativo (solvente) e um controlo positivo (antibiótico, por exemplo, apramicina [1 mg]).
    3. Incubam-se as placas sob condições adequadas até que as estirpes de ensaio são cultivadas visivelmente e determinar a zona de inibição, se aparente. Incubar E. coli e Bacillus sp. a 37 ° C durante 16 h, Streptomyces sp. a 28 ° C durante 2-4 dias, a estirpe de fungos (principalmente dependente estirpe de ensaio exato) umt 30 ° C durante 2 dias).

2. Grande Extração Scale, purificação e elucidação da estrutura do Composto

  1. Cultivar S. diastatochromogenes em 5 L de meio de HA (glucose 4 g, extracto de levedura 4 g, extracto de malte, 10 g, a água da torneira 1 L, pH 7,2). Inocular 2 ml da pré-cultura em frascos de 30 x 500 ml de Erlenmeyer contendo 150 ml de meio de HA. Incubar a estirpe a 28 ° C durante 6 dias num agitador rotativo a 180 rpm.
  2. Células colheita por centrifugação (10 min, 15.000 xg, RT) e extrair compostos utilizando acetato de etilo (ver secção 1.3).

Figura 2
Figura 2: Fluxo de trabalho para elucidação da estrutura. O processo compreende (1) o cultivo da estirpe, (2) de extracção, (3) purificação por extracção em fase sólida (SPE), cromatografia em camada fina (TLC), cromatografia líquida de alta eficiência preparativa (HPLC), tamanhocromatografia de exclusão (SEC) e (4) elucidação da estrutura por análise de massa (MS), de ressonância magnética nuclear (RMN) e as medições de raios-X. Por favor clique aqui para ver uma versão maior desta figura.

  1. A purificação do Polyketomycin
    NOTA: O processo de purificação e elucidação da estrutura é mostrada na Figura 2.
    1. Fraccionar extracto em bruto através de uma coluna C18 de extracção em fase sólida (SPE), utilizando um gradiente de MeOH 10% -stepwise variando de 30% a 100% de MeOH em H2O, 100 mL para cada condição.
    2. Purifica-se a fracção contendo o composto ainda por cromatografia em camada fina preparativa (TLC) usando 15 CH 2 Cl 2 / MeOH (7: 1) como sistema de eluição.
    3. Purifica-se o composto 16 por HPLC preparativa. Equipar o sistema de HPLC com uma pré-coluna C18 (5 m; 9,4 x 20 mm) e umcoluna principal (5 | iM; 9,4 x 150 mm). Usar um gradiente de ácido acético acetonitrilo + 0,5% variando de 20% a 95% em H 2 O + 0,5% de ácido acético (taxa de fluxo: 2,0 mL / min).
    4. Para remover os solventes e outras pequenas impurezas, efectuar um último passo de purificação por cromatografia de exclusão de tamanho utilizando uma coluna de 17 em MeOH. Recolhe-se o composto puro final e evapora-se de MeOH por evaporação rotativa a 40 ° C e 240 bar.
  2. elucidação estrutural
    1. Dissolve-se o composto puro (mais do que 2 mg) em 600-700 ul (dependente da máquina) de DMSO-d 6, ficha 1E RMN (1 H, 13 C) e RMN 2D (HSQC, HMBC, 1 H- 1 H COSY) espectros em um espectrômetro de RMN 18. Expresso de desvios químicos em valores de ô (ppm) usando DMSO-d 6.
    2. Grave um espectro de massa de alta resolução (HRESI-MS) 19 de polyketomycin usando uma alta resoluçãoespectrômetro de massa.
    3. Elucidar a estrutura de interpretação dos resultados da análise dos dados de RMN e MS 10.

3. Propor biossintética modelo do novo composto isolado

  1. Analisar a estrutura do composto isolado e prever enzimas, que podem estar envolvidos na sua biossíntese. Atribuí-los a policetido (tipo I, II ou III), a síntese de péptidos não-ribossomal, lantipeptide, terpenóides, ou açúcar via do metabolismo 8.
  2. exemplo polyketomycin
    1. Subdividir a estrutura em óbvias porções individuais: porção tetrac�lico, dois monossacarídeos e do ácido salicílico dimetil.
    2. Descobre, em que os fragmentos possam ser derivados a partir de: A porção tetracíclico podem ser derivados a partir de um tipo de policetido-sintase II e a parte de ácido salicílico de dimetilo pode ser derivado por uma policetido-sintase iterativo tipo I. As duas metades de açúcar, os quais são 6-deoxysugars , pode ser synthesizada a partir de glucose, envolvendo uma TDP-glicose-4,6-desidratase durante a biossíntese e provavelmente ligado por dois glicosiltransferases (ver Figura 3) 8.
    3. Prever genes putativos no cluster. Pense de enzimas que estão envolvidos na síntese das porções individuais, em que liga as unidades, bem como na alteração e adaptação da molécula. O cluster de genes biossintéticos de Polyketomycin provavelmente contém genes que codificam um tipo policetídeo sintase II (portanto mínimo um ACP, KS α und KS β para conectar unidades de diluição), um iterativo tipo policetídeo sintase I (pelo menos ACP, AT, KS), um TDP-glucose-4,6-desidratase (necessário para a etapa: glucose → deoxiglicose) e dois glicosiltransferases (anexar dois monómeros de açúcar para a aglicona) 8.

Figura 3
Figura 3: Estrutura de Polyketomycin Divided em single Building Blocks. Polyketomycin é composto de um decaketid tetracíclico (PKS tipo II) e um ácido salicílico dimetil (iterativo de PKS tipo I), ligadas por duas porções deoxysugar β-D-amicetose e α-L-axenose (NDP-glicose-4,6- desidratase e dois glicosiltransferase necessária). Por favor clique aqui para ver uma versão maior desta figura.

4. Genome Sequencing / Mineração

  1. Sequenciamento de próxima geração
    1. Sequenciar o DNA genômico por tecnologias de sequenciamento de próxima geração como Illumina, 454 pyrosequencing ou sólida 20. Alinhar única lê a uma sequência de referência ou montar de novo.
      NOTA: O genoma de S. diastatochromogenes Tü6028 foi sequenciado no Centro de Biotecnologia (CeBiTec) na Universidade de Bielefeld. Todas as leituras foram montados com um projecto de genomade 7,9 Mb.
  2. mineração genoma
    1. Busca de quadros de leitura aberta (ORF) pela utilização de, por exemplo NCBI Procarióticas Genome Anotação Pipeline 21,22, RAST (anotação rápida usando a tecnologia do subsistema) 23,24,25, Prokka (rápida anotação do genoma procariotas) 26 ou GenDB 27. Estes programas também propor suas funções. A análise da sequência de S. diastatochromogenes Tü6028 projecto de genoma levou à identificação de mais de 7.000 ORFs.
    2. Execute BLAST específico (Básico Local Alignment Search Tool) Análise para obter mais informações como alinhamentos com outros genes semelhantes e domínios catalíticos 28,29,30.
    3. Para a identificação dos programas gene cluster executar metabolito secundário como antiSMASH 31,32,33, 34 e NaPDoS NRPSpredictor 35,36. No projecto de genoma de Streptomyces diastatochromogenes antiSMASH 31,32,33 identicadas 22 agrupamentos de genes.
    4. Analisar os agrupamentos de genes putativos para a sua via enzimática (s) (de policetido-sintase (tipo I, II ou III), sintetase não-péptido ribossomal, lanthipeptide, terpenóides, metabolismo do açúcar ...). Pesquisa para agrupar (s) contendo os genes que possam estar envolvidos na síntese do composto (ver secção 3). Em S. diastatochromogenes de cluster anotada 2 contém genes II, eu genes de três policetídeo tipo sintase, um gene-TDP-glucose 4,6-desidratase e dois genes de glicosiltransferase (ver Figura 4) policetídeo tipo sintase.
    5. Concentre-se em genes individuais dentro do cluster. Para o tipo I e PKS NRPS a especificidade de aciltransferases e domínios adenilação, e, assim, a incorporação de unidades individuais de diluição, pode ser previsto. Também comparar a ordem da unidade de extensor incorporado com a molécula. antiSMASH 31,32,33 também mostra aglomerados semelhantes de compostos já conhecidos, com uma ligação à base de dados MIBiG 37. Comparar a estrutura do composto com estes compostos e verificar se há semelhanças.

Figura 4
Figura 4: Saída antiSMASH de Polyketomycin biossintética Gene Cluster e Visão Geral de Outros Clusters em S. diastatochromogenes Tü6028. (A) Resumo dos agrupamentos de genes biossintéticos previstos no genoma de S. diastatochromogenes Tü6028; Conjunto de genes biossintéticos (B) Cluster 2 Polyketomycin com genes alvo. Por favor clique aqui para ver uma versão maior desta figura.

5. A verificação do Cluster de genes biossintéticos

  1. Procurar um gene com funções importantes e óbvias (essenciais) para a biosíntese do composto. Para verificação da polyketoo aglomerado de genes micina pokPI gene, que codifica para a α ketosynthase da PKS tipo II, foi seleccionado e inactivado por uma fora de enquadramento -deletion (ver Figura 5B). Em alternativa, interrompe o gene através da clonagem de um fragmento interno (ver Figura 5C).

Figura 5
Figura 5: Verificação de um Cluster Gene pelo único Crossover. (A) do gene nativo conduz à tradução de uma proteína funcional; (B) Clonagem do gene com deleção interna num vector suicida leva a um único cruzamento, resultando em um desvio de enquadramento no gene alvo e subsequente tradução de proteínas de não-funcional; (C) Clonagem de um fragmento interno do gene num vector suicida leva a uma truncagem do gene e a subsequente tradução de uma proteína não funcional. oriT: origem da transferência; R antibiótico: resistência a antibióticos. Por favor clique aqui para ver uma versão maior desta figura.

  1. Clonagem do construto-único cruzamento
    1. Amplificar um fragmento contendo pokPI por PCR 38 com primers pokPI_for e pokPI_rev.
    2. Clone produto de PCR no vector suicida pKC1132 39 (apramicina R [50 mg / mL]). O vector suicida não é capaz de se replicar na estirpe de Streptomyces e, assim, tem de se integrar no gene alvo pela recombinação homóloga para fornecer apramicina-resistência. Transferir o vector em E. coli hospedeiro de clonagem por transformação de choque térmico 40.
    3. Isolar o vector por lise alcalina 41.
    4. Digerir o ADN do vector com uma única enzima de restrição de corte que corta dentro do fragmento. O pokPI gene foi digerido com enzima Kpn I.
    5. Tratar ADN do vector digerido com grande de polimerase I de ADN (Klenow) de fragmento, o qual tem 5 '→ 3' e a actividade da polimerase '→ 5' exonuclease 3-actividade. Embotamento das extremidades coesivas e religação subsequente conduz à perda de quatro bases. Verifique se há perda destas bases de transformação etapas em E. coli XL1 azul, pegando colónias isoladas, isolando seu DNA de plasmídeo, 41 e aprofundar a análise por digestão de restrição e sequenciação.
  2. Conjugação do single-cruzado construir em Streptomyces
    1. Transferir o vector suicida contendo o gene pokPI (pKC1132_ pokPI del) com supressão em E. coli ET12567 pUZ8002 42 (canamicina R) por transformação de choque térmico 40. Incubar as células em 100 ml de meios LB (canamicina 50 ug mL-1, apramicina 50 ug mL-1
    2. Misturar 500 mL de E. coli pUZ8002 pKC1132_ pokPI del com 500 pL de cultura de Streptomyces diastatochromogenes (alternativamente usar esporos). Espalhar a mistura sobre placas de MS (farinha de soja 20 g, de D-manitol 20 g, MgCl 2 10 mM, 1,5% de agar, água da torneira 1 L). Incubar as placas durante 20 h a 28 ° C.
    3. Overlay cada placa com apramicina (1,25 mg) e fosfomicina (5 mg) dissolvido em 1 ml de água e deixar secar. Incubar as placas durante vários dias a 28 ° C até que os exconjugantes são visíveis.
  3. Verifique mutantes de crossover único
    1. Inocular exconjugantes individuais em 20 ml de meio TSB (apramicina 50 mg mL -1) e incubar a 28 ° C durante três dias e 180 rpm.
    2. Isolar DNA genômico 43 e verifique interrupção do gene pokPI por PCR.
    3. Inocular os clones individuais com a interrupção do gene verificada e a estirpe Streptomyces tipo selvagem, em 100 mL de meio de HA e incubar durante 6 dias a 28 ° C e 180 rpm. Extrair o extrato bruto (ver secção 1.3). Verifique produção composto por análise de HPLC-MS (ver secção 1.4). O pico correspondente no cromatograma de HPLC e a massa do composto não deve ser detectada mais (ver Figura 6).

Figura 6
Figura 6: Análise por HPLC da S. diastatochromogenes com pokPI gene inactivado. Cromatograma de HPLC (λ = 430 nm) de extracto em bruto de S. diastatochromogenes WT (topo) e a estirpe mutante com interrompida pokPI -Gen (abaixo). A estirpe mutante não produz mais polyketomycin.Por favor clique aqui para ver uma versão maior desta figura.

Representative Results

Nesta visão geral, descrevemos os passos individuais da identificação de um antibiótico que conduz à sua aglomerado de genes biossintéticos. Há muitos anos que clonado de uma biblioteca de cosmídeo, embalados-los em fagos, transduzidas células hospedeiras de E. coli, e teve de tela milhares de colónias para identificar os clones que possuem regiões que se sobrepõem de aglomerado polyketomycin. A sequenciação dos cosmídeos foi também um processo difícil e dispendioso 12.

A fim de realizar novos estudos sobre a tensão que sequenciou o genoma inteiro de Streptomyces diastatochromogenes Tü6028. Com o projeto de sequenciamento do genoma que facilmente identificados no cluster de genes biossintéticos de polyketomycin e outros clusters que codificam compostos promissores. A Figura 7 compara o método "velho" de identificação do cluster biossintético por clonagem de uma biblioteca de cosmídeos e rastreio elaborativa, eo método "novo" por toda a sequenciação do genoma com a mineração genoma subsequente numa escala de tempo áspero. As novas tecnologias de sequenciamento e programas de mineração genoma novas acelerar todo o processo.

Figura 7
Figura 7: Comparação entre o "velho" e "novo" método de atribuição de um biossintética Gene Cluster. O método "velho" compreende a clonagem de uma biblioteca de cosmídeos com uma selecção de clones positivos e sequenciação do respectivo cosmideo (s) (supra); O método "novo" inclui sequenciação do genoma completo e -mining para identificar todos os agrupamentos de genes de metabolitos secundários localizados no genoma da estirpe (em baixo). Duração de etapas individuais são mostrados em uma escala de tempo áspero. Por favor clique aqui para ver uma versão maior desta figura.

Discussion

Neste laboratório, uma biblioteca de cosmídeos genómica de Streptomyces diastatochromogenes foi gerado e rastreados muitos anos atrás, resultando na identificação do grupo de genes polyketomycin através de um processo extremamente moroso. Caracterização de genes individuais foram possíveis usando deleções de genes-alvo e análise dos mutantes resultantes 12. Recentemente, uma sequência projecto de genoma de S. diastatochromogenes foi obtido permitindo a identificação rápida do cluster gene biossintético polyketomycin. Poderíamos facilmente detectar os genes biossintéticos, embora a sequência projecto genoma ainda contém muitos contigs. O processo descrito pode ser alcançado dentro de alguns meses. No entanto, o processo compreende diversos passos. etapas individuais podem falhar várias vezes, impedindo a progressão para as etapas subseqüentes:

O género Streptomyces é conhecida pela sua capacidade para produzir compostos bioactivos. Enquanto eles carregam muitas vezes mais de 20 biosynthetic agrupamentos de genes, normalmente, apenas um ou dois compostos são produzidos em condições de laboratório. A aplicação da abordagem OSMAC (cultivo de uma estirpe em condições diferentes) para acordar agrupamentos de genes silenciosos podem não ser suficientes. A manipulação genética dos genes reguladores, tais como os genes reguladores pleiotrópicos ADPA 44 e bldA 45,46, é também um método eficaz para activar a produção de outros metabolitos secundários.

Para o esclarecimento da estrutura do composto, por exemplo, por análise de RMN, geralmente superior a 2 mg de composto purificado é necessário. Por conseguinte, a fermentação de mais de 10 l de cultura é muitas vezes necessária. Sem um fermentador que é capaz de manter condições de oxigénio, pH e temperatura, pode ser um desafio numa pequena laboratório para lidar com esta quantidade de cultura e a extracção subsequente. Durante a purificação, o composto pode ser alterado devido a oxidação, radiação ou a temperatura.Além disso, quanto mais etapas de purificação são utilizados, maior é a possibilidade de degradação.

Ao analisar a estrutura do produto natural, e os clusters no genoma, às vezes não é tão fácil de identificar o cluster apropriado. Em primeiro lugar, se houver apenas uma sequência projecto genoma alguma parte do cluster pode estar faltando. Em segundo lugar, nem todos os genes que são necessários para a biossíntese estão no cluster. Em terceiro lugar, por vezes, um cluster é dividido em duas partes separadas umas das outras por muitas quilobases. Em quarto lugar, pode ser difícil decidir qual é o aglomerado de genes apropriados. Em caso de grandes sistemas de PKS tipo I ou NRPS, onde é possível calcular o número de unidades de diluição com base no número de módulos, ou mesmo identificar as unidades de diluição simples por análise dos domínios de selecção, que se transforma-se facilmente. No entanto, no caso de enzimas trabalhar de forma iterativa a previsão dos compostos sintetizados não é muitas vezes possível, especialmente se o strano tem mais do que 40 conjuntos de genes. Em quinto lugar, a natureza é altamente complexa e cheia de compostos ainda desconhecidas. Muitas vezes, a biossíntese é uma mistura de diferentes vias. Se o novo composto não é identificada ainda, ou não relacionado com outro composto, pode ser difícil identificar o cluster, propor um modelo de biossíntese e para provar isso.

Uma vez que o cluster é identificado, a técnica de passagem única é um método bom e rápido para verificar a hipótese. PCR, clonagem num vector suicida, conjugação, a selecção de clones positivos, e o ensaio de produção são os únicos passos necessários. Uma desvantagem desta técnica é que a integração do vector no cromossoma não é estável devido à mais eventos de recombinação. Por conseguinte, a fim de analisar mais genes simples, deleções de genes precisos são necessários. Também pode ser complicado para manipular estirpes Streptomyces no nível genético.

O processo descrito pode ser atribuído tO qualquer outro composto produzido por uma estirpe de Streptomyces ou outro microrganismo. O conhecimento sobre um conjunto de genes biossintéticos e seu composto sintetizado nos dá novas oportunidades para já modificar moléculas existentes com o objectivo de melhorar-los para a luta contra patógenos multirresistentes.

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
A partir de um produto natural para seu cluster de genes biossintéticos: Uma demonstração utilizando Polyketomycin de<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter