Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Generation af Integration-fri induceret pluripotente stamceller fra humane perifere mononucleære blodceller Brug episomale vektorer

doi: 10.3791/55091 Published: January 1, 2017

Abstract

Inducerede pluripotente stamceller (iPSCs) lover godt for sygdom modellering og regenererende behandlinger. Vi har tidligere beskrevet anvendelsen af ​​Episomale vektorer (EV) for at generere integration-fri iPSCs fra mononukleære celler fra perifert blod (PB MNC'er). De episomale vektorer anvendes, er DNA-plasmider indarbejdet med oriP og EBNA1 elementer fra viruset Epstein-Barr (EB), som giver mulighed for replikation og langsigtet fastholdelse af plasmider i mammale celler. Med yderligere optimering kan opnås tusindvis af IPSC kolonier fra 1 ml perifert blod. To afgørende betydning for opnåelsen af ​​høj omprogrammering effektivitetsgevinster er: 1) anvendelsen af ​​en 2A "self-spaltning" peptid at linke OCT4 og SOX2 og således opnå ækvimolær udtryk for de to faktorer; 2) anvendelsen af ​​to vektorer til at udtrykke MYC og KLF4 individuelt. Her beskriver vi en trin-for-trin-protokol til at generere integration-fri iPSC'er fra voksne perifere blodprøver. De genererede iPSCs er integration-fri som resterende episomale plasmider er målbart efter fem passager. Selvom omprogrammering effektivitet er sammenlignelig med Sendai-virus (SV) vektorer, EV plasmider er betydeligt mere økonomiske end de kommercielt tilgængelige SV vektorer. Denne prisbillige EV omprogrammering systemet rummer potentiale for kliniske anvendelser i regenerativ medicin og giver en tilgang til direkte omprogrammering af PB multinationale selskaber til integration uden mesenkymale stamceller, neurale stamceller osv.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Efter tvungen ekspression af adskillige transkriptionsfaktorer (Dvs. OCT4, SOX2, MYC og KLF4), kan somatiske celler omprogrammeres til induceret pluripotente stamceller (iPSCs), som holder meget lovende for applikationer i regenerativ medicin og celleudskiftning 1-3. Til dato er forskellige fremgangsmåder blevet udviklet til at forøge succesraten for omprogrammering 4-7. Virale vektorer induceret omprogrammering er meget brugt til effektiv generering af iPSCs, fordi viral integration fører til et højt niveau, stabil ekspression af omprogrammering faktorer. Permanent integration af vektor-DNA i cellegenomet, kan imidlertid inducere insertionsmutagenese 5. Desuden kan utilstrækkelig inaktivering af omprogrammering faktorer forstyrre iPSCs differentiering 8. Som sådan er anvendelsen af ​​iPSCs uden integration af omprogrammering faktorer er bydende nødvendigt, specielt til brug i celleterapi applikationer.

9 Epstein-Barr (EB). OriP element fremmer plasmidreplikation i pattedyrceller, mens EBNA1 element bindsler oriP-indeholdende plasmid-DNA til det kromosomale DNA, der muliggør opdelingen af ​​episom under opdeling af værtscellen. I sammenligning med andre integrationsrelevante fri strategier, herunder Sendai-virus (SV) og RNA transfektion elbiler besidder flere fordele 5,6,10. Som plasmid-DNA, kan elbiler let fremstilles og ændres i hus, hvilket gør dem yderst overkommelig. Desuden omprogrammering med EV er en mindre arbejdskrævende proces, da en enkelt transfektion med elbiler er tilstrækkelig til iPSC generation, mens der er nødvendige for en vellykket omprogrammering flere RNA transfektioner.

DErmal fibroblaster er blevet anvendt i mange omprogrammering undersøgelser. Men hudbiopsi er ikke kun en invasiv og smertefuld proces, men også tidskrævende for at udvide celler til tilstrækkelige mængder til omprogrammering. Af større bekymring, har hudceller af voksne donorer ofte været udsat for langvarig UV-lys-stråling, som kan føre til mutationer associeret med tumorer, hvilket begrænser ansøgningerne om iPSCs afledt hud fibroblaster 11,12. For nylig er det blevet rapporteret, at normale menneskelige hudceller ophobes somatiske mutationer og flere kræft gener, herunder de fleste af de vigtigste drivkræfter for kutant planocellulært karcinom, er under stærk positiv selektion 13.

I modsætning til hudfibroblaster, perifert blod (PB) celler er en foretrukket kilde til celler til omprogrammering fordi 1) blodlegemer kan let opnås gennem en minimalt invasiv fremgangsmåde, 2) perifere blodlegemer er afkom af hæmatopoietiske stamcellerbopæl i knoglemarven, og dermed beskyttet mod skadelig stråling. Perifere mononukleære blodceller (PB MNC'er) kan opsamles i en time fra buffy coat lag efter en simpel gradient centrifugering under anvendelse af Ficoll-Hypaque (1,077 g / ml). De opnåede PB MNCs er sammensat af lymfocytter, monocytter og nogle hæmatopoietiske stamceller (HPCs) 14. Selvom humane T-lymfocytter er en af de største celletyper i PB, modne T celler indeholder omlejringer af T-cellereceptoren (TCR) gener og mangler et intakt genom således begrænser deres potentielle anvendelser 15,16. Foryngelse af T-celler via iPSC generation, kan dog have potentielle anvendelser i kimære Antigen receptor (CAR) T-celleterapi 17-19. Til sammenligning HPC'er har et intakt genom og er let reprogrammable. Selvom kun 0,01-0,1% celler i det perifere kredsløb er HPCs, kan disse celler udvides ex vivo i erythroid medium, der favoriserer spredning af erythrOID progenitorceller 14.

I vores tidligere undersøgelse, brugte vi den faktor BCL-XL i tillæg til de Yamanaka faktorer (OCT4, SOX2, MYC og KLF4), hvilket resulterede i en 10x stigning i PB omprogrammering efficency 20. BCL-XL, også kendt som BCL2L1, er en potent hæmmer af celledød, ved at inhibere aktivering af caspaser 21,22. Men, kan BCL-XL også spille en vigtig rolle i at opretholde pluripotens 21,22. For nylig har vi yderligere optimeret vores EV omprogrammering systemet ved separat udtrykke MYC og KLF4 med to vektorer, hvilket fører til en omtrent 100x stigning i omprogrammering effektivitet 23. Under anvendelse af denne metode, omprogrammering effektivitet defineret ved hjælp af koloni nummer divideret med start celletal ved transfektion, er 0,2 - 0,5% fra raske donorer. Som det fremgår, beskriver vi den detaljerede eksperimentelle procedure til at generere integration-fri iPSCs fra PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle de menneskelige PB prøver blev indhentet fra anonyme voksne donorer uden identifikation oplysninger fra Tianjin Blood Center med godkendelse af den lokale videnskabsetiske komité.

1. Endo-free Plasmidpræparat

  1. Brug en kommerciel Plasmid Purification Maxi Kit til at ekstrahere episomale vektorer fra E. coli ifølge producentens protokol. For det sidste trin, til erstatning TE buffer med endotoksin-frit sterilt vand opløse DNA-pelleten.
  2. Måling af DNA-koncentration ved anvendelse af en kommerciel UV / Vis spektrofotometer. Koncentrationen er sædvanligvis større end 1 ug / pi, med A260 / A280 og A260 / A230-forhold større end 1,8 og 2,0, henholdsvis.

2. Kultur Medier

  1. Forbered erythroid medium: hæmatopoietisk stamcelletransplantation Expansion Medium suppleret med 100 ng / mL menneskelige stamceller Factor (SCF), 10 ng / mL Interleukin-3 (IL3), 2 U / mL Erythropoietin (EPO), 20 ng / ml insulin vækstfaktor-1 (IGF1), 1 pM dexamethason og 0,2 mM 1-thioglycerol. Filter sterilisere med et 0,22 um sprøjtefilter. Erythroid medium kan opbevares ved 4 ° C i op til en måned.
  2. Forbered iPSC medium: DMEM / F12-medium (Dulbeccos Modified Eagle Medium / Nutrient Mixture F-12) suppleret med 1x L-glutamin, 1x penicillin / streptomycin, 1x ikke-essentielle aminosyrer, 50 ng / mL for fibroblastvækstfaktor 2 (FGF2 ), 1x Insulin-Transferrin-Selenite supplement (ITS), og 50 mg / ml ascorbinsyre. Filter sterilisere med et 0,22 um sprøjtefilter. iPSC medium kan opbevares ved 4 ° C i op til en måned.
  3. Forbered MEF medium: Dulbeccos modificerede Eagle-medium (DMEM; høj glucose) suppleret med 1x penicillin / streptomycin og 10% kalvefosterserum (FBS). Filter sterilisere med et 0,22 um sprøjtefilter. MEF medium kan opbevares ved 4 ° C i op til en måned eller frisk tilføje 1x L-glutamin før brug.
  4. PRepare iPSC kryopræservering medium (2x): Opløs 5 g D-trehalose i 30 ml sterilt vand i et 37 ° C vandbad. Bringe temperaturen til 4 ° C og derefter tilsættes 10 ml FBS og 10 ml dimethylsulfoxid (DMSO). Filter sterilisere med et 0,22 um sprøjtefilter. Opbevar ved 4 ° C i op til 3 måneder 24.

3. Isolering af perifere mononucleære blodceller (PB MNCs)

  1. Kombiner 10 ml frisk PB prøve og 10 ml PBS-buffer i et 50 ml rør og bland godt. Bring PBS til RT eller 37 ° C før brug.
    BEMÆRK: Ca. 1 - 3 x 10 6 multinationale selskaber (friske eller kryopræserverede) kan fås fra 1 ml PB. Efter 6 d af kultur, forventer at have 0,5 - 1 x 10 6 af total celler på grund af død modne celler under dyrkning. Ca. 1 x 10 7 celler kan opnås fra 10 ml frisk PB.
  2. Tilsæt 10 ml Ficoll til bunden af ​​røret under anvendelse af en 10 ml sprøjte fastgjort til en lang nål. Denne proces bør ske langsomt for at sikre, at Ficoll lag ikke blandes med PB.
  3. Centrifuger ved 400 x g i 30 minutter ved en lav acceleration og deceleration. Efter centrifugering, PB MNC'er i det hvide lag (buffy coat) placeret mellem PB plasma og Ficoll.
  4. Langsomt aspirer -10 ml PB plasma uden at forstyrre buffy coat lag. Omhyggeligt høste det hvide lag med en 1 ml pipettespids til et nyt 50 ml rør. Den samlede mængde af opsamlede celler fra det hvide lag vil være mellem 3. - 6. ml.
  5. Tilføj PBS til at bringe det totale volumen til 30 ml og bland godt med en 10 ml pipette. Centrifuger ved 400 xg i 10 min.
  6. Fjern supernatanten og resuspender cellepelleten i 20 ml dyrkningsmedium (dvs. Iscoves Modificeret Dulbeccos Medium, IMDM) og blandes godt. Centrifuger ved 400 xg i 10 minutter for at fjerne størstedelen af ​​blodpladerne.
  7. Fjern supernatanten og resuspender cellepelleten i 1 - 2 ud ml IMDM. Celler kan anvendes feller øjeblikkelig kultur, eller frosset ned til senere brug. For kryopræservering, tilsættes samme mængde nedfrysning medium. Alikvote celler i kryohætteglas (0,5 - 1 ml pr hætteglas) og overføre kryoglas til en -80 ° C fryser øjeblikkeligt. PB MNC'er kan opbevares i -80 ° C fryser i flere uger eller overføres til en flydende nitrogen tank til langtidsopbevaring.
    BEMÆRK: Når optøning af frosne celler, selvom vores kryopræservering medium kan opretholde cellernes levedygtighed, kan cellen nummer falde på grund af celledød under optøningen. Det anbefales, at 1 - 10 x 10 7 celler vil blive nedfrosset i hvert hætteglas.

4. Udvidelse af PB multinationale selskaber i erythroid Medium

  1. Forbered 5 ml IMDM-medium i et 15 ml rør. Hurtigt tø de frosne PB multinationale selskaber i en 37 ° C vandbad og derefter overføre dem til røret med IMDM medium.
    BEMÆRK: Den tid i vandbad afhænger af mængden af ​​de kryopræserverede celler og cryovialet used. Sædvanligvis vil den frosne celle tø inden for 1 min.
  2. Centrifuger ved 400 x g i 5 - 10 min. Fjern supernatanten og resuspender cellepelleten i erythroid medium. Tilsæt 10 pi trypanblåt-opløsning til 10 pi cellesuspension og bland godt. Trypan Blå farver døde celler inden for 1 - 3 min. Tæl cellerne under mikroskop ved hjælp af en hæmocytometer.
  3. Kultur PB MNC'er i en ikke-vævskultur (ikke-TC) behandles 6-brønds plade med 2 ml medium per brønd, på en celletæthed på ~ 5 x 10 6 celler / ml, ved 37 ° C i en 5% CO2 fugtig inkubator.
  4. Tilsæt 1 ml frisk erythroide medium direkte til hver brønd uden ændring af mediet ved D 3 og 5.
  5. Hos D 6, høste PB multinationale selskaber til nucleofection.

5. PB MNC nucleofection og Omprogrammering

  1. En dag før nucleofection, pre-coat TC-behandlede plader med 6 brønde med 0,1% gelatine ved 37 ° C i 20 min. Thaw inaktiveret muse embryonale Fibroblast (MEF) fødeceller i et 37 ° C vandbad og straks overføre dem til en 15 ml rør indeholdende 5 ml MEF medium.
  2. Centrifuger ved 400 x g i 5 minutter og fjern supernatanten. Fjern gelatinen fra 6-brønds plade, resuspendere cellepelleten i MEF medium, og overføre dem til gelatinen forbehandlet 6-brønds plade. I hver brønd, seed 2 - 4 x 10 5 inaktiverede MEF celler suspenderet i 2 ml MEF medium.
  3. Kultur MEF fødeceller ved 37 ° C i en 5% CO2 befugtet inkubator.
  4. På dagen for nucleofection, opsug MEF medium og erstatte det med 1 ml erythroid medium. Pre-ækvilibrere dyrkningspladen for 10 - 30 minutter ved 37 ° C i en 5% CO2 befugtet inkubator.
  5. Tilsæt 2 ug pEV-OCT4-2A-SOX2, 1 ug pEV-myc, 1 ug pEV-KLF4 og 0,5 ug pEV-BCL-XL i et 1,5 ml sterilt Eppendorf-rør. Opvarm røret ved 50 ° C i 5 minutter for at forhindre kontaminering, og køle ned til stuetemperatur. Tilføje57 uL nucleofection buffer og 13 uL supplement.
  6. Harvest 2 x 10 6 dyrkede PB multinationale selskaber til en 5 ml rør ved centrifugering ved 200 xg i 7 min. Fjern supernatanten og tilsæt plasmidet og nucleofection buffer mix til cellepelleten. Bland godt ved at stille røret med fingeren.
    BEMÆRK: Så lavt som 2 x 10 5 celler kan anvendes til nucleofection, men en lavere omprogrammering effektivitet bør forventes som godt.
  7. Overfør DNA'et og cellesuspensionen til kuvetten følger med kittet og hætten kuvetten. Vælg programmet U-008 på nucleofection enheden. Sæt kuvetten i holderen, og tryk på OK for at anvende U-008-programmet.
  8. Tag kuvetten ud af holderen, tilsættes 0,5-1 ml forvarmet erythroide medium i hver kuvette, og overfør celler til pre-ligevægt MEF plade med det samme. På grund af den høje omprogrammering effektivitet og donor variation, podning forskellige antal celler i området fra 1-10 x 10 5 celler pER brønd stærkt fremmet.
  9. Overfør pladen til en hypoxi kammer, og skyl kammeret med en blandet gas sammensat af 92% N2, 5% CO2 og 3% O2, til 1 - 2 minutter ved en hastighed på 20 l / min. Efter lukning af kammeret, dyrke cellerne ved 37 ° C.
  10. Ved D2 post-nucleofection tilsættes 2 mL iPSC medium direkte til hver brønd.
  11. Ved D 4 efter nucleofection, fjerne 3 ml medium og tilsæt 2 ml frisk iPSC medium. Ved D 4 efter nucleofection, vil de fleste af de levende celler er fæstnet til fødelag.
  12. Efter D 6 post-nucleofection, ændre mediet hver 2 d ved at efterlade 500 uL brugt medium og tilsætning af 2 ml frisk E8 medium suppleret med 0,25 mM natriumbutyrat indtil D 14-18.
    BEMÆRK: Yderligere feeder celler kan tilføjes i dyrkningsbrøndene når observere, at feeder celler er blevet løsrevet. Efter optøning MEF'er (se 5.1 og 5.2), resuspender cellepelleten i et lille volumen E8 medium (dvs. ~ 0.2 ml til en brønd af en 6-brønds plade) og derefter tilføje MEF'er ind dyrkningsbrøndene. Ca. kan tilsættes 2% FBS for at øge cellevedhæftning. Alternativt kan MEF-konditioneret medium også anvendes, men det er mere arbejdskrævende.

6. Udvidelse af iPSCs

BEMÆRK: I de fleste tilfælde et stort antal IPSC kolonier vises D 8 - 10 efter nucleofection. Efter D 14, store IPSC kolonier er normalt klar til plukning.

  1. Før plukke kolonier, tilsættes 500 pi E8 medium suppleret med ROCK inhibitor, Y27632 (10 uM), i en brønd på en arkføder eller Matrigel coatede 24-brønds plade. Brug en uL pipette 10 eller 20 at ridse og plukke kolonier under mikroskop. Overfør stykker af hver koloni til brøndene indeholdende dyrkningsmediet.
    BEMÆRK: Koncentrationen af ​​Matrigel forskellig fra parti til parti. Normalt anvender vi 1: 100 fortynding af Matrigel.
    1. For at undgå krydskontaminering, pickkolonier, der er store og godt adskilt fra andre. Kultur iPSCs ved 37 ° C i en 5% CO2 befugtet inkubator.
      BEMÆRK: Det bør være opmærksom på, at iPSC befolkning kan være polyklonale skyldes cellemigrering når der er snesevis eller hundredvis af kolonier i hver brønd i en 6-brønds plade.
  2. Du må ikke ændre medium for den første 2 d. ROCK inhibitor kan fremme overlevelsen af små kolonier 25.
  3. Fra D 2 og fremefter, ændre medium hver dag ved at fjerne brugt medium og tilsætte 500 pi frisk E8 medium i hver brønd.
  4. Ca. 1 uge senere, når kolonierne er store nok, fjern medium og behandle cellerne med 300 pi Cellefrigørelse opløsning (0,5 mM EDTA i PBS) ved 37 ° C til 1 - 3 min. Fjern Cellefrigørelse opløsning og tilføje E8 medium indeholdende ROCK inhibitor (10 uM) suspendere iPSCs. Må ikke nedbryde kolonier i enkelte celler, hvilket kan føre til overdreven celledød. Cellen klumper med 5-50 celles er egnede til iPSC passage.
  5. Overfoeres 50 - 100% af cellesuspensionen til hver brønd i en 12- eller 6-brønds plade, der er blevet belagt med foderautomater eller Matrigel.
  6. For langsigtede kultur i Matrigelcoatede plader (se note i 6.1), ændre mediet hver dag. Når cellekonfluens når 40 - 60%, behandle cellerne med 1 ml Cellefrigørelse opløsning (0,5 mM EDTA i PBS) ved 37 ° C i ~ 3 min. Når kolonierne begynder at krølle op, fjerne cellen detachement løsningen og tilføje E8 medium indeholdende ROCK inhibitor (10 uM) at suspendere iPSCs. Passage celler med en opdeling faktor 4 - 8. ROCK hæmmer bør tilføjes, når passage celler til at øge overlevelsen og fjernet en d senere for at forhindre differentiering.
  7. At fryse-down iPSCs, behandle celler med Cellefrigørelse opløsning ved 37 ° C i 3 - 5 min ifølge producentens protokol. Da IPSC kolonier begynder at krølle op, suge bufferen og tilføje 0,5-1 ml E8 medium.
  8. <li> Tilføj en tilsvarende mængde kryopræservering medium til cellesuspensionen og bland godt. Frozen iPSCs kan opbevares i en -80 ° C fryser i flere uger eller i flydende nitrogen til langvarig opbevaring.

7. Valg af iPSCs uden Resterende episomale plasmider

  1. Efter passage 5, høst iPSCs og udtrække genomisk DNA.
    BEMÆRK: Normalt efter 5 passager af kultur, resterende episomale plasmider er målbart. Således næsten alle de IPSC kolonier på passager over 5 (dvs. passage 10) mangler resterende episomale plasmider.
  2. Brug genomisk DNA fra utransficerede PB MNC'er som en negativ kontrol. Tilføj 1,6 pg pEV-OCT4-2A-SOX2 plasmidet i 1 ug negativ kontrol-DNA at efterligne celler med en kopi af pEV plasmid per celle.
  3. Tilføj 9 pi PCR-grade vand, herunder 100 ng genomisk DNA og 1 pi specifikke primere (10 pM af hver af forward og reverse primere) i 10 pi High-Fidelity PCR Master Mix. Normalisere amount af DNA ved GAPDH. Brug følgende primere til PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Inkuber reaktionsblandingen ved 98 ° C i 60 s; efterfulgt af 98 ° C i 10 s, 60 ° C i 30 s og 72 ° C i 30 s. Efter 30 cykler; forlænge reaktionen ved 72 ° C i 5 min.
  5. Belastning 5 pi PCR-produkter i hver brønd af en 1% agarosegel. Kør gel til 20 - 30 min ved 100 V. Vælg IPSC-kloner med målbart bånd til EBNA1 og WPRE for yderligere kultur og nedstrøms analyse.

8. flowcytometri

  1. Harvest iPSCs ved at behandle dem med Accutase ved 37 ° C i 3 - 5 min til opnåelse af en enkelt cellesuspension. Tilsæt 1 pi PE-konjugeret anti-TRA-1-60 eller eFluor 570-konjugeret anti-SSEA4 eller isotypekontrol antistof til 100 pi cellesuspension (1 - 5 x 10 5 celler) I 5 ml rør. Inkubér rørene i et mørkt sted ved stuetemperatur i 20 min.
  2. Efter farvning i 20 minutter ved stuetemperatur, tilsættes 2 ml PBS og centrifugeres ved 400 xg i 5 min. Resuspender celler i 300 pi PBS til fluorescens-aktiveret cellesortering (FACS) analyse under anvendelse af en flowcytometri celle analysator. 23,26

9. Konfokal Imaging

  1. Seed iPSCs i Matrigel coatede kammer dias.
  2. Efter 3 - 4 d af kultur, fjerne vækstmediet og fastgør med 4% paraformaldehyd (PFA) ved stuetemperatur i 30 minutter. Vask cellerne to gange med PBS.
    Bemærk: PFA er giftigt og skadeligt.
  3. Behandl cellerne med 0,1% Triton X-100 i PBS (PBS-T) ved stuetemperatur i 30 minutter. Vask cellerne to gange med PBS.
  4. Blokere cellerne med blokeringsbuffer (5% gedeserum i PBS, V: V) ved stuetemperatur i 1 time.
  5. Under blokerende trin, fortyndes det primære antistof (100x) i blokerende buffer.
    BEMÆRK: antistoffer oplysninger er angivet i tabellen Materialer / udstyr.
  6. Inkuber celler med fortyndet antistof ved 4 ° CO / N.
  7. Vask to gange med PBS-T i 15 minutter, efterfulgt af to gange med PBS i 15 min.
  8. Cellerne inkuberes med en fortyndet fluorofor-konjugeret sekundært antistof ved stuetemperatur i 2 timer.
  9. Vask cellerne to gange med PBS-T i 15 minutter, efterfulgt af to gange med PBS i 15 min.
  10. Farv kernen med DAPI (1 ug / ml) i PBS ved stuetemperatur i 10 min.
  11. Vask cellerne to gange med PBS i 15 min.
  12. Tag billeder med en konfokal mikroskop. 23,27

10. Teratom Assay

Harvest 1 x 10 6 iPSCs med Cellefrigørelse opløsning (0,5 mM EDTA i PBS) og resuspender cellerne i 200 pi DMEM / F12 fortyndet (1: 1) Matrigel.

  1. Subkutant injicere celler i den bageste haunch af NOD / SCID immunsvækkede mus.
  2. Ved 8-12 uge efter iPSC injektion, dissekere og løse teratomer i 10% formalin. 28
  3. Efter microsectioning ogfarvning med hæmatoxylin og eosin (H & E), analysere prøver. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ved hjælp af denne protokol, kan vi få flere hundrede kolonier fra 1 x 10 5 nucleofected PB multinationale selskaber (figur 1A og 1B). Omprogrammering effektivitet er ca. 0,2 - 0,5%, og kolonierne ekspres pluripotens markører (fig 1c og 1d). iPSCs genereret ved hjælp af den beskrevne protokol er integration-fri og har evnen til at danne teratom komponere de 3 kimlag (figur 1 E og 1 F).

figur 1
Figur 1: Generering af Integration-fri iPSCs fra perifert blod mononukleære celler. (A): En skematisk af protokollen for at omprogrammere perifere blodceller. (B): AP farvning i løs vægt (til venstre) og en typisk ESC-lignende iPSC koloni (til højre)60; 14 d efter PB multinationale selskaber nucleofection. Scale bar: 100 um. (C): Repræsentative FACS diagrammer over iPSCs på passage 5 udtrykker TRA-1-60 eller SSEA4. (D): Repræsentative konfokale billeder af IPSC kolonier udtrykker NANOG og OCT4. Scale bar: 100 um. (E): Repræsentant billede af det samlede billede og H & E farvning af teratom omfattende alle tre kim lag. Scale bar: 100 um. (F): Kopier antal tilbageværende EV plasmider i iPSCs efter fem passager. Specifikke primere for EBNA1 og WPRE blev anvendt til at opformere episomale vektorer. GAPDH blev anvendt som en DNA-loading kontrol. UD, målbart. Den positive bane angiver en én-kopi kontrol. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Erhvervelse blodprøver fra raske donorer eller patienter er praktisk og ikke-invasiv, hvilket gør det til et attraktivt celle kilde til grundforskning og klinisk celleterapi. Her har vi beskrevet en protokol for højeffektive generation af integration-fri iPSCs fra perifere blodprøver. Denne reproducerbar og billig tilgang bør gavne iPSC feltet.

Vi har rapporteret, at der er to kritiske faktorer, der er ansvarlige for den meget effektive PB omprogrammering 30. Den ene er ækvimolær ekspression af OCT4 og SOX2 ved anvendelse af en 2A linker 31. For at opnå dette, er pEV-OCT4-2A-SOX2 anvendes i denne protokol. Den anden er brugen af to plasmider pEV-myc og pEV-KLF4 at udtrykke MYC og KLF4 stedet for pEV-MYC-2A-KLF4 at vi tidligere har brugt 30. Den tilsyneladende simpel ændring fører til en ca. 100X stigning i PB omprogrammering effektivitet, hvilket i høj grad skyldes en gradvis og større stigning i MYC: KLF4-forhold i løbet af processen.

bør overvejes Flere punkter for at opnå højeffektiv iPSC generation fra PB. PB multinationale selskaber dyrkes i ~ 1 uge i erythroid medium, som fremmer proliferation og udvidelse af erythroide stamceller og dermed øger omprogrammering effektivitet 20. For nogle prøver, især til blodceller fra leukæmipatienter, celler overlever dårligt, når de dyrkes i erythroid-medium. I dette tilfælde ville det være nyttigt at nedsætte dyrkningstid. Det er også opfordres til at bruge 1 - 2 ud ug pmaxGFP vektor for at verificere nucleofection effektivitet, som bør være større end 50%. Desuden plasmidet kvalitet er vigtig. Det anbefales at anvende plasmider uden endotoksinkontaminering (dvs. under anvendelse af Endo-free Plasmid Maxi Kit til at ekstrahere plasmider). Dårlig plasmid kvalitet kan føre til betydelig celledød og dermed reducere omprogrammering effektivitet. Vi og andre har vist, at hypoxi kampaes iPSC generation 14,32. Vi skylle hypoxi kammer med en blandet gas sammensat af 92% N2, 5% CO2 og 3% O2. Hvis normoxi i stedet bliver brugt, kan der observeres en op til 80% reduktion i omprogrammering effektivitet. Når omprogrammering er afsluttet, kan iPSCs dyrkes i en regelmæssig befugtet 5% CO2-inkubator. Når der skiftes medium, er det praktisk at efterlade en lille mængde af forbrugt medium (dvs. 500 pi per brønd i en 6-brønds plade), og derefter tilføje frisk medium. Skift medium kun hver anden dag i løbet af omprogrammering, som alt for hyppig medium ændring kan reducere iPSCs generation 33.

Den nye protokol vi har udviklet har opnået en høj-niveau PB omprogrammering som er sammenlignelig med den SV omprogrammering systemet. EV-systemet har flere indlysende fordele. For én, EV er mere overkommelig end SV. EV Systemet kan også modificeres yderligere ved at inkludere yderligere faktorer eller forskellige kombinationer af flere faktorer, hvorimod SVS vektorer er et kommercielt produkt, som ikke kan ændres af efterforskere. Vores nuværende protokol omfatter brug af MEF feeder celler og animalske produkter, der kan begrænse de kliniske applikationer, men kan nemt fjernes ved yderligere protokol udvikling 34,35.

iPSCs genereret med dette system kan bruges ikke kun til sygdom modellering og narkotika screening, men også til klinisk terapi, fordi GMP-niveau EV plasmider kan let genereres og ingen iPSCs med betydelig EV integration er blevet identificeret. I kliniske anvendelser, patient celler normalt huser en sygdom-fremkaldende gen, der skal rettes i iPSCs før differentiering i funktionelle celler til terapi. En nylig rapport viste, at EV omprogrammering systemet kan let integreres med CRISPR / Cas9 system for at opnå samtidig omprogrammering og genom-redigering efter en simpel nucleofection 36. Dette er enNother fordel ved EV over SV system. Vores upublicerede data har vist, at op til 20% genom redigering effektivitet kan opnås, når snylter genom redigering på EV omprogrammering. Det er vores håb, at integrationen af ​​PB omprogrammering med sprød / Cas9R genom-redigering kan have potentielle anvendelser i behandling af flere sygdomme, der ellers uhelbredelige i de kommende årtier.

Sammenfattende bør vores forbedrede perifere blodceller omprogrammering protokol være nyttige for en bred vifte af efterforskere i grundforskning og kliniske anvendelser. Dette effektive EV omprogrammering systemet kan også anvendes, efter modifikationer, for at generere integrationsrelevante fri mesenchymale stamceller (MSC'er) 37 eller neurale stamceller (NSC) 38, direkte fra voksne perifere blodceller uden at passere et iPSC fase.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
Generation af Integration-fri induceret pluripotente stamceller fra humane perifere mononucleære blodceller Brug episomale vektorer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter