Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Génération d'Intégration-libres induits des cellules souches pluripotentes à partir de cellules mononucléaires sang périphérique humain utilisant épisomique Vecteurs

doi: 10.3791/55091 Published: January 1, 2017

Abstract

Les cellules souches pluripotentes induites (CISP) sont très prometteurs pour la modélisation des maladies et des thérapies régénératrices. Nous avons précédemment rapporté l'utilisation de vecteurs épisomiques (EV) pour générer CSPi sans intégration-à partir de cellules mononucléaires du sang périphérique (PB MNC). Les vecteurs épisomiques utilisés sont des plasmides d'ADN incorporés avec oriP et EBNA1 éléments provenant du virus d' Epstein-Barr (EB), qui permettent la réplication et à long terme retainment de plasmides dans des cellules de mammifères, respectivement. Avec une optimisation plus poussée, des milliers de colonies iPSC peuvent être obtenus à partir de 1 ml de sang périphérique. Deux facteurs essentiels pour atteindre l'efficacité élevée de reprogrammation sont: 1) l'utilisation d'un 2A "auto-clivage" peptide pour relier OCT4 et SOX2, réalisant ainsi l'expression équimolaire des deux facteurs; 2) l'utilisation de deux vecteurs pour exprimer MYC et KLF4 individuellement. Nous décrivons ici un protocole étape par étape pour générer iP sans intégration,SCs à partir d'échantillons périphériques adultes de sang. Les CSPi générées sont libres d'intégration, comme des plasmides épisomiques résiduels sont indétectables après cinq passages. Bien que l'efficacité de reprogrammation est comparable à celle du virus Sendai (SV) des vecteurs, des plasmides EV sont beaucoup plus économiques que les vecteurs SV disponibles dans le commerce. Ce système EV de reprogrammation abordable détient un potentiel pour des applications cliniques en médecine régénératrice et fournit une approche pour la reprogrammation directe des multinationales PB aux cellules sans intégration-mésenchymateuses souches, les cellules souches neurales, etc.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Après l'expression forcée de plusieurs facteurs de transcription (C. -à- OCT4, SOX2, MYC et KLF4), les cellules somatiques peuvent être reprogrammées pour induits des cellules souches pluripotentes (CISP), qui sont très prometteurs pour des applications en médecine régénérative et la thérapie cellulaire de remplacement 1-3. À ce jour, diverses méthodes ont été développées pour augmenter le taux de reprogrammation 4-7 de succès. vecteurs induite par la reprogrammation virale est largement utilisé pour la production efficace de CSPi, parce que l'intégration virale conduit à un niveau élevé, l'expression stable des facteurs de reprogrammation. Cependant, l' intégration stable de l'ADN du vecteur dans le génome de la cellule peut provoquer une 5 mutagenèse insertionnelle. En outre, l' inactivation insuffisante des facteurs de reprogrammation peut perturber la différenciation des CSPi 8. En tant que tel, l'utilisation de iPSCs sans intégration de facteurs de reprogrammation est impératif, en particulier pour une utilisation dans des applications de thérapie cellulaire.

9. L'élément oriP favorise la replication du plasmide dans des cellules de mammifère, tandis que l'élément EBNA1 longes le plasmide ADN contenant oriP à l'ADN chromosomique qui permet la séparation de l'épisome au cours de la division de la cellule hôte. En comparaison à d' autres approches sans intégration, y compris les virus Sendai (SV) et la transfection d' ARN, les véhicules électriques possèdent de multiples avantages 5,6,10. Comme l'ADN plasmidique, les véhicules électriques peuvent être facilement produits et modifiés dans la maison, ce qui les rend extrêmement abordable. En outre, la reprogrammation EV est un processus de main-d'œuvre moins depuis une seule transfection avec des véhicules électriques est suffisante pour la production iPSC, alors que plusieurs transfections d'ARN sont nécessaires pour la reprogrammation réussie.

réfibroblastes ermal ont été utilisés dans de nombreuses études de reprogrammation. Cependant, une biopsie de la peau est non seulement un processus invasif et douloureux, mais aussi beaucoup de temps pour développer des cellules à des quantités suffisantes pour la reprogrammation. Plus préoccupant, les cellules de la peau des donneurs adultes ont souvent été exposés à long terme le rayonnement de lumière UV, ce qui peut conduire à des mutations associées à des tumeurs, ce qui limite les demandes de CSPi dérivées de fibroblastes de peau 11,12. Récemment, il a été rapporté que des cellules de peau humaine normale accumulent des mutations somatiques et les gènes du cancer multiples, y compris la plupart des principaux moteurs de carcinomes épidermoïdes cutanés, sont soumis à une forte sélection positive 13.

Contrairement aux fibroblastes de la peau, du sang périphérique (PB), les cellules sont une source de cellules pour une reprogrammation préférable parce que 1) les cellules sanguines peuvent être facilement obtenues par un procédé minimalement invasive, 2) des cellules du sang périphérique sont la descendance des cellules souches hématopoïétiquesrésidant dans la moelle osseuse, ainsi protégé contre les radiations nocives. Les cellules mononucléées du sang périphérique (PB MNC) peuvent être collectées en une heure de la couche leuco-plaquettaire après une centrifugation à gradient simple à l'aide de Ficoll-Hypaque (1,077 g / mL). Les multinationales PB obtenues sont composées de lymphocytes, monocytes et quelques cellules progénitrices hématopoïétiques (HPC) 14. Bien que les lymphocytes T humains sont l' un des principaux types de cellules dans PB, lymphocytes T matures contiennent des réarrangements du récepteur des cellules T (TCR) des gènes et manquent un génome intact limitant ainsi leur potentiel pour les applications 15,16. Cependant, le rajeunissement des cellules T via la génération iPSC peut avoir des applications potentielles dans chimériques Antigène Receptor (CAR) Thérapie des cellules T 17-19. En comparaison, les CAH ont un génome intact et sont facilement reprogrammable. Bien que seulement 0,01 à 0,1% des cellules dans la circulation périphérique sont CAH, ces cellules peuvent être développées ex vivo dans un milieu qui favorise la prolifération érythrocytaire du erythrcellules progénitrices oid 14.

Dans notre étude précédente, nous avons utilisé le facteur BCL-XL en plus des facteurs Yamanaka (OCT4, SOX2, MYC et KLF4), ce qui a entraîné une augmentation de 10x PB reprogrammation efficency 20. BCL-XL, également connu sous le nom BCL2L1, est un puissant inhibiteur de la mort cellulaire, par l' activation des caspases 21,22 inhibiteur. Mais, BCL-XL peut aussi jouer un rôle important dans le maintien de la pluripotence 21,22. Récemment, nous avons optimisé notre système EV de reprogrammation en exprimant séparément MYC et KLF4 avec deux vecteurs, ce qui conduit à une augmentation d' environ 100x dans l' efficacité de reprogrammation 23. En utilisant cette méthode, l'efficacité de reprogrammation, définie par le nombre de colonies de départ divisée par le nombre de cellules à transfection, est 0,2 à 0,5% de donneurs sains. Comme suit, nous décrivons la procédure expérimentale détaillée pour générer CSPi sans intégration de-PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tous les échantillons PB humains ont été obtenus à partir de donneurs adultes anonymes avec aucune information d'identification disponibles à partir de Tianjin Blood Center avec l'approbation du comité d'éthique de la recherche locale.

Plasmide Préparation 1. Endo-free

  1. Utiliser un kit de purification de plasmide commercial Maxi pour extraire des vecteurs épisomiques de E. coli conformément au protocole du fabricant. Pour l'étape finale, tampon TE substitut à l'eau stérile sans endotoxine pour dissoudre le culot d'ADN.
  2. Mesurer la concentration d'ADN en utilisant un spectrophotomètre commercial UV / Vis. La concentration est généralement supérieure à 1 ug / ul, avec A260 / A280 et les rapports A260 / A230 supérieur à 1,8 et 2,0, respectivement.

2. Culture Media

  1. Préparer le milieu érythroïde: souches hématopoïétiques Expansion cellulaire additionné de 100 ng / mL cellules souches humaines Factor (SCF), 10 ng / ml d'interleukine-3 (IL3), 2 U / ml érythropoïétine (EPO), 20 ng / mL insulin growth factor-1 (IGF-1), 1 uM de dexaméthasone et 0,2 mM de 1-thioglycérol. Stériliser par filtration avec un filtre à seringue de 0,22 um. moyen érythroïdes peut être conservé à 4 ° C pendant jusqu'à un mois.
  2. Préparer le milieu iPSC: milieu DMEM / F12 (milieu Eagle modifié le Mélange / des éléments nutritifs de Dulbecco F-12) supplémenté avec 1x L-glutamine, 1x pénicilline / streptomycine, 1x non essentielle solution d'acides aminés, 50 ng / mL Fibroblast Growth Factor 2 (FGF2 ), supplément 1x Insulin-transferrine-Sélénite (ITS), et 50 mg / ml d'acide ascorbique. Stériliser par filtration avec un filtre à seringue de 0,22 um. COPSi milieu peut être stocké à 4 ° C pendant jusqu'à un mois.
  3. Préparer le milieu MEF: milieu de Eagle modifié Dulbecco (DMEM; glucose élevé) supplémenté avec 1x pénicilline / streptomycine et 10% de sérum bovin fœtal (FBS). Stériliser par filtration avec un filtre à seringue de 0,22 um. moyen MEF peut être conservé à 4 ° C pendant jusqu'à un mois ou fraîchement ajouter 1x L-glutamine avant utilisation.
  4. PRepare moyen COPSi de cryoconservation (2x): dissoudre 5 g de D-tréhalose dans 30 ml d'eau stérile dans un bain-marie à 37 °. Amener la température à 4 ° C, puis ajouter 10 ml de FBS et 10 ml de diméthylsulfoxyde (DMSO). Stériliser par filtration avec un filtre à seringue de 0,22 um. Conserver à 4 ° C pendant 3 mois 24.

3. Isolement des cellules mononucléaires du sang périphérique (PB MNC)

  1. Mélanger 10 ml échantillon frais de PB et tampon de 10 ml de PBS dans un tube de 50 ml et bien mélanger. Apporter du PBS à la température ambiante ou à 37 ° C avant utilisation.
    NOTE: environ 1 - 3 x 10 6 multinationales (frais ou cryoconservés) peut être obtenu à partir de 1 ml de PB. Après 6 d de la culture, attendez -vous à avoir 0,5 - 1 x 10 6 cellules totales en raison de la mort des cellules matures pendant la culture. Environ 1 x 10 7 cellules peuvent être obtenues à partir de 10 ml de PB frais.
  2. Ajouter 10 ml de Ficoll au fond du tube en utilisant une seringue de 10 ml fixée à une longue aiguille. Ce process doit être effectuée lentement pour faire en sorte que la couche de Ficoll ne se mélange pas avec le PB.
  3. Centrifuger à 400 g pendant 30 min à une vitesse d'accélération et de décélération faible. Après centrifugation, les MNC sont PB dans la couche blanche (couche leucocytaire) se trouvant entre le plasma et le PB Ficoll.
  4. Lentement aspirée ~ 10 PB ml de plasma sans déranger la couche de la couche leucocytaire. récolter soigneusement la couche blanche en utilisant une pointe de pipette 1 mL à un nouveau tube de 50 ml. Le volume total des cellules recueillies à partir de la couche blanche sera entre 3-6 ml.
  5. Ajouter PBS pour porter le volume total à 30 ml et bien mélanger avec une pipette de 10 ml. Centrifuger à 400 g pendant 10 min.
  6. Retirer le surnageant et remettre le culot cellulaire dans 20 ml de milieu de culture (milieu de Dulbecco modifié de Iscove ie, IMDM) et bien mélanger. Centrifuger à 400 g pendant 10 min pour éliminer la majorité des plaquettes.
  7. Eliminer le surnageant et remettre en suspension le culot cellulaire dans 1 - 2 ml d'IMDM. Les cellules peuvent être utilisées fou de la culture immédiate, ou congelés vers le bas pour une utilisation ultérieure. Pour la cryoconservation, ajouter un montant égal de milieu de cryoconservation. cellules aliquotes en cryotubes (0,5 - 1 ml par flacon) et cryotubes de transfert à -80 ° C immédiatement au congélateur. PB MNC peuvent être stockés à -80 ° C dans le congélateur pendant plusieurs semaines ou transférés dans un réservoir d'azote liquide pour un stockage à long terme.
    NOTE: Lors de la décongélation les cellules congelées, bien que notre milieu de cryoconservation peut maintenir la viabilité des cellules, le nombre de cellules peut diminuer en raison de la mort cellulaire au cours du processus de décongélation. Il est recommandé que 1 - 10 x 10 7 cellules sont congelées dans chaque flacon.

4. Expansion des multinationales PB dans érythroïde Medium

  1. Préparer 5 ml de milieu IMDM dans un tube de 15 ml. dégeler rapidement les PTM PB congelés dans un bain-marie à 37 °, puis les transférer sur le tube avec le milieu IMDM.
    NOTE: La longueur de temps dans un bain d'eau dépend du volume des cellules cryoconservés et u cryovialsed. Habituellement, la cellule congelée se dégeler à moins de 1 min.
  2. Centrifuger à 400 xg pendant 5 - 10 min. Eliminer le surnageant et remettre en suspension le culot cellulaire dans du milieu érythroïdes. Ajouter 10 uL solution bleu Trypan à 10 pi de suspension cellulaire et bien mélanger. Trypan bleu colore les cellules mortes dans les 1 - 3 min. Compter les cellules au microscope en utilisant un hémocytomètre.
  3. MNC Culture PB dans une culture non-tissu (non-TC) traitées plaque de 6 puits avec 2 ml de milieu par puits, à une densité de cellules de ~ 5 x 10 6 cellules / ml, à 37 ° C dans un 5% de CO 2 incubateur humidifié.
  4. Ajouter 1 ml de milieu frais directement érythroïde à chaque puits, sans changer le milieu à D 3 et 5.
  5. Au D 6, récolter les multinationales PB pour nucléofection.

5. PB MNC Nucléofection et Reprogrammation

  1. Un jour avant nucléofection, la pré-couche TC-traitée plaques à 6 puits avec 0,1% de gélatine à 37 ° C pendant 20 min. Thaw inactivé murin Embryonic Fibroblast (MEF) cellules nourricières dans un bain-marie à 37 ° et immédiatement les transférer sur un tube de 15 ml contenant 5 ml de milieu MEF.
  2. Centrifuger à 400 g pendant 5 min et retirer le surnageant. Retirer la gélatine à partir de la plaque de 6 puits, resuspendre le culot cellulaire dans un milieu MEF, et les transférer à la gélatine pré-traitée plaque de 6 puits. Dans chaque puits, semences 2 - 4 x 10 5 cellules MEF inactivées en suspension dans 2 ml milieu MEF.
  3. La culture des cellules nourricières MEF à 37 ° C dans un incubateur à CO2 humidifié à 5%.
  4. Le jour de nucléofection, aspirez le milieu MEF et le remplacer par 1 ml de milieu érythroïde. Pré-équilibrer la plaque de culture pendant 10 - 30 min à 37 ° C dans un incubateur à CO2 humidifié à 5%.
  5. Ajouter 2 pg pEV-OCT4-2A-SOX2, 1 pg pEV-MYC, 1 pg pEV-KLF4, et 0,5 pg pEV-BCL-XL dans un tube de 1,5 ml stérile Eppendorf. Chauffer le tube à 50 ° C pendant 5 min pour éviter la contamination, et refroidir à la température ambiante. Ajouter57 ul nucléofection tampon et 13 supplément de pi.
  6. Récolte 2 x 10 6 des multinationales cultivées PB à un tube de 5 ml par centrifugation à 200 xg pendant 7 min. Eliminer le surnageant et ajouter le mélange tampon plasmide et nucléofection au culot cellulaire. Bien mélanger en tapotant le tube avec votre doigt.
    NOTE: Seulement en 2 x 10 5 cellules peut être utilisé pour nucléofection, mais une efficacité de reprogrammation inférieure devrait être prévu ainsi.
  7. Transférer l'ADN et la suspension de cellules dans la cuvette fournie dans le kit et le capuchon de la cuvette. Sélectionnez le programme U-008 sur le dispositif de nucléofection. Insérez la cuvette dans le support et appuyez sur OK pour appliquer le programme U-008.
  8. Prendre la cuvette sur le support, ajouter 0,5 - milieu érythroïde 1 ml de pré-chauffé dans chaque cuvette, et les cellules de transfert à la plaque MEF pré-équilibrée immédiatement. En raison de l'efficacité de reprogrammation élevé et la variation du donneur, l' ensemencement des nombres différents de cellules allant de 1-10 x 10 5 cellules per bien est fortement encouragée.
  9. Transférer la plaque à une chambre de l' hypoxie, et vider la chambre avec un gaz mixte composé de 92% de N2, 5% de CO 2 et 3% de O 2, pendant 1 - 2 min à un débit de 20 L / min. Après avoir scellé la chambre, la culture des cellules à 37 ° C.
  10. A D 2 post-nucléofection, ajouter 2 moyennes iPSC ml directement à chaque puits.
  11. Au D 4 post-nucléofection, retirer 3 ml de milieu et ajouter 2 ml de milieu iPSC frais. A D 4 post-nucléofection, la plupart des cellules vivantes auront fixé à la couche d'alimentation.
  12. Après D 6 post-nucléofection, changer le milieu tous les 2 d en laissant 500 pi passé milieu et en ajoutant 2 ml de milieu de E8 frais supplémenté avec 0,25 mM de sodium butyrate jusqu'à D 14-18.
    NOTE: supplémentaires cellules nourricières peuvent être ajoutés dans les puits de culture à chaque observation que les cellules nourricières ont été détachés. Après décongélation MEF (voir 5.1 et 5.2), remettre en suspension le culot cellulaire dans un petit volume de milieu E8 (soit ~ 0.2 mL pour un puits d'une plaque à 6 puits), puis ajouter MEFs dans les puits de culture. Environ 2% de FBS peut être ajouté pour augmenter la fixation des cellules. En variante, le milieu conditionné MEF- peut également être utilisé, mais il est plus laborieux.

6. Expansion des CSPi

NOTE: Dans la plupart des cas, un grand nombre de colonies iPSC apparaissent à D 8-10 après nucléofection. Après D 14, les grandes colonies iPSC sont généralement prêts pour la cueillette.

  1. Avant de prendre des colonies, ajouter 500 ul de milieu E8 complété avec un inhibiteur de ROCK, Y27632 (10 uM), dans un puits d'une alimentation ou Matrigel revêtu plaque de 24 puits. Utiliser une pipette de 10 ou 20 à gratter et ramasser des colonies sous le microscope. Transférer les morceaux de chaque colonie dans les puits contenant le milieu de culture.
    REMARQUE: La concentration en Matrigel diffère d'un lot à l'autre. Habituellement, nous utilisons 1: 100 dilution de Matrigel.
    1. Afin d'éviter la contamination croisée, choisissezcolonies qui sont grandes et bien séparés des autres. IPSCs de culture à 37 ° C dans un incubateur à CO2 humidifié à 5%.
      NOTE: Il devrait être noter que la population iPSC peut être polyclonaux en raison de la migration des cellules quand il y a des dizaines ou des centaines de colonies dans chaque puits d'une plaque à 6 puits.
  2. Ne changez pas moyen pour les 2 premiers jours. Inhibiteur de ROCK peut favoriser la survie des petites colonies 25.
  3. De D 2 et suivantes, changer moyenne chaque jour en enlevant milieu usé et addition de milieu de E8 500 pi frais dans chaque puits.
  4. Environ 1 semaine plus tard, lorsque les colonies sont assez grandes, éliminer le milieu et de traiter les cellules avec 300 ul d'une solution de détachement cellulaire (0,5 mM d'EDTA dans du PBS) à 37 ° C pendant 1 à 3 min. Retirer la solution de détachement des cellules et ajouter du milieu E8 contenant un inhibiteur de ROCK (10 uM) de suspendre CSPi. Ne pas briser les colonies en cellules individuelles, ce qui peut conduire à la mort cellulaire excessive. Les amas cellulaires avec 5-50 celluless sont adaptés pour le passage iPSC.
  5. Transfert 50 - 100% de la suspension cellulaire à chaque puits d'un puits 6 plaque 12 ou qui a été pré-revêtu avec mangeoires ou Matrigel.
  6. Pour la culture à long terme dans des plaques Matrigel revêtues (voir note 6.1), changer le milieu tous les jours. Lorsque la confluence des cellules atteint 40 - 60%, de traiter les cellules avec 1 ml d'une solution de détachement cellulaire (0,5 mM d'EDTA dans du PBS) à 37 ° C pendant environ 3 min. Lorsque les colonies commencent à se recroqueviller, enlever la solution de détachement des cellules et ajouter un inhibiteur de ROCK milieu contenant E8 (10 uM) de suspendre les CSPi. cellules Passage avec un facteur de division de 4 - 8. l'inhibiteur de ROCK doit être ajouté lorsque passage de cellules pour augmenter la survie, et enlevés 1 d tard pour empêcher la différenciation.
  7. Pour geler-down CSPi, traiter les cellules avec une solution de détachement des cellules à 37 ° C pendant 3 - 5 min selon le protocole du fabricant. Lorsque les colonies iPSC commencent à se recroqueviller, aspirez le tampon et ajouter 0,5 à 1 moyen E8 mL.
  8. <li> Ajouter un volume égal de milieu de cryoconservation à la suspension cellulaire et bien mélanger. Congelé iPSCs peut être stocké dans un congélateur à -80 ° C pendant plusieurs semaines ou dans de l'azote liquide pour un stockage à long terme.

7. Sélection des CSPi sans résiduel épisomique Plasmides

  1. Après le passage 5, CSPi de récolte et d'extraire l'ADN génomique.
    NOTE: Généralement, après 5 passages de la culture, des plasmides épisomiques résiduels sont indétectables. Ainsi, la quasi - totalité des colonies iPSC à 5 passages ci - dessus ( à savoir le passage 10) font défaut plasmides épisomiques résiduels.
  2. Utiliser l'ADN génomique de multinationales PB non transfectées comme témoin négatif. Ajouter 1,6 pg pEV-OCT4-2A-SOX2 plasmide dans l'ADN de contrôle négatif de 1 ug à imiter les cellules avec une copie du pEV plasmide par cellule.
  3. Ajouter 9 ul d'eau PCR de qualité, y compris 100 ADN génomique ng et 1 ul d'amorces spécifiques (10 pM de chacun des amorces sens et antisens) dans 10 pi haute fidélité PCR Master Mix. Normaliser l'amontant de l'ADN par la GAPDH. Utilisez les amorces suivantes pour la PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Incuber le mélange réactionnel à 98 ° C pendant 60 s; suivi par 98 ° C pendant 10 s, 60 ° C pendant 30 s et 72 ° C pendant 30 s. Au bout de 30 cycles; étendre la réaction à 72 ° C pendant 5 min.
  5. Charge 5 produits de PCR ul dans chaque puits d'un gel d'agarose à 1%. Exécutez le gel pendant 20 - 30 min à 100 V. Choisissez les clones iPSC avec des bandes indétectables pour EBNA1 et WPRE pour plus de la culture et de l'analyse en aval.

8. cytométrie de flux

  1. Récolte CSPi en les traitant avec Accutase à 37 ° C pendant 3 - 5 min pour obtenir une suspension cellulaire unique. Ajouter 1 pi conjugué à PE anti TRA-1-60 570 ou eFluor conjugué anti SSEA4 ou anticorps isotypique à 100 ul de suspension cellulaire (1 - 5 x 10 5 cellules) Dans des tubes de 5 ml. Incuber les tubes dans un endroit sombre à température ambiante pendant 20 min.
  2. Après coloration pendant 20 min à température ambiante, ajouter 2 ml de PBS et on centrifuge à 400 g pendant 5 min. Resuspendre les cellules dans 300 ul de PBS pour cellule activé par fluorescence (FACS) en utilisant une analyse par cytométrie en flux analyseur de cellules. 23,26

9. imagerie confocale

  1. CSPi de semences dans les diapositives de chambre enduits Matrigel.
  2. Après 3 - 4 d de la culture, éliminer le milieu de croissance et fixer avec 4% de paraformaldehyde (PFA) à température ambiante pendant 30 min. Laver les cellules deux fois avec PBS.
    Remarque: PFA est toxique et nocif.
  3. Traiter les cellules avec 0,1% de Triton X-100 dans du PBS (PBS-T) à température ambiante pendant 30 min. Laver les cellules deux fois avec du PBS.
  4. Bloquer les cellules avec un tampon de blocage (sérum de chèvre à 5% dans du PBS, V: V) à température ambiante pendant 1 h.
  5. Au cours de l'étape de blocage, diluer l'anticorps primaire (100x) dans un tampon de blocage.
    REMARQUE: Les informations d'anticorps est répertorié dans la Table des Matières / Équipement.
  6. Incuber les cellules avec l'anticorps dilué à 4 ° CO / N.
  7. Laver deux fois avec du PBS-T pendant 15 minutes, suivie par deux fois avec du PBS pendant 15 min.
  8. Incuber les cellules avec un anticorps secondaire dilué fluorophore conjugué à la température ambiante pendant 2 h.
  9. Laver les cellules deux fois avec du PBS-T pendant 15 minutes, suivie par deux fois avec du PBS pendant 15 min.
  10. Colorer le noyau avec du DAPI (1 pg / ml) dans du PBS à température ambiante pendant 10 min.
  11. Laver les cellules deux fois avec du PBS pendant 15 min.
  12. Capture d'images avec un microscope confocal. 23,27

10. Teratoma Assay

Récolte de 1 x 10 6 iPSCs avec une solution de détachement cellulaire (EDTA 0,5 mM dans du PBS) et remettre en suspension les cellules dans 200 ul de DMEM / F12 dilué (1: 1) Matrigel.

  1. Sous-cutanée injecter des cellules dans le cuissot arrière de souris immunodéficientes NOD / SCID.
  2. A 8-12 semaine après injection iPSC, disséquer et fixer tératomes dans 10% de formaline. 28
  3. Après microsectioning etcoloration à l'hématoxyline et l'éosine (H & E), d'analyser des échantillons. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En utilisant ce protocole, nous pouvons obtenir des centaines de colonies de 1 x 10 5 nucleofected PB MNC (Figures 1A et 1B). L'efficacité de reprogrammation est d' environ 0,2 à 0,5% et les colonies expriment des marqueurs de pluripotence (figures 1C et 1D). CSPi générées en utilisant le protocole décrit sont libres d' intégration et ont la capacité de former tératome composant les 3 couches germinales (figures 1E et 1F).

Figure 1
Figure 1: Génération de CSPi sans intégration de cellules-mononucléaires du sang périphérique. (A): Un schéma du protocole pour la reprogrammation des cellules du sang périphérique. (B): AP coloration en vrac ( à gauche) et une colonie typique ESC comme iPSC ( à droite)60; 14 j après PB MNC nucléofection. Barre d'échelle: 100 um. (C): FACS représentatifs des schémas de CSPi à passage 5 exprimant TRA-1-60 ou SSEA4. (D): les images confocales représentatives des colonies iPSC exprimant NANOG et OCT4. Barre d'échelle: 100 um. (E): Représentant l' image de l'image totale et coloration H & E de tératome comprenant les trois couches germinales. Barre d'échelle: 100 um. (F): Copiez le nombre de plasmides EV résiduels dans CSPi après cinq passages. des amorces spécifiques pour EBNA1 et WPRE ont été utilisés pour amplifier les vecteurs épisomiques. GAPDH a été utilisé comme témoin ADN de chargement. UD, indétectable. La voie positive indique un contrôle d'une copie. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'acquisition d'échantillons de sang provenant de donneurs sains ou de patients est pratique et non invasive, ce qui en fait une source de cellules attrayante pour la recherche fondamentale et la thérapie cellulaire clinique. Ici, nous avons décrit un protocole pour la production hautement efficace de iPSCs libre rapprochement à partir d'échantillons de sang périphérique. Cette approche reproductible et abordable devrait bénéficier le domaine iPSC.

Nous avons signalé qu'il ya deux facteurs essentiels responsables de la PB très efficace reprogrammation 30. La première est l' expression équimolaire de OCT4 et SOX2 en utilisant un segment de liaison 31 2A. Pour ce faire, pEV-OCT4-2A-SOX2 est utilisé dans ce protocole. L'autre est l'utilisation de deux plasmides pEV-MYC et pEV-klf4 pour exprimer MYC et KLF4 au lieu de pEV-MYC-2A-KLF4 que nous avons utilisé précédemment 30. Le changement apparemment simple conduit à une augmentation d'environ 100X dans PB efficacité de reprogrammation, qui est due en grande partie à une augmentation progressive et une plus grande dans le MYC: KLrapport F4 au cours du processus.

Plusieurs points doivent être pris en considération pour la réalisation de haute efficacité génération iPSC de PB. PTM PB sont cultivées pendant ~ 1 semaine en moyenne érythroïde, ce qui favorise la prolifération et l' expansion des cellules progénitrices érythroïdes et augmente ainsi l' efficacité de reprogrammation 20. Cependant, pour certains échantillons, en particulier pour les cellules sanguines provenant de patients atteints de leucémie, les cellules survivent mal lorsqu'elles sont cultivées dans un milieu érythroïde. Dans ce cas, il serait utile de réduire le temps de culture. Il est également encouragé à utiliser 1 - 2 pg pmaxGFP vecteur pour vérifier l'efficacité de nucléofection, qui devrait être supérieure à 50%. En outre, la qualité de plasmide est importante. Il est recommandé d'utiliser des plasmides sans contamination par des endotoxines (ie en utilisant Endo-free Kit Plasmid Maxi pour extraire les plasmides). La mauvaise qualité de plasmide peut conduire à la mort cellulaire significative et réduire ainsi l'efficacité de reprogrammation. Nous et d'autres ont montré que l'hypoxie promotes génération iPSC 14,32. On tire la chasse de la chambre à l'hypoxie avec un gaz mixte composé de 92% de N2, 5% de CO 2 et 3% de O 2. Si normoxie est utilisé à la place, une réduction allant jusqu'à 80% de l'efficacité de reprogrammation peut être observée. Une fois que la reprogrammation est terminée, iPSCs peut être cultivé dans un régulière humidifié à 5% de CO 2 incubateur. Lors du changement de milieu, il est pratique de laisser une petite quantité de milieu usé (soit 500 pl par puits dans une plaque de 6 puits), puis ajouter du milieu frais. Changer le milieu que tous les autres jours lors de la reprogrammation, le changement moyen trop fréquent peut réduire CSPi génération 33.

Le nouveau protocole, nous avons développé a atteint un reprogrammation de PB de haut niveau qui est comparable au système SV de reprogrammation. Le système EV présente plusieurs avantages évidents. Pour l'un, EV est plus abordable que SV. Le système EV peut également être encore modifiée en incluant des facteurs supplémentaires ou combina différentstions de multiples facteurs, alors que les vecteurs SVS sont un produit commercial qui ne peut pas être modifiée par les enquêteurs. Notre protocole actuel comprend l'utilisation de cellules nourricières MEF et des produits d'origine animale, ce qui peut limiter les applications cliniques, mais peuvent être facilement enlevés par développement de protocole 34,35.

CSPi générées par ce système peut être utilisé non seulement pour la modélisation de la maladie et le dépistage des drogues, mais aussi pour la thérapie clinique, car les plasmides EV GMP de niveau peuvent être facilement générés et aucun CSPi avec intégration EV considérables ont été identifiés. Dans les applications cliniques, les cellules du patient abritent habituellement un gène de la maladie d'induction, qui doit être corrigée dans les iPSCs avant la différenciation en cellules fonctionnelles pour la thérapie. Un récent rapport a montré que le système EV de reprogrammation peut être facilement intégré au système / cas9 CRISPR pour réaliser la reprogrammation simultanée et l' édition du génome après simple nucléofection 36. C'est unavantage nother de EV sur le système de SV. Nos données non publiées ont montré que jusqu'à un génome efficacité d'édition de 20% peut être réalisé lorsque ferroutage édition du génome sur EV reprogrammation. Nous espérons que l'intégration de PB avec reprogrammation CRISP / Cas9R génome édition peut avoir des applications dans le traitement de plusieurs maladies qui sont autrement incurables au cours des prochaines décennies.

En résumé, l'amélioration de notre protocole de reprogrammation de cellules de sang périphérique devrait être utile pour un large éventail de chercheurs en recherche fondamentale et les applications cliniques. Ce système EV de reprogrammation efficace peut également être utilisé, après modifications, pour générer des cellules sans intégration-souches mésenchymateuses (CSM) 37, ou des cellules souches neurales (NNC) 38, directement à partir de cellules périphériques adultes de sang sans passer par un stade iPSC.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
Génération d&#39;Intégration-libres induits des cellules souches pluripotentes à partir de cellules mononucléaires sang périphérique humain utilisant épisomique Vecteurs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter