Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

דור של תאי גזע מושרים אינטגרציה נטולה מן אדם הדם ההיקפי mononuclear תאי שימוש וקטורי Episomal

doi: 10.3791/55091 Published: January 1, 2017

Abstract

תאי גזע מושרים (iPSCs) מחזיקים הבטחה גדולה עבור מודלי מחלה וטיפולים רגנרטיבית. אנחנו שדווח בעבר השימוש וקטורים Episomal (EV) כדי ליצור iPSCs אינטגרציה נטולת מתאי דם היקפיים mononuclear (MNCs PB). הווקטורים episomal בהם נעשה שימוש הם פלסמידים DNA משולב עם אלמנטים oriP ו EBNA1 מן נגיף אפשטיין-באר (EB), המאפשרים retainment לטווח ארוך שכפול של פלסמידים בתאי יונקים, בהתאמה. עם אופטימיזציה נוספת, אלף מושבות iPSC ניתן להשיג 1 מיליליטר של דם היקפי. שני גורמים קריטיים להשגת יעילות תכנות מחדש גבוה הם: 1) השימוש של 2A "עצמי מחשוף" פפטיד לקשר Oct4 ו Sox2, ובכך להשיג ביטוי equimolar של שני הגורמים; 2) שימוש שני וקטורים להביע MYC ו KLF4 בנפרד. כאן אנו מתארים צעד-אחר-צעד פרוטוקול להפקת ה- IP אינטגרציה נטולתגיל מדגים דם היקפי מבוגר. IPSCs שנוצר הם אינטגרציה נטולת כמו פלסמידים episomal שיורית הם לגילוי לאחר חמישה קטעים. למרות היעילות תכנות מחדש דומה לזו של וירוס סנדאי (SV) וקטורים, פלסמידים EV הם הרבה יותר חסכוני מאשר וקטורים SV זמינים מסחרית. מערכת תכנות מחדש EV סביר זה טומן בחובו פוטנציאל ליישומים קליניים ברפואה רגנרטיבית ומספקת גישה עבור תכנות מחדש הישיר של MNCs PB לתאי גזע mesenchymal ללא אינטגרציה, תאי גזע עצביים, וכו.

Introduction

לאחר ביטוי בכפייה של גורמי שעתוק כמה (כלומר Oct4, Sox2, MYC ו KLF4), תאים סומטיים ניתן לתכנות מחדש לתאי גזע מושרים (iPSCs), המחזיקות הבטחה גדולה עבור יישומים ברפואה רגנרטיבית והחלפת התא טיפול 1-3. נכון להיום, שיטות מגוונות פותחו כדי להגדיל את שיעור ההצלחה של תכנות מחדש 4-7. וקטורים המושרים ויראלי תכנות מחדש נעשה שימוש נרחב עבור דור יעיל של iPSCs, כי שילוב ויראלי מוביל ברמה גבוהה, ביטוי היציב של גורמי תכנות מחדש. עם זאת, שילוב קבוע של ה- DNA וקטור לתוך הגנום התא עלול לגרום mutagenesis insertional 5. בנוסף, איון מספיק גורמי תכנות מחדש עלול להפריע iPSCs בידול 8. ככזה, השימוש iPSCs ללא שילוב של גורמי תכנות מחדש הוא הכרחי, במיוחד לשימוש ביישומי טיפול בתא.

> Episomal וקטורים (EVS) נמצאים בשימוש נרחב דור iPSCs אינטגרציה נטולת. הערך הגלום הנפוץ ביותר הוא פלסמיד המכיל שני אלמנטים, מקורו של שכפול נגיפי (oriP) ו EB גרעיני Antigen 1 (EBNA1), מן אפשטיין-באר (EB) וירוס 9. מרכיב oriP מקדם שכפול פלסמיד בתאי יונקים, בעוד אלמנט EBNA1 רצועות ה- DNA פלסמיד המכיל oriP ל- DNA כרומוזומלי המאפשר החלוק של episome במהלך חלוקת התא המארח. לשם השוואה לגישות אינטגרציה נטולת אחרים, כולל וירוס סנדאי (SV) ו transfection RNA, EVS להחזיק 5,6,10 יתרונות מרובים. כמו DNA פלסמיד, EVS ניתן לייצר בקלות שונה בבית, מה שהופך אותם מאוד יקרים. בנוסף, תכנות מחדש עם EV הוא תהליך שדורש פחות מאז transfection יחיד עם מכוניות חשמליות מספיק עבור דור iPSC, ואילו transfections RNA כמה נחוץ תכנות מחדש מוצלח.

Dפיברובלסטים ermal שימשו במחקרים תכנות מחדש רבים. עם זאת, ביופסיה של העור הוא לא רק תהליך פולשני וכואב, אלא גם זמן רב להרחבת תאים בכמות מספקת לתכנות מחדש. דאגה גדולה יותר, תאי עור של תורמים מבוגרים לעתים קרובות נחשפו לקרינת אור UV לטווח ארוכה, דבר שעלול להוביל מוטציות הקשורות גידולים, ובכך להגביל את בקשות iPSCs נגזר fibroblasts עור 11,12. לאחרונה, זה כבר דווח כי תאי עור אדם נורמלים לצבור מוטציות סומטיות וגני סרטן מרובים, כוללים רוב נהגי המפתח של קרצינומה של תאי קשקש עורית, נמצא תחת סלקציה החיובית חזקה 13.

בניגוד פיברובלסטים עור, דם היקפי (PB) תאים הם מקור עדיף של תאים לתכנות מחדש כי 1) תאי דם ניתן להשיג בקלות באמצעות תהליך פולשנית, 2) תאי דם היקפיים הם הצאצאים של תאי גזע hematopoieticהמתגורר מח עצם, ולפיכך הוא מוגן מפני קרינה מזיקה. תאי דם היקפיים mononuclear (MNCs PB) ניתן לאסוף תוך שעה מהשכבה מעיל באפי בעקבות צנטריפוגה שיפוע פשוטה באמצעות Ficoll-Hypaque (1.077 גרם / מ"ל). MNCs PB השיג מורכבים של לימפוציטים, מונוציטים וכמה ובתאים Hematopoietic (HPCs) 14. למרות לימפוציטים מסוג T האדם הם אחד מסוגי התאים העיקריים ב PB, בוגרת תאי T המכילים rearrangements של הקולטן של תאי T (TCR) גנים חסרים גנום שלם ובכך להגביל את הפוטנציאל שלהם ליישומים 15,16. עם זאת, התחדשות של תאי T באמצעות הדור iPSC ייתכן יישומים פוטנציאליים Chimeric Antigen קולטן (CAR) T-cell טיפול 17-19. לשם השוואה, יש HPCs גנום שלם הם reprogrammable בקלות. למרות רק 0.01 - 0.1 תאים% במחזור הפריפריה הם HPCs, תאים אלה ניתן להרחיב vivo לשעבר במדיום erythroid שדוגלת ריבוי erythrובתאי OID 14.

במחקר הקודם שלנו, השתמשנו גורם BCL-XL בנוסף הגורמים יאמאנאקה (Oct4, Sox2, MYC ו KLF4), אשר הביאה לעלייה 10x ב ויעילות תכנות מחדש PB 20. BCL-XL, הידוע גם בשם BCL2L1, הוא מעכב חזק של מוות של תאים, על ידי עיכוב ההפעלה של caspases 21,22. אבל, BCL-XL יכול גם לשחק תפקיד חשוב בשמירה על pluripotency 21,22. לאחרונה, יש לנו אופטימיזציה נוספת מערכת תכנות מחדש EV שלנו על ידי בנפרד להביע MYC ו KLF4 עם שני וקטורים, מה שמוביל לעלייה כ 100x יעיל תכנות מחדש 23. באמצעות שיטה זו, את יעילות תכנות מחדש, המוגדר על ידי מספר מושבה המחולק החל מספר תא transfection, היא 0.2 - 0.5% מתורמים בריאים. כדלקמן, אנו מתארים את הליך הניסוי המפורט ליצירת iPSCs ללא אינטגרציה מן PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל הדגימות האנושיות PB התקבלו מתורמי מבוגרים אנונימי ללא פרטי זיהוי זמינים Tianjin דם מרכז באישור ועדת אתיקת מחקר המקומית.

1. אנדו ללא הכנה פלסמיד

  1. השתמש ערכה מסחרית פלסמיד טיהור מקסי לחלץ וקטורי episomal מ חיידק על פי הפרוטוקול של היצרן. עבור השלב הסופי, חיץ TE תחליף עם מים סטריליים ללא רעלן פנימי לפזר את גלולת DNA.
  2. מדוד ריכוז ה- DNA באמצעות ספקטרופוטומטר מסחרי UV / Vis. הריכוז הוא בדרך כלל גדול יותר 1 מיקרוגרם / μL, עם A260 / A280 ויחסי A260 / A230 גדול מ 1.8 ו -2.0, בהתאמה.

2. מדיה ותרבות

  1. הכן בינוני erythroid: בינוני הרחבת תא גזע Hematopoietic בתוספת 100 ng / פקטור תאי גזע אנושיים מ"ל (SCF), 10 ng / mL Interleukin-3 (IL3), 2 U / mL אריתרופויטין (EPO), 20 ng / Factor-1 אינסולין צמיחה מ"ל (IGF1), 1 מיקרומטר dexamethasone ו- 0.2 מ"מ 1-thioglycerol. סנן לעקר עם מסנן מזרק 0.22 מיקרומטר. בינוני erythroid יכול להיות מאוחסן על 4 מעלות צלזיוס למשך עד חודש.
  2. הכן בינוני iPSC: DMEM / בינוני F12 (בינוני הנשר שונה של Dulbecco / מזין תערובת F-12) בתוספת גלוטמין L-1x, 1x פניצילין / סטרפטומיצין, פתרון חומצות אמינו 1x שאינם חיוניים, 50 ng / mL פיברובלסטים צמיחה 2 Factor (FGF2 ), תוספת אינסולין-transferrin-סלניט 1x () ITS, וחומצה אסקורבית 50 מ"ג / מ"ל. סנן לעקר עם מסנן מזרק 0.22 מיקרומטר. בינוני iPSC יכול להיות מאוחסן על 4 מעלות צלזיוס למשך עד חודש.
  3. כן בינוני MEF: בינוני הנשר השונה של Dulbecco (DMEM; גלוקוז גבוהה) השלים עם פניצילין 1x / סטרפטומיצין ו -10% עובריים שור סרום (FBS). סנן לעקר עם מסנן מזרק 0.22 מיקרומטר. בינוני MEF יכול להיות מאוחסן על 4 מעלות צלזיוס למשך עד חודש או טרי להוסיף לפני השימוש L- גלוטמין 1x.
  4. Pבינוני cryopreservation repare iPSC (2x): ממיסים 5 גרם של D-trehalose ב 30 מ"ל של מים סטריליים באמבט מים 37 מעלות צלזיוס. להביא את הטמפרטורה עד 4 ° C ולאחר מכן להוסיף 10 מ"ל של FBS ו 10 מ"ל של dimethylsulfoxide (DMSO). סנן לעקר עם מסנן מזרק 0.22 מיקרומטר. חנות ב 4 מעלות צלזיוס למשך עד 3 חודשים 24.

3. בידוד של תאי הדם ההיקפי mononuclear (MNCs PB)

  1. שלב 10 מדגם PB טרי מ"ל ו -10 מ"ל חיץ PBS לתוך צינור 50 מ"ל ומערבבים היטב. תביאו PBS על RT או 37 ° C לפני השימוש.
    הערה: כ 1 - 3 x 10 6 MNCs (טריים או cryopreserved) ניתן להשיג 1 מ"ל של PB. לאחר 6 ד תרבות, מצפה לקבל 0.5 - 1 x 10 6 תאים בסך הכל בשל מוות של תאים בוגרים במהלך התרבות. כ 1 x 10 7 תאים ניתן להשיג 10 מיליליטר של PB הטרי.
  2. הוסף 10 מ"ל Ficoll אל החלק התחתון של הצינור באמצעות מזרק 10 מ"ל מצורף מחט ארוכה. פרו זהסס צריך להיעשות לאט כדי להבטיח כי שכבת Ficoll אינו מתערבב עם PB.
  3. צנטריפוגה ב 400 XG במשך 30 דקות בקצב האצה האטה נמוכה. לאחר צנטריפוגה, MNCs PB הנמצאים בשכבה לבנה (מעיל באפי) ממוקם בין פלזמה PB ואת Ficoll.
  4. לאט לשאוב ~ 10 פלזמה מ"ל PB מבלי להפריע את שכבת מעיל באפי. בזהירות מסיק את השכבה הלבנה באמצעות קצה פיפטה 1 מ"ל לצינור 50 מ"ל חדש. ההיקף הכולל של תאים שנאספו מההשכבה הלבנה יהיה בין 3 - 6 מיליליטר.
  5. להוסיף PBS להביא את הנפח הכולל עד 30 מ"ל ומערבבים היטב עם טפטפת 10 מ"ל. צנטריפוגה ב 400 XG במשך 10 דקות.
  6. הסר את תא גלולה supernatant ו resuspend במדיום תרבות 20 מ"ל (בינוני של Dulbecco Modified של קרי Iscove, IMDM) ומערבבים היטב. צנטריפוגה ב 400 XG במשך 10 דקות כדי להסיר את הרוב של טסיות.
  7. הסר את supernatant ו resuspend התא גלולה ב 1 - 2 מ"ל IMDM. תאים עשויים לשמש fאו תרבות מיידית, או למטה קפוא לשימוש מאוחר יותר. עבור cryopreservation, להוסיף כמות שווה של המדיום cryopreservation. תאים Aliquot ב cryovials (0.5 - 1 מ"ל לכל בקבוקון) והעברת cryovials כדי מקפיא -80 מעלות צלזיוס מיד. MNCs PB ניתן לאחסן במקפיא -80 מעלות צלזיוס במשך כמה שבועות או יועבר מיכל חנקן נוזלי עבור אחסון לטווח ארוך.
    הערה: כאשר להפשרת תאים קפואים, אם כי בינוני cryopreservation שלנו עלול להיגרם כדאיות התא, את מספר הסלולרי עשוי לקטון בשל מוות של תאים במהלך תהליך ההפשרה. מומלץ 1 - 10 x 10 7 תאים יוקפאו בכל בקבוקון.

4. הרחבת MNCs PB ב erythroid בינוני

  1. הכן 5 בינוני מ"ל IMDM בתוך שפופרת 15 מ"ל. במהירות להפשיר את MNCs PB קפוא בתוך אמבט מים 37 מעלות צלזיוס ולאחר מכן להעביר אותם אל הרכבת התחתית עם המדיום IMDM.
    הערה: משך הזמן באמבט מים תלוי בנפח של תאים cryopreserved ואת u cryovialSED. בדרך כלל, התא הקפוא יפשיר בתוך דקות 1.
  2. צנטריפוגה ב 400 XG עבור 5 - 10 דקות. הסר את supernatant ו resuspend התא גלולה במדיום erythroid. הוסף 10 μL פתרון Trypan כחול עד 10 μL ההשעיה תא ומערבבים היטב. Trypan כחול מכתים תאים מתים בתוך 1 - 3 דקות. ספירת התאים תחת מיקרוסקופ באמצעות hemocytometer.
  3. MNCs תרבות PB בתרבות הלא רקמות (לא TC) שטופלו 6-גם צלחת עם 2 בינוני מ"ל לכל טוב, בצפיפות תא של ~ 5 x 10 6 תאים / מ"ל, ב 37 מעלות צלזיוס CO 5% 2 חממת humidified.
  4. הוסף 1 בינוני erythroid טרי מ"ל ישירות היטב כל מבלי לשנות את המדיום בבית D 3 ו -5.
  5. בשעה D 6, לקצור את MNCs PB עבור nucleofection.

5. PB MNC Nucleofection ו Reprogramming

  1. יום אחד לפני nucleofection, טרום מעיל TC שטופלו 6-גם צלחות עם ג'לטין 0.1% ב 37 מעלות צלזיוס למשך 20 דקות. פיברו מומת הפשרת Murine העובריהפיצוץ (MEF) תאים מזין בתוך אמבט מים 37 ° C ומיד ולהעבירם צינור 15 מ"ל המכיל 5 מ"ל של מדיום MEF.
  2. צנטריפוגה ב 400 XG במשך 5 דקות ולהסיר את supernatant. הסר את הג'לטין מהצלחת 6-היטב, resuspend התא גלולה במדיום MEF, ולהעבירם את הג'לטין מראש שטופלו 6-גם צלחת. בכל טוב, זרע 2 - 4 x 10 5 תאים MEF מומת המרחפים 2 בינוני מ"ל MEF.
  3. תרבות תאי מזין MEF על 37 מעלות צלזיוס חממת humidified 5% CO 2.
  4. ביום nucleofection, לשאוב את המדיום MEF ולהחליפו בינוני erythroid 1 מ"ל. טרום לאזן את צלחת התרבות במשך 10 - 30 דקות ב 37 מעלות צלזיוס חממת humidified 5% CO 2.
  5. הוסף 2 מיקרוגרם PEV-OCT4-2A-Sox2, 1 מיקרוגרם PEV-myc, 1 מיקרוגרם PEV-KLF4, ו -0.5 מיקרוגרם PEV-BCL-XL בתוך שפופרת Eppendorf 1.5 מ"ל סטרילי. מחממים את הצינור ב 50 מעלות צלזיוס למשך 5 דקות על מנת למנוע זיהום, להתקרר RT. לְהוֹסִיף57 μL Nucleofection חיץ 13 תוספת μL.
  6. קציר 2 x 10 6 MNCs PB תרבותי לצינור מ"ל 5 על ידי צנטריפוגה ב XG 200 עבור 7 דקות. הסר את supernatant ולהוסיף לתערובת חיץ פלסמיד nucleofection אל התא גלולה. מערבבים היטב על ידי מצליף את הצינור עם האצבע.
    הערה: נמוכה כמו 2 x 10 5 תאים עשויה לשמש nucleofection, אבל יעילות תכנות מחדש תחתונות צריכות להיות צפויות גם כן.
  7. מעביר את דנ"א השעית תא קובט המסופק בערכה וכובע קובט. בחר את תוכנית U-008 במכשיר nucleofection. הכנס את קובט לתוך מחזיק ולחץ על אישור כדי להחיל את תוכנית יו- 008.
  8. קח קובט מתוך המחזיק, להוסיף 0.5 - 1 מ"ל מחומם מראש בינוני erythroid בכל קובט, ותאי העברת לצלחת MEF מראש equilibrated מיד. בשל וריאציה היעילות התורם תכנות מחדש גבוהה, זריעת מספרים שונים של תאים הנעים בין 1-10 x 10 5 תאים pאה כן מומלץ מאוד.
  9. מעביר את צלחת תא היפוקסיה, ולשטוף את החדר עם גז מעורב המורכב 92% N 2, 5% CO 2 ו -3% O 2, 1 - 2 דקות בקצב של 20 ליטר / דקה. לאחר איטום החדר, התרבות תאים על 37 מעלות צלזיוס.
  10. ב D 2 שלאחר nucleofection, להוסיף 2 בינוני מ"ל iPSC ישירות היטב כל אחד.
  11. בשעה D 4 שלאחר nucleofection, להסיר 3 מ"ל של מדיום ולהוסיף 2 מ"ל בינוני iPSC טריים. בשעת D 4 שלאחר nucleofection, רוב תאי החיים יהיו מחובר שכבת המזין.
  12. אחרי D 6 שלאחר nucleofection, לשנות את המדיום כל 2 ד על ידי השארת 500 μL בילה בינוני והוספת 2 בינוני E8 טרי מ"ל בתוספת 0.25 מ"מ נתרן בוטיראט עד D 14 - 18.
    הערה: מזין תאים נוסף שיתווספו בארות ההתרבות בכל פעם ההתבוננות כי התאים המזינים שהופרדו. לאחר ההפשרה MEFs (ראה 5.1 ו -5.2), resuspend התא גלולה בנפח קטן של המדיום E8 (כלומר ~ 0.2 מיליליטר עבור אחד טוב של צלחת 6-היטב) ולאחר מכן להוסיף MEFs לתוך בארות התרבות. כ 2% FBS ניתן להוסיף כדי להגדיל מצורף התא. לחלופין, מדיום ממוזג MEF יכול לשמש גם, אבל זה יותר מייגע.

6. הרחבת iPSCs

הערה: ברוב המקרים, מספר רב של מושבות iPSC להופיע D 8 - 10 פוסט nucleofection. אחרי D 14, מושבות iPSC גדולות הן בדרך כלל מוכנות לקטיף.

  1. לפני לקטוף מושבות, להוסיף 500 בינוני μL E8 השלימו עם מעכב רוק, Y27632 (10 מיקרומטר), ב אחד טוב של מזין או Matrigel מצופה צלחת 24 גם. השתמש פיפטה μL 10 או 20 ושורטים לבחור מושבות תחת מיקרוסקופ. מעביר את החתיכות של כל מושבה כדי הבארות המכילות את מדיום התרבות.
    הערה: ריכוז Matrigel נבדל אצווה אחת לאחרת. בדרך כלל, אנו משתמשים 1: 100 דילול של Matrigel.
    1. על מנת למנוע מגע בין שני, להריםמושבות כי הם גדולים ומופרדים היטב מאחרים. IPSCs תרבות על 37 מעלות צלזיוס חממה humidified 5% CO 2.
      הערה: זה צריך להיות לציין כי אוכלוסיית iPSC עשויה להיות polyclonal בשל נדידת תאים כאשר יש עשרות או מאות מושבות בכל טוב של צלחת 6 באר.
  2. אל תשנה בינוני עבור ד 2 הראשון. מעכב ROCK יכול לקדם הישרדות של מושבות קטנות 25.
  3. מ D 2 ואילך, לשנות בינוני כל יום על ידי הסרה בינונית בילה והוספת בינוני E8 טרי 500 μL בכל טוב.
  4. כ 1 שבוע לאחר מכן, כאשר המושבות הם גדולים מספיק, להסיר את המדיום ולטפל את התאים עם 300 פתרון ניתוק התא μL (0.5 מ"מ EDTA ב PBS) בשעה 37 מעלות צלזיוס במשך 1 - 3 דקות. הסר את הפתרון ניתוק התא ולהוסיף בינוני E8 המכילים מעכבי ROCK (10 מיקרומטר) להשעות iPSCs. אין לשבור מושבות לתוך תאים בודדים, דבר שעלול להוביל למות תאים מופרז. גושי התא עם 5 - 50 תאיםהים מתאים למעבר iPSC.
  5. העברת 50 - 100% של השעיה התא היטב כל צלחת 12 או 6 היטב כי כבר precoated עם מתקני האכלה או Matrigel.
  6. לתרבות לטווח ארוך צלחות מצופות Matrigel (ראה הערה 6.1), לשנות את המדיום מדי יום. כאשר התא confluency מגיע 40 - 60%, לטיפול בתאים עם 1 פתרון ניתוק התא מ"ל (0.5 mM EDTA ב PBS) בשעה 37 מעלות צלזיוס במשך ~ 3 דקות. כאשר המושבות להתחיל להתכרבל, להסיר את הפתרון ניתוק התא ולהוסיף המכילים מעכבי ROCK בינוני E8 (10 מיקרומטר) להשעות את iPSCs. תאי מעבר עם גורם קריעה 4 - 8. מעכב ROCK יש להוסיף כאשר passaging תאים להגדיל הישרדות, ומוציאים 1 ד מאוחר יותר כדי למנוע בידול.
  7. כדי להקפיא למטה iPSCs, לטפל בתאים עם פתרון ניתוק התא ב 37 מעלות צלזיוס במשך 3 - 5 דקות על פי פרוטוקול של היצרן. כאשר המושבות iPSC להתחיל להתכרבל, לשאוב את המאגר ואת להוסיף 0.5 - 1 בגווני מ"ל E8.
  8. <li> הוסף נפח שווה של המדיום cryopreservation על השעיית התא ומערבבים היטב. קפואים iPSCs ניתן לאחסן במקפיא -80 מעלות צלזיוס במשך כמה שבועות או בחנקן נוזלי עבור אחסון לטווח ארוך.

בחירה 7. iPSCs ללא שיורית Episomal פלסמידים

  1. לאחר המעבר 5, iPSCs הקציר ולחלץ הדנ"א הגנומי.
    הערה: בדרך כלל לאחר 5 קטעים של תרבות, פלסמידים episomal שיורית הם לגילוי. לכן, כמעט כל המושבות iPSC ב מעברים מעל 5 (כלומר מעבר 10) חסרים פלסמידים episomal שיורית.
  2. השתמש הדנ"א הגנומי של MNCs untransfected PB כביקורת שלילית. הוסף פלסמיד 1.6 pg PEV-OCT4-2A-Sox2 לתוך ה- DNA בקרה שלילית 1 מיקרוגרם לחקות תאים עם עותק אחד של פלסמיד PEV לכל תא.
  3. הוסף 9 מים μL PCR כיתה כולל 100 הדנ"א הגנומי ng ו 1 μL פריימרים ספציפיים (10 מיקרומטר אחד של קדימה לאחור פריימרים) לתוך 10 μL באיכות גבוהה PCR מיקס מאסטר. לנרמל את amount של ה- DNA על ידי GAPDH. השתמש פריימרים הבאים עבור PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, צפון אמריקנית בהמשך הקטע-F GGTTTAAACGCGTCGACAAT, צפון אמריקנית בהמשך הקטע-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. דגירת תערובת התגובה על 98 מעלות צלזיוס למשך 60 שניות; ואחריו 98 מעלות צלזיוס למשך 10 שניות, 60 ° C למשך 30 שניות, ו -72 מעלות צלזיוס למשך 30 שניות. אחרי 30 מחזורים; להאריך את התגובה על 72 מעלות צלזיוס למשך 5 דקות.
  5. טען 5 מוצרים μL PCR בכל טוב של ג'ל agarose 1%. הפעל את ג'ל למשך 20 - 30 דקות ב 100 V. בחר שיבוטים iPSC עם להקות לגילוי עבור EBNA1 ואת צפון אמריקנית בהמשך הקטע לתרבות נוספת וניתוח במורד הזרם.

8. cytometry זרימה

  1. קציר iPSCs תוך התייחסות אליהם עם Accutase ב 37 מעלות צלזיוס במשך 3 - 5 דקות כדי לקבל השעיה תא בודד. הוסף 1 μL PE מצומדות אנטי-TRA-1-60 או 570 מצומדות eFluor אנטי SSEA4 או נוגדן Isotypic 100 μL של ההשעיה תא (1 - 5 x 10 5 תאים) צינורות 5 מ"ל. דגירת הצינורות במיקום בחושך ב RT במשך 20 דקות.
  2. לאחר מכתים עבור 20 דקות ב RT, להוסיף 2 מ"ל PBS ו צנטריפוגות ב 400 XG במשך 5 דקות. תאי Resuspend ב 300 μL PBS עבור מיון תא קרינה מופעלת (FACS) ניתוח באמצעות cytometry זרימת מנתח תא. 23,26

9. הדמיה Confocal

  1. iPSCs זרע שקופיות קאמרית מצופה Matrigel.
  2. אחרי 3 - 4 ד התרבות, הסר את מדיום הגידול ולתקן עם paraformaldehyde 4% (PFA) ב RT במשך 30 דקות. שטוף תאים פעמים עם PBS.
    הערה: PFA הוא רעיל ומזיק.
  3. פנקו את התאים עם 0.1% Triton X-100 ב PBS (PBS-T) ב RT במשך 30 דקות. שוטפים את התאים פעמיים עם PBS.
  4. חסום את התאים עם חיץ חסימה (סרום עיזים 5% ב PBS, V: V) ב RT במשך שעה 1.
  5. במהלך השלב חסימה, לדלל את הנוגדן הראשוני (100x) בחסימת המאגר.
    הערה: מידע הנוגדנים מופיע בטבלת החומרים / ציוד.
  6. דגירה תאים עם נוגדן מדולל ב 4 ° CO / N.
  7. פעמים לשטוף עם PBS-T במשך 15 דקות, ואחריו פעמים עם PBS במשך 15 דקות.
  8. דגירה תאים עם נוגדנים משני fluorophore מצומדות בדילול ב RT עבור 2 שעות.
  9. פעמים לשטוף את התאים עם PBS-T במשך 15 דקות, ואחריו פעמים עם PBS במשך 15 דקות.
  10. הכתם הגרעין עם DAPI (1 מיקרוגרם / מ"ל) ב PBS ב RT במשך 10 דקות.
  11. שטוף תאים פעמים עם PBS במשך 15 דקות.
  12. צלמו תמונות עם מיקרוסקופ confocal. 23,27

10. teratoma Assay

קציר 1 x 10 6 iPSCs עם פתרון ניתוק התא (0.5 mM EDTA ב PBS) ותאי resuspend ב 200 μL DMEM / F12 מדולל (1: 1) Matrigel.

  1. תת עורי להזריק תאים לתוך החלקה האחורית האחורית של עכברי immunodeficient NOD / SCID.
  2. בשעה 8 - 12 בשבוע לאחר ההזרקה iPSC, לנתח ולתקן teratomas בפורמלין 10%. 28
  3. לאחר microsectioning וצביעה עם hematoxylin ו eosin (H & E), ולנתח דגימות. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

שימוש בפרוטוקול זה, אנו יכולים להשיג מאות מושבות מ 1 x 10 5 nucleofected MNCs PB (איורים 1 א ו -1 B). יעילות תכנות מחדש היא כ 0.2 - 0.5% ואת המושבות להביע סמני pluripotency (1C הדמוי ו 1D). iPSCs שנוצר באמצעות פרוטוקול המתוארים הם ללא אינטגרציה ויש להם את היכולת ליצור teratoma להלחין את (1E דמויות 1F) 3 שכבות הנבט.

איור 1
איור 1: דור של iPSCs אינטגרציה נטולה מתאי הדם ההיקפי mononuclear. (א): סכמטי של פרוטוקול תכנות מחדש תאי דם היקפיים. (ב): מכתים AP בתפזורת (משמאל) מול מושבת iPSC טיפוסית ESC דמוי (מימין)60; 14 ד לאחר nucleofection MNCs PB. סרגל קנה מידה: 100 מיקרומטר. (C): דיאגרמות נציג FACS של iPSCs ב מעבר 5 להביע TRA-1-60 או SSEA4. (ד): תמונות confocal נציג של מושבות iPSC להביע NANOG ו Oct4. סרגל קנה מידה: 100 מיקרומטר. (ה): התמונה נציג של התמונה הכוללת ו- H & E מכתים של teratoma הכולל את כל שלוש שכבות הנבט. סרגל קנה מידה: 100 מיקרומטר. (F): העתק מספרים של פלסמידים EV השיורי iPSCs לאחר חמישה קטעים. פריימרים ספציפיים EBNA1 ואת הצפון אמריקאי בהמשך הקטע שמשו כדי להגביר וקטורי episomal. GAPDH שימש כביקורת הטעינה DNA. א.ד., כמעט בלתי מורגש. השביל החיובי מצביע על שליטה עבור עותק יחיד. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

רכישת דגימות דם מתורמים או מטופלים בריאים נוחה ולא פולשנית, מה שהופך אותו מקור תא אטרקטיבי למחקר בסיסי טיפול בתאים קליני. כאן יש לנו תיאר פרוטוקול עבור הדור היעילה ביותר של iPSCs אינטגרציה נטולת מדגימות דם היקפיים. גישה לשחזור ובמחיר סביר זה אמור להועיל בתחום iPSC.

דיווחנו כי ישנם שני גורמים קריטיים אחראים תכנות מחדש PB היעיל ביותר 30. אחת מהן היא ביטוי equimolar של Oct4 ו Sox2 באמצעות מקשר 2A 31. כדי להשיג זאת, PEV-OCT4-2A-Sox2 משמש בפרוטוקול זה. השני הוא השימוש בשני פלסמידים PEV-myc ו PEV-KLF4 להביע MYC ו KLF4 במקום PEV-myc-2A-KLF4 שאנחנו השתמשנו בעבר 30. השינוי הפשוט לכאורה מוביל לעלייה כ 100X ניצולת תכנות מחדש PB, אשר נובעת במידה רבה לעלייה הדרגתית יותר של MYC: KLיחס F4 במהלך התהליך.

יש לשקול כמה נקודות להשגת דור iPSC-יעילות גבוהה מ PB. MNCs PB מתורבת עבור ~ 1 שבוע במדיום erythroid, מקדמת התפשטות והתרחבות של ובתאים erythroid ובכך מגביר את יעילות תכנות מחדש 20. עם זאת, עבור כמה דוגמאות, במיוחד עבור תאי דם מחולים בלוקמיה, תאים לשרוד גרוע כאשר בתרבית בינוני erythroid. במקרה זה, יהיה זה מועיל כדי להקטין זמן culturing. זה מעודד גם להשתמש 1 - 2 מיקרוגרם וקטור pmaxGFP כדי לאמת את יעילות nucleofection, אשר צריך להיות גדול מ -50%. בנוסף, איכות פלסמיד חשובה. מומלץ להשתמש פלסמידים ללא זיהום רעלן פנימי (כלומר באמצעות Endo-חינם ערכת פלסמיד מקסי לחלץ פלסמידים). איכות פלסמיד עניה יכולה לגרום למות תא משמעותי ובכך להקטין את יעילות תכנות מחדש. אנחנו ואחרים הראו promot היפוקסיה כיes iPSC הדור 14,32. אנחנו לשטוף את התא היפוקסיה עם גז מעורב מורכב 92% N 2, 5% CO 2 ו -3% O 2. אם normoxia משמש במקום זאת, עד 80% הפחתה יעיל תכנות מחדש אפשר לראות. לאחר תכנות מחדש יושלם, iPSCs עלול להיות מתורבת 2 באינקובטור קבוע humidified 5% CO. בעת שינוי המדיום, הוא שימושי להשאיר כמות קטנה של המדיום בילה (כלומר 500 μL לכל היטב צלחת 6-היטב), ולאחר מכן להוסיף בינוני טרי. שנה בינונית רק פעם ביומיים במהלך תכנות מחדש, כמו שינוי בינוני תכופים מדי עשוי להפחית iPSCs דור 33.

הפרוטוקול החדש פתחנו השיג תכנות מחדש PB ברמה גבוהה כי ניתן להשוות את מערכת תכנות מחדש SV. מערכת EV יש כמה יתרונות ברורים. קודם כל, EV הוא יותר זול מאשר SV. מערכת EV יכולה גם להיות שונה על ידי הוספת גורמים נוספים או הקומבינה שונהמשא של גורמים מרובים, ואילו וקטורי SVS הוא מוצר מסחרי שלא ניתן לשנות על ידי חוקרים. הפרוטוקול הנוכחי שלנו כולל שימוש בתאי מזין MEF ומוצרים שמקורם מן החי, אשר עלול להגביל את היישומים הקליניים, אך ניתן להסירו בקלות על ידי פיתוח פרוטוקול נוסף 34,35.

iPSCs שנוצר עם מערכת זו יכולה לשמש לא רק עבור מודלים מחלות ההקרנה סמים, אלא גם עבור טיפול קליני, כי פלסמידים EV GMP ברמה יכול להיווצר בקלות וללא iPSCs עם שילוב EV ניכר זוהה. ביישומים קליניים, תאי חולה בדרך כלל נמל גן וישכנע מחלה, אשר צריך להיות מתוקנים ב iPSCs לפני הבידול לתאים פונקציונליים לטיפול. לאחרונה דווח הראה שמערכת תכנות מחדש EV ניתן לשלב בקלות עם מערכת CRISPR / Cas9 להשיג תכנות מחדש סימולטני ועריכה הגנום לאחר nucleofection פשוט 36. זהיתרון nother של EV על מערכת SV. נתונים שלא פורסמו שלנו הראו כי עד יעילות עריכת הגנום 20% יכולה להיות מושגת כאשר piggybacking עריכת הגנום על תכנות מחדש EV. תקוותנו היא כי שילוב של תכנות מחדש PB עם הפריך / Cas9R הגנום עריכה ייתכן יישומים פוטנציאליים בטיפול במחלות רבות כי הן חשוכות מרפאות אחרות בעשורים הקרובים.

לסיכום, פרוטוקול תכנות מחדש של תאי דם ההיקפי המשופר שלנו צריך להיות שימושי עבור ספקטרום רחב של חוקרים במחקר בסיסי ויישומים קליניים. מערכת תכנות מחדש EV יעיל זה יכול גם להיות מועסק, לאחר שינויים, כדי ליצור תאי גזע mesenchymal אינטגרציה נטולת (MSCs) 37, או בתאי גזע עצביים (NSCs) 38, ישירות מתאי דם היקפיים מבוגר ללא עבר שלב iPSC.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
דור של תאי גזע מושרים אינטגרציה נטולה מן אדם הדם ההיקפי mononuclear תאי שימוש וקטורי Episomal
Play Video
PDF DOI

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter