Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

मानव परिधीय रक्त कोशिकाओं mononuclear से एकता मुक्त प्रेरित pluripotent स्टेम कोशिकाओं की पीढ़ी episomal वैक्टर का उपयोग

doi: 10.3791/55091 Published: January 1, 2017

Abstract

प्रेरित pluripotent स्टेम सेल (IPSCs) रोग मॉडलिंग और पुनर्योजी उपचार के लिए महान वादा पकड़। हम पहले episomal वैक्टर (ईवी) के उपयोग परिधीय रक्त कोशिकाओं mononuclear (पीबी एमएनसी) से एकीकरण से मुक्त IPSCs उत्पन्न करने की सूचना दी। Episomal इस्तेमाल किया वैक्टर डीएनए एपस्टीन बर्र (ईबी) वायरस से oriP और EBNA1 तत्व है, जो क्रमश: स्तनधारी कोशिकाओं में plasmids की प्रतिकृति है और लंबी अवधि के लिए retainment अनुमति देते हैं, के साथ शामिल plasmids हैं। आगे अनुकूलन के साथ, IPSC कालोनियों के हजारों परिधीय रक्त के 1 एमएल से प्राप्त किया जा सकता है। उच्च reprogramming क्षमता प्राप्त करने के लिए दो महत्वपूर्ण कारक हैं: 1) एक 2A का उपयोग "आत्म दरार" पेप्टाइड OCT4 और Sox2 से जोड़ने के लिए, इस प्रकार दो कारकों की equimolar अभिव्यक्ति को प्राप्त; 2) दो वैक्टर का उपयोग MYC और KLF4 व्यक्तिगत रूप से व्यक्त करते हैं। यहाँ हम एकीकरण-मुक्त IP पैदा करने के लिए एक कदम दर कदम प्रोटोकॉल का वर्णनवयस्क परिधीय रक्त के नमूनों से अनुसूचित जाति। के रूप में अवशिष्ट episomal plasmids पांच मार्ग के बाद undetectable हैं उत्पन्न IPSCs एकीकरण से मुक्त हैं। हालांकि reprogramming दक्षता सेंडाइ वायरस (एसवी) वैक्टर के बराबर है, ईवी plasmids काफी व्यावसायिक रूप से उपलब्ध एसवी वैक्टर की तुलना में अधिक किफायती हैं। यह सस्ती ईवी reprogramming प्रणाली पुनर्योजी चिकित्सा में नैदानिक अनुप्रयोगों के लिए क्षमता रखती है और एकीकरण से मुक्त mesenchymal स्टेम कोशिकाओं, तंत्रिका स्टेम कोशिकाओं, आदि के लिए पंजाब बहुराष्ट्रीय कंपनियों के प्रत्यक्ष reprogramming के लिए एक दृष्टिकोण प्रदान करता है।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

कई प्रतिलेखन कारक के लिए मजबूर करने के बाद अभिव्यक्ति (यानी OCT4, Sox2, MYC और KLF4), दैहिक कोशिकाओं प्रेरित pluripotent स्टेम सेल (IPSCs), जो पुनर्योजी चिकित्सा और सेल रिप्लेसमेंट थेरेपी 1-3 में अनुप्रयोगों के लिए महान वादा धारण करने के लिए reprogrammed किया जा सकता है। तिथि करने के लिए, विविध तरीकों 4-7 reprogramming की सफलता की दर बढ़ाने के लिए विकसित किया गया है। वायरल वैक्टर प्रेरित reprogramming व्यापक रूप से IPSCs के कुशल उत्पादन के लिए प्रयोग किया जाता है क्योंकि वायरल एकीकरण के लिए एक उच्च स्तरीय, reprogramming कारकों के स्थिर अभिव्यक्ति की ओर जाता है। हालांकि, सेल जीनोम में वेक्टर डीएनए की स्थायी एकीकरण इन्सर्शनल म्युटाजेनेसिस 5 उत्पन्न हो सकता है। इसके अलावा, reprogramming कारकों की अपर्याप्त निष्क्रियता IPSCs भेदभाव 8 को परेशान कर सकता है। जैसे, reprogramming कारकों के एकीकरण के बिना IPSCs का उपयोग विशेष रूप से सेल थेरेपी अनुप्रयोगों में प्रयोग के लिए आवश्यक है।

9 से युक्त एक प्लाज्मिड है। जबकि EBNA1 तत्व गुणसूत्र डीएनए कि मेजबान सेल के विभाजन के दौरान episome के विभाजन के लिए अनुमति देता है oriP युक्त प्लास्मिड डीएनए tethers oriP तत्व, स्तनधारी कोशिकाओं में प्लाज्मिड प्रतिकृति को बढ़ावा देता है। सेंडाइ वायरस (एसवी) और आरएनए अभिकर्मक सहित अन्य एकीकरण से मुक्त दृष्टिकोण, की तुलना में, ईवीएस कई फायदे 5,6,10 के पास है। प्लास्मिड डीएनए के रूप में, ईवीएस आसानी से उत्पादन किया जा सकता है और घर में संशोधित, उन्हें बेहद किफायती बनाने। इसके अलावा, ईवी साथ reprogramming एक कम श्रम गहन प्रक्रिया के बाद से ईवीएस के साथ एक एकल अभिकर्मक IPSC पीढ़ी के लिए पर्याप्त है, जबकि कई आरएनए transfections सफल reprogramming के लिए आवश्यक हैं।

डीermal fibroblasts कई reprogramming अध्ययन में इस्तेमाल किया गया है। हालांकि, त्वचा बायोप्सी न केवल एक आक्रामक और दर्दनाक प्रक्रिया है, लेकिन reprogramming के लिए पर्याप्त मात्रा में कोशिकाओं के विस्तार के लिए भी समय लेने वाली है। अधिक चिंता का विषय, वयस्क दाताओं की त्वचा कोशिकाओं को अक्सर लंबे समय तक पराबैंगनी प्रकाश विकिरण, जो ट्यूमर के साथ जुड़े इस प्रकार की त्वचा fibroblasts 11,12 से निकाली गई IPSCs के लिए आवेदन पत्र सीमित म्यूटेशन को जन्म दे सकती को उजागर किया गया है। हाल ही में, यह बताया गया है कि सामान्य मानव त्वचा कोशिकाओं दैहिक म्यूटेशन और त्वचीय स्क्वैमस सेल कार्सिनोमा के प्रमुख ड्राइवर के सबसे सहित कई कैंसर जीन, संचित, मजबूत सकारात्मक चयन 13 के तहत कर रहे हैं।

त्वचा fibroblasts के विपरीत, परिधीय रक्त (पंजाब) कोशिकाओं reprogramming के लिए कोशिकाओं का एक बेहतर स्रोत है क्योंकि 1) रक्त कोशिकाओं को आसानी से एक न्यूनतम इनवेसिव प्रक्रिया के माध्यम से प्राप्त की जा सकती हैं, 2) परिधीय रक्त कोशिकाओं hematopoietic स्टेम कोशिकाओं की संतान हैंअस्थि मज्जा में रहने वाले, इस प्रकार हानिकारक विकिरण से रक्षा की। परिधीय रक्त कोशिकाओं mononuclear (पीबी एमएनसी) Ficoll-hypaque (1.077 g / एमएल) का उपयोग कर एक साधारण ढाल centrifugation निम्नलिखित बफी कोट परत से एक घंटे में एकत्र किया जा सकता है। प्राप्त पीबी बहुराष्ट्रीय कंपनियों लिम्फोसाइटों, monocytes और कुछ Hematopoietic पूर्वपुस्र्ष कोशिकाओं (HPCs) 14 से बना रहे हैं। हालांकि मानव टी lymphocytes, पंजाब में प्रमुख प्रकार की कोशिकाओं में से एक हैं परिपक्व टी कोशिकाओं टी सेल रिसेप्टर (TCR) जीन की rearrangements होते हैं और एक अक्षुण्ण जीनोम इस प्रकार अनुप्रयोगों 15,16 के लिए अपनी क्षमता को सीमित करने की कमी है। हालांकि, IPSC पीढ़ी के माध्यम से टी कोशिकाओं की कायाकल्प chimeric एंटीजन रिसेप्टर (सीएआर) टी सेल थेरेपी 17-19 में संभावित आवेदन कर सकते हैं। इसकी तुलना में, HPCs एक अक्षुण्ण जीनोम है और आसानी से reprogrammable हैं। हालांकि केवल 0.01 - परिधीय संचलन में 0.1% की कोशिकाओं HPCs हैं, इन कोशिकाओं को विस्तारित किया जा सकता पूर्व एर्य्थ्रोइद माध्यम में विवो कि erythr के प्रसार के पक्ष मेंOID पूर्वज 14 कोशिकाओं।

हमारे पिछले अध्ययन में, हम यामानाका कारकों (OCT4, Sox2, MYC और KLF4) है, जो पंजाब reprogramming दक्षता 20 में एक 10x वृद्धि के परिणामस्वरूप के अलावा कारक बीसीएल-एक्सएल का इस्तेमाल किया। बीसीएल-एक्सएल भी BCL2L1 के रूप में जाना जाता है, कोशिका मृत्यु का एक शक्तिशाली अवरोध करनेवाला, caspases 21,22 की सक्रियता के द्वारा बाधा है। लेकिन, बीसीएल-एक्सएल भी pluripotency 21,22 बनाए रखने में महत्वपूर्ण भूमिका निभा सकते हैं। हाल ही में, हम आगे की अलग-अलग दो वैक्टर, जो reprogramming दक्षता 23 में एक लगभग 100x वृद्धि हो जाती है साथ MYC और KLF4 व्यक्त करने से हमारे ईवी reprogramming प्रणाली अनुकूलित है। स्वस्थ दाताओं से 0.5% - इस विधि का प्रयोग, reprogramming दक्षता, अभिकर्मक पर सेल नंबर शुरू करने से विभाजित कॉलोनी संख्या से परिभाषित 0.2 है। इस प्रकार के रूप में, हम पंजाब से एकीकरण से मुक्त IPSCs पैदा करने के लिए विस्तृत प्रयोगात्मक प्रक्रिया का वर्णन है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

मानव पीबी नमूने के सभी कोई पहचान स्थानीय अनुसंधान आचार समिति के अनुमोदन से तियानजिन रक्त केंद्र से उपलब्ध जानकारी के साथ गुमनाम वयस्क दानदाताओं से प्राप्त किया गया।

1. इंडो-मुक्त प्लाज्मिड तैयारी

  1. एक वाणिज्यिक प्लाज्मिड शोधन मैक्सी किट का प्रयोग निर्माता प्रोटोकॉल के अनुसार ई कोलाई से episomal वैक्टर निकालने के लिए। अंतिम चरण के लिए, endotoxin मुक्त बाँझ पानी के साथ स्थानापन्न ते बफर डीएनए गोली भंग करने के लिए।
  2. डीएनए एकाग्रता उपाय एक वाणिज्यिक यूवी / विज़ स्पेक्ट्रोफोटोमीटर का उपयोग। एकाग्रता आमतौर पर 1 से अधिक माइक्रोग्राम / μL, A260 / A280 और A260 / A230 1.8 और 2.0 क्रमश: अधिक से अधिक अनुपात के साथ है।

2. संस्कृति मीडिया

  1. एर्य्थ्रोइद मध्यम तैयार: hematopoietic स्टेम सेल विस्तार मध्यम 100 एनजी / एमएल मानव स्टेम सेल फैक्टर (एससीएफ), 10 एनजी / एमएल इंटरल्युकिन-3 (IL3), 2 यू / एमएल एरिथ्रोपीटिन के साथ पूरक (ईपीओ), 20 एनजी / एमएल इंसुलिन वृद्धि कारक 1 (IGF1), 1 माइक्रोन dexamethasone और 0.2 मिमी 1-thioglycerol। 0.22 सुक्ष्ममापी सिरिंज फिल्टर के साथ बाँझ फ़िल्टर। Erythroid मध्यम एक महीने तक के लिए 4 डिग्री सेल्सियस पर संग्रहित किया जा सकता है।
  2. IPSC मध्यम तैयार: DMEM / F12 मध्यम (Dulbecco संशोधित ईगल मध्यम / पोषक तत्व मिश्रण F-12) 1x एल glutamine, 1x पेनिसिलिन / स्ट्रेप्टोमाइसिन, 1x गैर आवश्यक अमीनो एसिड समाधान, 50 एनजी / एमएल fibroblast वृद्धि कारक 2 (FGF2 के साथ पूरक ), 1x इंसुलिन Transferrin-Selenite पूरक (आईटीएस), और 50 मिलीग्राम / एमएल एस्कॉर्बिक एसिड। 0.22 सुक्ष्ममापी सिरिंज फिल्टर के साथ बाँझ फ़िल्टर। IPSC मध्यम एक महीने तक के लिए 4 डिग्री सेल्सियस पर संग्रहित किया जा सकता है।
  3. ; 1x पेनिसिलिन / स्ट्रेप्टोमाइसिन और 10% भ्रूण गोजातीय सीरम (FBS) के साथ पूरक Dulbecco संशोधित ईगल मध्यम (उच्च ग्लूकोज DMEM): MEF मध्यम तैयार करें। 0.22 सुक्ष्ममापी सिरिंज फिल्टर के साथ बाँझ फ़िल्टर। MEF मध्यम अप करने के लिए एक महीने के लिए 4 डिग्री सेल्सियस पर संग्रहित किया जा सकता है या हौसले से उपयोग करने से पहले 1x एल glutamine जोड़ें।
  4. पीrepare IPSC cryopreservation मध्यम (2x): एक 37 डिग्री सेल्सियस पानी के स्नान में बाँझ पानी के 30 एमएल में डी-trehalose के 5 ग्राम भंग। 4 डिग्री सेल्सियस तक तापमान ले आओ और फिर FBS के 10 एमएल और dimethylsulfoxide के 10 एमएल (DMSO) जोड़ें। 0.22 सुक्ष्ममापी सिरिंज फिल्टर के साथ बाँझ फ़िल्टर। अप करने के लिए 3 महीने के लिए 24 4 डिग्री सेल्सियस पर स्टोर।

3. परिधीय रक्त कोशिकाओं mononuclear के अलगाव (पीबी एमएनसी)

  1. एक 50 मिलीलीटर ट्यूब में 10 एमएल ताजा पीबी नमूना और 10 एमएल पीबीएस बफर का मिश्रण है और अच्छी तरह मिलाएँ। आरटी के लिए पीबीएस लाओ या उपयोग करने के 37 डिग्री सेल्सियस से पहले।
    नोट: लगभग 1 - 3 एक्स 10 6 बहुराष्ट्रीय कंपनियों (ताजा या cryopreserved) पंजाब के 1 एमएल से प्राप्त किया जा सकता है। संस्कृति के दौरान 1 एक्स 10 6 कुल परिपक्व कोशिकाओं की मौत के कारण कोशिकाओं - के बाद संस्कृति के 6 डी, 0.5 की उम्मीद है। लगभग 1 10 x 7 कोशिकाओं ताजा पंजाब के 10 एमएल से प्राप्त किया जा सकता है।
  2. एक 10 एमएल सिरिंज एक लंबी सुई से जुड़ी का उपयोग कर ट्यूब के नीचे करने के लिए 10 एमएल Ficoll जोड़ें। यह समर्थकउपकर धीरे से किया जाना चाहिए कि यह सुनिश्चित करने Ficoll परत पंजाब के साथ मिश्रण नहीं है।
  3. एक कम त्वरण और मंदी दर पर 30 मिनट के लिए 400 XG पर अपकेंद्रित्र। बाद centrifugation, पंजाब बहुराष्ट्रीय कंपनियों सफेद परत (बफी कोट) पंजाब प्लाज्मा और Ficoll के बीच स्थित में हैं।
  4. धीरे-धीरे महाप्राण ~ बफी कोट परत परेशान बिना 10 एमएल पीबी प्लाज्मा। ध्यान से सफेद परत एक नया 50 मिलीलीटर ट्यूब के लिए एक 1 एमएल विंदुक टिप का उपयोग फसल। 6 एमएल - सफेद परत से एकत्र कोशिकाओं की कुल मात्रा 3 के बीच होगा।
  5. पीबीएस 30 एमएल के लिए कुल मात्रा लाने के लिए और एक 10 एमएल विंदुक के साथ अच्छी तरह से मिश्रण करने के लिए जोड़ें। 10 मिनट के लिए 400 XG पर अपकेंद्रित्र।
  6. 20 एमएल संस्कृति के माध्यम से (यानी Iscove संशोधित Dulbecco के मध्यम, IMDM) में सतह पर तैरनेवाला और resuspend सेल गोली निकालें और अच्छी तरह मिलाएँ। 10 मिनट के लिए 400 XG पर अपकेंद्रित्र प्लेटलेट्स की बहुमत हटा दें।
  7. तैरनेवाला निकालें और 1 में सेल गोली resuspend - 2 एमएल IMDM। प्रकोष्ठों च इस्तेमाल किया जा सकता हैया तत्काल संस्कृति, या बाद में उपयोग के लिए जमे हुए नीचे। cryopreservation के लिए, cryopreservation मध्यम के बराबर राशि जोड़ें। करने के लिए एक -80 - (शीशी प्रति 1 एमएल 0.5) और हस्तांतरण cryovials सी फ्रीजर तुरंत ° cryovials में अशेष कोशिकाओं। पंजाब बहुराष्ट्रीय कंपनियों के कई हफ्तों के लिए -80 डिग्री सेल्सियस फ्रीजर में जमा हो या लंबी अवधि के भंडारण के लिए एक तरल नाइट्रोजन टैंक को हस्तांतरित किया जा सकता है।
    नोट: जब जमे हुए कोशिकाओं विगलन, हालांकि हमारे cryopreservation मध्यम सेल व्यवहार्यता को बनाए रखने कर सकते हैं, सेल नंबर कारण कोशिका मृत्यु के लिए विगलन प्रक्रिया के दौरान कम हो सकती है। यह सिफारिश की है कि 1 - 10 के 10 x 7 कोशिकाओं को एक शीशी में जमे हुए किया जाएगा।

4. erythroid मध्यम में पंजाब बहुराष्ट्रीय कंपनियों का विस्तार

  1. एक 15 मिलीलीटर ट्यूब में 5 एमएल IMDM मध्यम तैयार। जल्दी से एक 37 डिग्री सेल्सियस पानी के स्नान में जमे हुए पंजाब बहुराष्ट्रीय कंपनियों पिघलना और फिर IMDM मध्यम के साथ ट्यूब को हस्तांतरण।
    नोट: नहाने के पानी में समय की लंबाई cryopreserved कोशिकाओं की मात्रा और cryovial यू पर निर्भर करता हैएसईडी। आमतौर पर, जमे हुए सेल 1 मिनट के भीतर गल जाएगा।
  2. 10 मिनट - 5 के लिए 400 XG पर अपकेंद्रित्र। तैरनेवाला निकालें और erythroid मध्यम में सेल गोली resuspend। 10 μL Trypan ब्लू 10 μL सेल निलंबन के लिए समाधान जोड़ें और मिश्रण अच्छी तरह से। 3 मिनट - Trypan ब्लू 1 के भीतर मृत कोशिकाओं दाग। खुर्दबीन के नीचे कोशिकाओं एक hemocytometer का उपयोग गिनती।
  3. एक गैर टिशू कल्चर में संस्कृति पीबी बहुराष्ट्रीय कंपनियों (गैर टीसी) अच्छी तरह से प्रति 2 एमएल मध्यम के साथ 6 अच्छी तरह से थाली में इलाज, के एक सेल घनत्व में ~ 5 एक्स 10 6 कोशिकाओं / एमएल, 37 डिग्री सेल्सियस पर एक 5% सीओ 2 में humidified इनक्यूबेटर।
  4. डी 3 और 5 में मध्यम बदलने के बिना प्रत्येक अच्छी तरह से करने के लिए 1 एमएल ताजा एर्य्थ्रोइद मध्यम सीधे जोड़ें।
  5. डी 6 में फसल nucleofection के लिए पंजाब एमएनसी।

5. पंजाब बहुराष्ट्रीय कंपनी Nucleofection और Reprogramming

  1. nucleofection से पहले एक दिन, पूर्व कोट 0.1% जिलेटिन के साथ 37 डिग्री सेल्सियस पर 20 मिनट के लिए टीसी का इलाज 6 अच्छी तरह प्लेटें। पिघलना निष्क्रिय Murine भ्रूण Fibroविस्फोट (MEF) एक 37 डिग्री सेल्सियस पानी के स्नान में फीडर कोशिकाओं और तुरंत उन्हें MEF माध्यम के 5 एमएल युक्त एक 15 मिलीलीटर ट्यूब को हस्तांतरण।
  2. 5 मिनट के लिए 400 XG पर अपकेंद्रित्र और सतह पर तैरनेवाला हटा दें। 6 अच्छी तरह से थाली से जिलेटिन निकालें, MEF मध्यम में सेल गोली resuspend, और उन्हें जिलेटिन पूर्व इलाज 6 अच्छी तरह से थाली के लिए स्थानांतरण। प्रत्येक अच्छी तरह से, बीज 2 - 4 एक्स 10 5 निष्क्रिय MEF कोशिकाओं 2 एमएल MEF माध्यम में निलंबित कर दिया।
  3. संस्कृति एक 5% सीओ 2 humidified इनक्यूबेटर में 37 डिग्री सेल्सियस पर MEF फीडर कोशिकाओं।
  4. nucleofection के दिन, MEF मध्यम aspirate और 1 एमएल एर्य्थ्रोइद मध्यम के साथ बदलें। 37 डिग्री सेल्सियस पर 30 मिनट के एक 5% सीओ 2 humidified इनक्यूबेटर में - 10 के लिए संस्कृति प्लेट पूर्व संतुलित करना।
  5. 2 माइक्रोग्राम PEV-OCT4-2A-Sox2, जोड़ें 1 माइक्रोग्राम PEV-MYC, 1 माइक्रोग्राम PEV-KLF4, और 0.5 माइक्रोग्राम प्रति एक 1.5 एमएल बाँझ Eppendorf ट्यूब में PEV-बीसीएल-एक्सएल। 50 डिग्री सेल्सियस पर ट्यूब हीट 5 मिनट के प्रदूषण को रोकने के लिए, और आरटी को शांत करने के लिए। जोड़ना57 μL बफर और 13 μL पूरक nucleofection।
  6. हार्वेस्ट 7 मिनट के लिए 200 XG पर centrifuging द्वारा एक 5 एमएल ट्यूब 2 एक्स 10 6 सुसंस्कृत पीबी एमएनसी। तैरनेवाला निकालें और सेल गोली प्लाज्मिड और nucleofection बफर मिश्रण जोड़ें। अपनी उंगली के साथ ट्यूब flicking द्वारा अच्छी तरह से मिलाएं।
    नोट: 2 एक्स 10 5 कोशिकाओं के रूप में के रूप में कम nucleofection के लिए इस्तेमाल किया जा सकता है, लेकिन एक कम reprogramming दक्षता के रूप में अच्छी तरह से उम्मीद की जानी चाहिए।
  7. किट में प्रदान की क्युवेट करने के लिए डीएनए और सेल निलंबन स्थानांतरण और क्युवेट टोपी। nucleofection डिवाइस पर कार्यक्रम अंडर 008 का चयन करें। धारक में क्युवेट डालें और यू-008 कार्यक्रम लागू करने के लिए ठीक दबाएँ।
  8. तुरंत पूर्व equilibrated MEF थाली करने के लिए प्रत्येक क्युवेट में 1 एमएल पूर्व गर्म एर्य्थ्रोइद माध्यम है, और हस्तांतरण कोशिकाओं - धारक के बाहर क्युवेट लो, 0.5 जोड़ें। उच्च reprogramming दक्षता और दाता बदलाव लेकर कोशिकाओं की संख्या अलग बोने के कारण 1-10 x 10 5 कोशिकाओं से Pएर अच्छी तरह से अत्यधिक प्रोत्साहित किया जाता है।
  9. एक हाइपोक्सिया चैम्बर के लिए थाली हस्तांतरण, और एक मिश्रित 92% एन 2, 5% सीओ 2 और 3% 2 हे की रचना की गैस के साथ चैम्बर फ्लश, 1 - 20 एल / मिनट की दर पर 2 मिनट। 37 डिग्री सेल्सियस पर चैम्बर, संस्कृति कोशिकाओं को सील करने के बाद।
  10. डी 2 के बाद nucleofection में, प्रत्येक अच्छी तरह से करने के लिए सीधे 2 एमएल IPSC माध्यम जोड़ें।
  11. डी 4 के बाद nucleofection में मध्यम के 3 एमएल निकालें और 2 एमएल जोड़ने ताजा IPSC माध्यम। डी 4 के बाद nucleofection में जीवित कोशिकाओं के सबसे फीडर परत से जुड़ा हुआ है जाएगा।
  12. 18 - डी 6 के बाद nucleofection के बाद, मध्यम 500 μL छोड़ने मध्यम बिताया और 2 मिलीलीटर ताजा E8 मध्यम डी 14 तक 0.25 मिमी सोडियम butyrate के साथ पूरक जोड़कर हर 2 डी बदल जाते हैं।
    नोट: अतिरिक्त फीडर कोशिकाओं संस्कृति कुओं जब भी देख रहा है कि फीडर कोशिकाओं को अलग कर दिया गया है में जोड़ा जा सकता है। MEFs (5.1 और 5.2 देखें) विगलन के बाद, (E8 माध्यम की एक छोटी मात्रा में सेल गोली resuspend यानी ~ 0।एक 6 अच्छी तरह से थाली में से एक अच्छी तरह से) और उसके बाद के लिए 2 एमएल संस्कृति कुओं में MEFs जोड़ें। लगभग 2% FBS सेल लगाव बढ़ाने के लिए जोड़ा जा सकता है। वैकल्पिक रूप से, MEF वातानुकूलित मध्यम भी इस्तेमाल किया जा सकता है, लेकिन इसे और अधिक श्रमसाध्य है।

6. IPSCs का विस्तार

नोट: - 10 पद nucleofection ज्यादातर मामलों में, IPSC कालोनियों की बड़ी संख्या डी 8 पर दिखाई देते हैं। D 14 के बाद, बड़े IPSC कालोनियों आम तौर पर चुनने के लिए तैयार हैं।

  1. कालोनियों उठा से पहले, 500 μL E8 मध्यम रॉक अवरोध, Y27632 (10 माइक्रोन) के साथ पूरक जोड़ने के लिए एक फीडर या Matrigel लेपित 24 अच्छी तरह से थाली के एक कुएं में। खरोंच और माइक्रोस्कोप के नीचे कालोनियों लेने के लिए एक 10 या 20 μL पिपेट का प्रयोग करें। संस्कृति के माध्यम से युक्त कुओं के लिए प्रत्येक कॉलोनी के टुकड़े स्थानांतरण।
    नोट: Matrigel की एकाग्रता एक बैच से दूसरे को अलग है। Matrigel के 100 कमजोर पड़ने: आमतौर पर, हम 1 का उपयोग करें।
    1. आदेश पार संक्रमण से बचने के लिए, उठाओकालोनियों है कि बड़े और अच्छी तरह से दूसरों से अलग कर रहे हैं। एक 5% सीओ 2 humidified इनक्यूबेटर में 37 डिग्री सेल्सियस पर संस्कृति IPSCs।
      नोट: यह ध्यान रखें कि IPSC आबादी है जब वहाँ एक 6 अच्छी तरह से थाली के प्रत्येक कुएं में दर्जनों या कालोनियों के सैकड़ों रहे हैं सेल प्रवास के कारण पॉलीक्लोनल हो सकता है किया जाना चाहिए।
  2. के लिए पहले 2 डी मध्यम बदल नहीं है। रॉक अवरोध छोटी कालोनियों 25 के अस्तित्व को बढ़ावा देने के कर सकते हैं।
  3. डी 2 के बाद से, मध्यम खर्च मध्यम हटाने और अच्छी तरह से प्रत्येक में 500 μL ताजा E8 मध्यम जोड़कर हर दिन बदल जाते हैं।
  4. लगभग 1 सप्ताह बाद जब कालोनियों काफी बड़े हैं, मध्यम हटाने और 1 के लिए 37 डिग्री सेल्सियस पर 300 μL सेल टुकड़ी समाधान (पीबीएस में 0.5 मिमी EDTA) के साथ कोशिकाओं का इलाज - 3 मिनट। सेल टुकड़ी समाधान निकालें और रॉक अवरोध करनेवाला (10 माइक्रोन) युक्त IPSCs को निलंबित करने के E8 माध्यम जोड़ें। एकल कक्षों, जो अत्यधिक सेल मौत का कारण हो सकता है में कालोनियों नीचे तोड़ नहीं है। 50 सेल - साथ 5 सेल clumpsएस IPSC पारित होने के लिए उपयुक्त हैं।
  5. एक 12 या 6 अच्छी तरह से थाली कि भक्षण या Matrigel साथ precoated कर दिया गया है की हर अच्छी तरह से करने के लिए सेल निलंबन के 100% - स्थानांतरण 50।
  6. Matrigel में लिपटे प्लेटों में लंबी अवधि संस्कृति (6.1 में नोट देखें) के लिए, हर दिन मध्यम बदल जाते हैं। सेल confluency 40 तक पहुँच जाता है - 60%, ~ 3 मिनट के लिए 37 डिग्री सेल्सियस पर 1 एमएल सेल टुकड़ी समाधान (पीबीएस में 0.5 मिमी EDTA) के साथ कोशिकाओं का इलाज। कालोनियों कर्ल करने के लिए शुरू, सेल टुकड़ी समाधान निकालने और IPSCs को निलंबित करने के E8 मध्यम युक्त रॉक अवरोध करनेवाला (10 माइक्रोन) के जोड़ें। के 4 एक बंटवारे कारक के साथ पारित होने कोशिकाओं - 8. रॉक अवरोध जब कोशिकाओं passaging अस्तित्व बढ़ाने के लिए जोड़ा जाना चाहिए, और भेदभाव को रोकने के लिए 1 घ बाद में हटा दिया।
  7. निर्माता प्रोटोकॉल के अनुसार 5 मिनट - फ्रीज नीचे करने के लिए IPSCs, 3 के लिए 37 डिग्री सेल्सियस पर सेल टुकड़ी समाधान के साथ कोशिकाओं का इलाज। IPSC कालोनियों कर्ल करने के लिए शुरू, बफर aspirate और 0.5 जोड़ - 1 एमएल E8 माध्यम।
  8. <li> सेल निलंबन के लिए cryopreservation मध्यम के एक बराबर मात्रा में जोड़ें और मिश्रण अच्छी तरह से। जमे हुए IPSCs कई हफ्तों के लिए या लंबी अवधि के भंडारण के लिए तरल नाइट्रोजन में एक -80 डिग्री सेल्सियस फ्रीजर में संग्रहित किया जा सकता है।

अवशिष्ट episomal प्लास्मिड बिना IPSCs 7. चयन

  1. पारित होने के 5, फसल IPSCs के बाद और जीनोमिक डीएनए निकाल सकते हैं।
    नोट: आमतौर पर संस्कृति के 5 मार्ग के बाद, अवशिष्ट episomal plasmids undetectable हैं। इस प्रकार, लगभग सभी 5 (यानी पारित होने के 10) के ऊपर मार्ग पर IPSC कालोनियों के अवशिष्ट episomal plasmids कमी कर रहे हैं।
  2. एक नकारात्मक नियंत्रण के रूप में untransfected पीबी बहुराष्ट्रीय कंपनियों से जीनोमिक डीएनए का प्रयोग करें। 1 माइक्रोग्राम प्रति नकारात्मक नियंत्रण डीएनए में 1.6 पीजी PEV-OCT4-2A-Sox2 प्लाज्मिड जोड़े सेल प्रति PEV प्लाज्मिड की एक प्रति के साथ कोशिकाओं को नकल करने के लिए।
  3. (10 माइक्रोन के प्रत्येक आगे की और प्राइमरों रिवर्स) 9 μL पीसीआर ग्रेड 100 एनजी जीनोमिक डीएनए और 1 μL विशिष्ट प्राइमरों सहित पानी मे 10 μL उच्च फिडेलिटी पीसीआर मास्टर मिश्रण में। AM को सामान्यGAPDH से डीएनए के ount। EBNA1-एफ TTTAATACGATTGAGGGCGTCT, EBNA1 आर GGTTTTGAAGGATGCGATTAAG, WPRE-एफ GGTTTAAACGCGTCGACAAT, WPRE आर GTTGCGTCAGCAAACACAGT, GAPDH-एफ GAGTCCACTGGCGTCTTC, GAPDH आर GACTGTGGTCATGAGTCCTTC: पीसीआर के लिए निम्नलिखित प्राइमरों का प्रयोग करें।
  4. 60 एस के लिए 98 डिग्री सेल्सियस पर प्रतिक्रिया मिश्रण सेते हैं; 10 एस, 30 एस के लिए 60 डिग्री सेल्सियस, और 30 एस के लिए 72 डिग्री सेल्सियस के लिए 98 डिग्री सेल्सियस के द्वारा पीछा किया। 30 चक्रों के बाद; 5 मिनट के लिए 72 डिग्री सेल्सियस पर प्रतिक्रिया करता हूं।
  5. लोड 5 एक 1% agarose जेल के प्रत्येक कुएं में μL पीसीआर उत्पादों। 100 पर 30 मिनट के वी EBNA1 और WPRE आगे संस्कृति और नीचे की ओर विश्लेषण के लिए के लिए undetectable बैंड के साथ IPSC क्लोन चुनें - 20 के लिए जेल चला।

8. से फ्लो

  1. 5 मिनट के लिए एक एकल कोशिका निलंबन प्राप्त करने के लिए - 3 के लिए 37 डिग्री सेल्सियस पर Accutase के साथ उन्हें इलाज से हार्वेस्ट IPSCs। जोड़े 1 μL पीई संयुग्मित विरोधी टीआरए-1-60 या eFluor 570 संयुग्मित विरोधी SSEA4 या Isotypic एंटीबॉडी सेल निलंबन के 100 μL करने के लिए (1 - 5 एक्स 10 5 कोशिकाओं) 5 एमएल ट्यूबों में। 20 मिनट के लिए आरटी पर एक अंधेरे स्थान में ट्यूबों को सेते हैं।
  2. आरटी पर 20 मिनट के लिए धुंधला के बाद, 5 मिनट के लिए 400 XG पर 2 मिलीलीटर पीबीएस और सेंट्रीफ्यूज जोड़ें। प्रतिदीप्ति सक्रिय सेल छंटनी (FACS) के विश्लेषण के लिए 300 μL पीबीएस में Resuspend कोशिकाओं सेल विश्लेषक एक प्रवाह cytometry का उपयोग कर। 23,26

9. Confocal इमेजिंग

  1. Matrigel लेपित चैम्बर स्लाइड्स में बीज IPSCs।
  2. बाद 3 - संस्कृति के 4 डी, मध्यम विकास को हटा दें और 30 मिनट के लिए आरटी पर 4% paraformaldehyde (पीएफए) के साथ तय कर लो। कोशिकाओं पीबीएस के साथ दो बार धोएं।
    नोट: पीएफए ​​विषाक्त और हानिकारक है।
  3. 30 मिनट के लिए 0.1% ट्राइटन आरटी पर पीबीएस में X-100 (पीबीएस-टी) के साथ कोशिकाओं को समझो। कोशिकाओं पीबीएस के साथ दो बार धोएं।
  4. 1 घंटे के लिए आरटी पर: बफर अवरुद्ध (वी पीबीएस में 5% बकरी सीरम, वी) के साथ कोशिकाओं को ब्लॉक करें।
  5. अवरुद्ध कदम के दौरान, बफर अवरुद्ध में प्राथमिक एंटीबॉडी (100x) पतला।
    नोट: एंटीबॉडी जानकारी सामग्री की तालिका में सूचीबद्ध है / उपकरण
  6. 4 डिग्री सीओ / एन पर पतला एंटीबॉडी के साथ कोशिकाओं को सेते हैं।
  7. दो बार पीबीएस-टी के साथ 15 मिनट के लिए पीबीएस के साथ दो बार 15 मिनट के लिए धो, द्वारा पीछा किया।
  8. 2 घंटे के लिए आरटी पर एक पतला fluorophore संयुग्मित माध्यमिक एंटीबॉडी के साथ कोशिकाओं को सेते हैं।
  9. कोशिकाओं में दो बार पीबीएस-टी के साथ 15 मिनट के लिए, जिसके बाद दो बार पीबीएस के साथ 15 मिनट के लिए धो लें।
  10. 10 मिनट के लिए आरटी पर DAPI (1 माइक्रोग्राम / एमएल) पीबीएस के साथ नाभिक दाग।
  11. 15 मिनट के लिए पीबीएस के साथ कोशिकाओं को दो बार धो लें।
  12. छवियों को एक confocal खुर्दबीन के साथ कब्जा। 23,27

10 टेराटोमा परख

सेल टुकड़ी समाधान (पीबीएस में 0.5 मिमी EDTA) और resuspend कोशिकाओं 200 μL DMEM / F12 में पतला साथ हार्वेस्ट 1 एक्स 10 6 IPSCs (1: 1) Matrigel।

  1. Subcutaneously इशारा / SCID immunodeficient चूहों के पीछे रान में कोशिकाओं इंजेक्षन।
  2. 8 - IPSC इंजेक्शन के बाद 12 सप्ताह, काटना और 10% formalin में teratomas तय कर लो। 28
  3. microsectioning के बाद औरhematoxylin और eosin (एच एंड ई) के साथ धुंधला हो जाना, नमूनों का विश्लेषण। 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस प्रोटोकॉल का उपयोग करना, हम 1 एक्स 10 5 nucleofected पीबी बहुराष्ट्रीय कंपनियों से कालोनियों के सैकड़ों प्राप्त कर सकते हैं (आंकड़े 1 ए और 1 बी)। 0.5% और कालोनियों pluripotency मार्कर (आंकड़े 1 सी और 1 डी) एक्सप्रेस - reprogramming दक्षता लगभग 0.2 है। वर्णित प्रोटोकॉल का उपयोग कर उत्पन्न IPSCs एकीकरण से मुक्त हैं और टेराटोमा 3 रोगाणु परतों (आंकड़े 1E और 1F) रचना फार्म करने की क्षमता है।

आकृति 1
चित्रा 1: परिधीय रक्त कोशिकाओं mononuclear से एकता मुक्त IPSCs की पीढ़ी। (ए): परिधीय रक्त कोशिकाओं reprogramming के लिए प्रोटोकॉल का एक योजनाबद्ध। (ख): थोक (बाएं) में एपी धुंधला और एक ठेठ ईएससी-तरह IPSC कॉलोनी (दाएं)60, 14 डी पीबी बहुराष्ट्रीय कंपनियों nucleofection के बाद। स्केल पट्टी: 100 माइक्रोन। (सी): बीतने के 5 पर IPSCs के प्रतिनिधि FACS आरेख व्यक्त टीआरए-1-60 या SSEA4। (डी): IPSC कालोनियों NANOG और OCT4 व्यक्त करने का प्रतिनिधि confocal छवियों। स्केल पट्टी: 100 माइक्रोन। (ई): कुल तस्वीर और सभी तीन रोगाणु परतों शामिल टेराटोमा के एच एंड ई धुंधला के प्रतिनिधि छवि। स्केल पट्टी: 100 माइक्रोन। (एफ): पांच मार्ग के बाद IPSCs में अवशिष्ट ईवी plasmids के नंबरों को कॉपी करें। EBNA1 और WPRE के लिए विशिष्ट प्राइमरों episomal वैक्टर बढ़ाना इस्तेमाल किया गया। GAPDH एक डीएनए लोडिंग नियंत्रण के रूप में इस्तेमाल किया गया था। यूडी, undetectable। सकारात्मक लेन एक एक प्रतिलिपि नियंत्रण इंगित करता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

स्वस्थ दाताओं या रोगियों से रक्त के नमूने हासिल करना यह बुनियादी अनुसंधान और नैदानिक ​​सेल थेरेपी के लिए एक आकर्षक सेल स्रोत बना सुविधाजनक और noninvasive है। यहाँ हम परिधीय रक्त के नमूनों से एकीकरण से मुक्त IPSCs की अत्यधिक कुशल पीढ़ी के लिए एक प्रोटोकॉल का वर्णन किया है। यह प्रतिलिपि प्रस्तुत करने योग्य और सस्ती दृष्टिकोण IPSC क्षेत्र को लाभ होना चाहिए।

हम सूचना दी है वहाँ अत्यधिक कुशल पीबी 30 reprogramming के लिए जिम्मेदार दो महत्वपूर्ण कारक हैं कि। एक एक 2A लिंकर 31 का उपयोग करके OCT4 की equimolar अभिव्यक्ति और Sox2 है। इस लक्ष्य को हासिल करने के लिए, PEV-OCT4-2A-Sox2 इस प्रोटोकॉल में प्रयोग किया जाता है। अन्य दो plasmids PEV-MYC और PEV-KLF4 के उपयोग MYC और KLF4 व्यक्त करने के लिए PEV-MYC-2A-KLF4 के बजाय कि हम पहले 30 का इस्तेमाल किया है। प्रतीत होता है सरल परिवर्तन पीबी reprogramming क्षमता में एक लगभग 100X वृद्धि हुई है, जो काफी हद तक MYC में एक क्रमिक और अधिक से अधिक वृद्धि के कारण है की ओर जाता है: के.एल.प्रक्रिया के दौरान F4 अनुपात।

कई बिंदुओं पंजाब से उच्च दक्षता IPSC पीढ़ी को प्राप्त करने के लिए विचार किया जाना चाहिए। पंजाब बहुराष्ट्रीय कंपनियों एर्य्थ्रोइद माध्यम है, जो प्रसार और एर्य्थ्रोइद पूर्वज कोशिकाओं के विस्तार को बढ़ावा देता में ~ 1 सप्ताह के लिए सुसंस्कृत हैं और इस प्रकार reprogramming दक्षता 20 बढ़ जाती है। हालांकि, कुछ नमूने, विशेष रूप से ल्यूकेमिया के रोगियों से रक्त कोशिकाओं के लिए के लिए, कोशिकाओं को खराब जीवित रहने के लिए जब एर्य्थ्रोइद माध्यम में सुसंस्कृत। इस मामले में, यह संवर्धन के समय को कम करने में मददगार होगा। nucleofection दक्षता, जो 50% से अधिक होना चाहिए सत्यापित करने के लिए 2 माइक्रोग्राम pmaxGFP वेक्टर - यह भी 1 का उपयोग करने के लिए प्रोत्साहित किया जाता है। इसके अलावा, प्लाज्मिड गुणवत्ता के लिए महत्वपूर्ण है। यह (IE का उपयोग इंडो-मुक्त प्लाज्मिड मैक्सी किट plasmids निकालने के लिए) endotoxin संदूषण के बिना plasmids का उपयोग करने की सिफारिश की है। गरीब प्लाज्मिड गुणवत्ता महत्वपूर्ण कोशिका मृत्यु का कारण हो सकता है और इस तरह reprogramming क्षमता को कम। हम और दूसरों है कि हाइपोक्सिया promot से पता चला हैIPSC पीढ़ी 14,32 तों। हम एक मिश्रित 92% एन 2, 5% सीओ 2 और 3% 2 हे की रचना की गैस के साथ हाइपोक्सिया चैम्बर फ्लश। normoxia बजाय प्रयोग किया जाता है, तो reprogramming दक्षता में 80% की कमी करने के लिए एक ऊपर देखा जा सकता है। एक बार जब reprogramming पूरा हो गया है, IPSCs एक नियमित humidified 5% सीओ 2 इनक्यूबेटर में संवर्धित किया जा सकता है। जब मध्यम बदल रहा है, यह खर्च माध्यम की एक छोटी राशि (यानी 500 6 अच्छी तरह से थाली में अच्छी तरह से प्रति μL) को छोड़ने के लिए, और फिर ताजा मध्यम जोड़ने आसान है। मध्यम reprogramming के दौरान केवल हर दूसरे दिन बदलें, भी लगातार मध्यम परिवर्तन के रूप में IPSCs पीढ़ी 33 कम कर सकते हैं।

नए प्रोटोकॉल हम विकसित किया है एक उच्च स्तरीय पीबी reprogramming कि एसवी reprogramming प्रणाली के बराबर है हासिल की है। ईवी प्रणाली कई स्पष्ट फायदे हैं। एक के लिए, ईवी एसवी तुलना में सस्ती है। ईवी प्रणाली को भी आगे अतिरिक्त कारकों या अलग combina सहित द्वारा संशोधित किया जा सकताकई कारकों का माहौल है, जबकि SVs वैक्टर एक वाणिज्यिक उत्पाद है कि जांचकर्ताओं द्वारा संशोधित नहीं किया जा सकता है। हमारे वर्तमान प्रोटोकॉल MEF फीडर कोशिकाओं और पशु व्युत्पन्न उत्पादों के उपयोग, जो नैदानिक अनुप्रयोगों को सीमित कर सकता है, लेकिन आसानी से आगे प्रोटोकॉल विकास 34,35 से हटाया जा सकता है।

इस प्रणाली के साथ उत्पन्न IPSCs, न केवल रोग मॉडलिंग और दवा स्क्रीनिंग, के लिए बल्कि नैदानिक ​​चिकित्सा के लिए इस्तेमाल किया जा सकता है क्योंकि जीएमपी स्तर ईवी plasmids आसानी से उत्पन्न किया जा सकता है और काफी ईवी एकीकरण के साथ कोई IPSCs पहचान की गई है। नैदानिक ​​अनुप्रयोगों में, मरीज की कोशिकाओं को आम तौर पर एक रोग उत्प्रेरण जीन है, जो चिकित्सा के लिए कार्यात्मक कोशिकाओं में भेदभाव से पहले IPSCs में ठीक करने की जरूरत है बंदरगाह। हाल ही में एक रिपोर्ट से पता चला है कि ईवी reprogramming प्रणाली को आसानी से CRISPR / Cas9 प्रणाली के साथ एकीकृत किया जा सकता है कि एक साधारण nucleofection 36 के बाद एक साथ reprogramming और जीनोम संपादन प्राप्त करने के लिए। यह है एकएसवी प्रणाली पर EV के Nother लाभ। हमारे अप्रकाशित डेटा है कि ऊपर से पता चला है एक 20% जीनोम संपादन दक्षता के लिए जब ईवी reprogramming पर जीनोम संपादन पिगीबैकिंग प्राप्त किया जा सकता है। हमें उम्मीद है क्रिस्प / Cas9R जीनोम संपादन के साथ पंजाब reprogramming के एकीकरण के कई रोगों कि अन्यथा आने वाले दशकों में लाइलाज हैं उपचार में संभावित आवेदन कर सकते है।

सारांश में, हमारी सुधार परिधीय रक्त कोशिका reprogramming प्रोटोकॉल बुनियादी अनुसंधान और नैदानिक ​​अनुप्रयोगों में जांचकर्ताओं की एक व्यापक स्पेक्ट्रम के लिए उपयोगी होना चाहिए। इस कुशल ईवी reprogramming प्रणाली को भी संशोधनों के बाद, नियोजित किया जा सकता है, एक IPSC चरण से गुजर बिना एकीकरण से मुक्त mesenchymal स्टेम सेल (MSCs), 37, या तंत्रिका स्टेम सेल (एनएससी), 38, वयस्क परिधीय रक्त कोशिकाओं से सीधे उत्पन्न करते हैं।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
मानव परिधीय रक्त कोशिकाओं mononuclear से एकता मुक्त प्रेरित pluripotent स्टेम कोशिकाओं की पीढ़ी episomal वैक्टर का उपयोग
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter