Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Generasjon Integrerings--frie Utførte Pluripotent stamceller fra menneskelige perifere mononukleære blodceller Bruke episomale vektorer

doi: 10.3791/55091 Published: January 1, 2017

Abstract

Indusert Pluripotent stamceller (iPSCs) holder store løftet for sykdom modellering og regenerativ behandling. Vi har tidligere rapportert ved bruk av episomale vektorer (EV) for å generere integrasjonsfrie iPSCs fra perifert blod mononukleære celler (MNC) PB. De episomale vektorer som anvendes er DNA-plasmider innlemmet med oriP og EBNA1 elementer fra Epstein-Barr (EB) virus, som gir mulighet for replikasjon og langvarig bibeholdelse av plasmider i pattedyrceller, respektivt. Med ytterligere optimalisering, kan tusenvis av IPSC kolonier oppnås fra 1 ml av perifert blod. To viktige faktorer for å oppnå høy effektivitet omprogrammering er: 1) bruk av et 2A "selv-spaltning" peptid for å koble OCT4 og SOX2, og dermed oppnå ekvimolar ekspresjon av de to faktorer; 2) bruk av to vektorer for å uttrykke MYC og KLF4 individuelt. Her beskriver vi en steg-for-steg-protokollen for å generere integrering fritt iPSC'er fra voksne perifere blodprøver. De genererte iPSCs er integrering fritt som rest episomale plasmider er umulig å oppdage etter fem passasjer. Selv om omprogrammering effektivitet er sammenlignbar med Sendai-virus (SV) vektorer, EV plasmider er betydelig mer økonomisk enn de kommersielt tilgjengelige SV vektorer. Denne rimelige EV omprogrammering system har potensial for kliniske applikasjoner i regenerativ medisin og gir en tilnærming for direkte omprogrammering av PB MNCs til integrering fritt stamceller, nevrale stamceller, osv.

Introduction

Etter tvunget uttrykk for flere transkripsjonsfaktorer (Dvs. OCT4, SOX2, MYC og KLF4), kan somatiske celler omprogrammeres til indusert Pluripotent stamceller (iPSCs), som holder store løftet for applikasjoner i regenerativ medisin og celle replacement therapy 1-3. Hittil har ulike metoder blitt utviklet for å øke suksessraten for omprogrammering 4-7. Virale vektorer-indusert omprogrammering er mye brukt for effektiv generering av iPSCs, fordi viral integrering fører til et høyt nivå, stabil ekspresjon av de reprogrammerings-faktorer. Imidlertid kan permanent integrering av vektor DNA i cellegenomet indusere insertional mutagenese 5. I tillegg kan utilstrekkelig inaktivering av reprogrammerings faktorer forstyrrer iPSCs differensiering 8. Som sådan, er bruken av iPSCs uten integrering av reprogrammerings faktorer avgjørende, spesielt for bruk i celleterapi anvendelser.

9. Den oriP element fremmer plasmid replikasjon i pattedyrceller, mens den EBNA1 element platformer den oriP-inneholdende plasmid-DNA til kromosomalt DNA som gjør det mulig for oppdeling av episom under delingen av vertscellen. I forhold til andre integrasjonsfrie tilnærminger, inkludert Sendai Virus (SV) og RNA transfeksjon, elbiler har flere fordeler 5,6,10. Som plasmid DNA, kan elbiler lett produsert og endret i huset, noe som gjør dem svært rimelig. I tillegg omprogrammering med EV er en mindre arbeidskrevende prosess, siden en enkelt transfeksjon med el-biler er tilstrekkelig for IPSC generasjon, mens flere RNA-transfeksjoner er nødvendig for vellykket omprogrammering.

Dermal fibroblaster er blitt anvendt i mange studier omprogrammering. Imidlertid er huden biopsi ikke bare en invasiv og smertefull prosess, men også tidkrevende for å utvide cellene til tilstrekkelige mengder for omprogrammering. Av større interesse er det hudceller hos voksne givere ofte vært utsatt for langvarig UV-lysstråling, som kan føre til mutasjoner assosiert med tumorer, og dermed begrense søknadene for iPSCs avledet fra hudfibroblaster 11,12. Nylig har det blitt rapportert at normale menneskelige hudceller samle somatiske mutasjoner og flere kreftgener, inkludert de fleste av de viktigste driverne av kutane plateepitelkarsinom, er under sterk positiv seleksjon 13.

I motsetning til hudfibroblaster, perifert blod (PB) -celler er en foretrukket kilde for celler for omprogrammering fordi 1) blodlegemer kan lett oppnås ved en minimalt invasiv prosess, 2) perifere blodceller er avkommet av hematopoetiske stamcellerbosatt i benmargen, og dermed beskyttet mot skadelig stråling. Perifere blod mononukleære celler (MNC) PB kan samles i en time fra buffy coat-lag etter en enkel sentrifugering ved hjelp av Ficoll-Hypaque (1,077 g / ml). De oppnådde PB MNCer er sammensatt av lymfocytter, monocytter og noen Hematopoetiske progenitorceller (HPCS) 14. Selv om humane T-lymfocytter er en av de store celletyper i PB, modne T-celler inneholder rearrangementer av T-cellereseptoren (TCR) gener og mangler et intakt genom og dermed begrense deres muligheter for anvendelser 15,16. Imidlertid kan foryngelse av T-celler via IPSC generasjon har potensielle bruksområder i kimære antigen reseptor (CAR) T-cellen terapi 17-19. Til sammenligning HPCS har en intakt genom og er lett reprogrammable. Selv om bare 0,01 til 0,1% celler i perifer sirkulasjon er HPCS, kan disse cellene bli utvidet ex vivo i erytroide medium som favoriserer spredning av erythrOID stamceller 14.

I vår forrige undersøkelse, brukte vi den faktoren BCL-XL i tillegg til de Yamanaka faktorer (OCT4, SOX2, MYC og KLF4), noe som resulterte i en 10x økning i PB omprogrammering effektivitet 20. BCL-XL, også kjent som BCL2L1, er en potent hemmer av celledød, ved å inhibere aktivering av kaspaser 21,22. Men, kan BCL-XL også spille en viktig rolle i å opprettholde pluripotency 21,22. Nylig har vi ytterligere optimalisert vårt EV omprogrammering system ved separat å uttrykke MYC og KLF4 med to vektorer, noe som fører til en tilnærmet 100 ganger økning i effektivitet omprogrammering 23. Ved hjelp av denne metoden, omprogrammering effektivitet, definert ved koloni-nummer delt av startcellenummer ved transfeksjon, er 0,2 til 0,5% fra friske donorer. Som følger, beskriver vi den detaljerte eksperimentelle prosedyren for å generere integrering fritt iPSCs fra PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle de menneskelige PB prøver ble innhentet fra anonyme voksne donorer uten identifikasjon informasjon fra Tianjin Blood Center med godkjenning av den lokale forskningsetisk komité.

1. Endo-free Plasmid Forberedelse

  1. Bruk en kommersiell Plasmid Rensing Maxi Kit for å trekke episomale vektorer fra E. coli i henhold til produsentens protokoll. For det avsluttende trinn, til erstatning TE-buffer med endotoksin-fri sterilt vann oppløse den DNA-pelleten.
  2. Mål-DNA-konsentrasjon ved anvendelse av en kommersiell UV / Vis spektrofotometer. Konsentrasjonen er vanligvis større enn 1 ug / ul, med A260 / A280 og A260 / A230-forhold større enn 1,8 og 2,0, respektivt.

2. Kultur Media

  1. Forbered erytroid medium: hematopoetisk stamcelle Ekspansjons medium supplert med 100 ng / ml humant stamcellefaktor (SCF), 10 ng / ml interleukin-3 (IL3), 2 U / mL erytropoietin (EPO), 20 ng / ml insulin vekstfaktor-1 (IGF1), 1 uM deksametason og 0,2 mM 1-tioglycerol. Filtrer sterilisere med en 0,22 mikrometer sprøyte filter. Erytropoide medium kan lagres ved 4 ° C i opptil en måned.
  2. Forbered IPSC Medium: DMEM / F12-medium (Dulbeccos modifiserte Eagle-medium / Nutrient Blanding F-12) supplert med 1 x L-glutamin, 1x penicillin / streptomycin, 1 x ikke-essensielle aminosyrer løsning, 50 ng / ml fibroblast vekstfaktor 2 (FGF2 ), 1x Insulin-Transferrin-Selenite supplement (ITS), og 50 mg / ml askorbinsyre. Filtrer sterilisere med en 0,22 mikrometer sprøyte filter. IPSC medium kan lagres ved 4 ° C i opptil en måned.
  3. Forbered MEF medium: Dulbeccos modifiserte Eagle-medium (DMEM; høy glukose) supplert med 1x penicillin / streptomycin og 10% føtalt bovint serum (FBS). Filtrer sterilisere med en 0,22 mikrometer sprøyte filter. MEF medium kan lagres ved 4 ° C i opptil en måned eller fersk legge 1x L-glutamin før bruk.
  4. PRepare IPSC nedfrysing medium (2x): Oppløs 5 g D-trehalose i 30 ml sterilt vann i et 37 ° C vannbad. Bringe temperaturen til 4 ° C og tilsett 10 ml FBS og 10 ml dimetylsulfoksid (DMSO). Filtrer sterilisere med en 0,22 mikrometer sprøyte filter. Oppbevar ved 4 ° C i inntil 3 måneder 24.

3. Isolering av perifere mononukleære blodceller (PB MNCs)

  1. Kombiner 10 ml frisk PB prøven og 10 ml PBS-buffer i et 50 ml rør og bland godt. Bringe PBS til romtemperatur eller 37 ° C før bruk.
    MERK: Omtrent 1 - 3 x 10 6 MNCs (ferske eller cryopreserved) kan fås fra 1 ml PB. Etter 6 d av kultur, regner med å ha 0,5 - 1 x 10 6 celler totalt på grunn av dødsfallet til modne celler under kultur. Omtrent 1 x 10 7 celler kan fås fra 10 ml frisk PB.
  2. Tilsett 10 ml Ficoll til bunnen av røret ved hjelp av en 10 ml sprøyte festet til en lang nål. dette process bør skje langsomt for å sikre at Ficoll-lag ikke blander seg med PB.
  3. Sentrifuger ved 400 xg i 30 minutter ved en lav akselerasjon og retardasjon hastighet. Etter sentrifugering PB MNCer er i det hvite sjiktet (buffy coat) plassert mellom PB plasmaet og Ficoll.
  4. Sakte aspirer ~ 10 ml PB plasma uten å forstyrre Buffy Coat lag. høste det hvite laget ved hjelp av en 1 ml pipette tips til en ny 50 ml tube nøye. Det totale volumet av oppsamlede celler fra det hvite sjiktet vil være mellom 3 - 6 ml.
  5. Legg PBS for å bringe det totale volum til 30 ml og blandes godt med en 10 ml pipette. Sentrifuger ved 400 xg i 10 min.
  6. Fjern supernatanten og resuspender cellepelleten i 20 ml dyrkningsmedium (dvs. Iscoves modifiserte Dulbeccos medium, IMDM) og bland godt. Sentrifuger ved 400 xg i 10 minutter for å fjerne mesteparten av blodplatene.
  7. Fjern supernatanten og cellepelleten suspenderes i 1 - 2 ml IMDM. Celler kan anvendes feller umiddelbar kultur, eller frosset ned for senere bruk. For nedfrysing, legge til en lik mengde cryopreservation medium. Delmengde celler i cryovials (0,5 - 1 ml per hetteglass) og overføre cryovials til en -80 ° C fryser umiddelbart. PB MNCer kan lagres i -80 ° C fryser i flere uker eller overføres til en flytende nitrogen tank for langtidslagring.
    MERK: Ved tining av frosne celler, selv om våre nedfrysing medium kan opprettholde celle levedyktighet, kan celletallet reduseres på grunn av celledød under tineprosessen. Det anbefales at en - 10 x 10 7 celler vil bli frosset i hvert hetteglass.

4. Utvidelse av PB MNCs i erytroide Medium

  1. Forbered 5 mL IMDM medium i en 15 ml tube. Raskt tine den frosne PB MNCs i en 37 ° C vannbad og deretter overføre dem til røret med IMDM medium.
    MERK: Tiden i vannbad avhenger av volumet av cryopreserved celler og kryoampulle used. Vanligvis vil den frosne celle-tine i løpet av 1 min.
  2. Sentrifuger ved 400 xg i 5 - 10 min. Fjern supernatanten og cellepelleten suspenderes i erytroide medium. Tilsett 10 mL trypanblått løsning til 10 mL cellesuspensjon og bland godt. Trypanblått flekker døde celler i 1-3 min. Telle celler i mikroskop ved hjelp av en hemocytometer.
  3. Kultur PB MNCer i et ikke-vevskultur (ikke-TC) ble behandlet 6-brønns plate med 2 ml medium pr brønn, ved en celletetthet på ~ 5 x 10 6 celler / ml, ved 37 ° C i en 5% CO2 fuktet inkubator.
  4. Tilsett 1 ml friskt medium erytropoide direkte til hver brønn uten å endre mediet ved D 3 og 5.
  5. På D 6, høste PB MNCs for nucleofection.

5. PB MNC nucleofection og Omprogrammering

  1. Én dag før nucleofection, pre-coat TC-behandlede 6-brønns plater med 0,1% gelatin ved 37 ° C i 20 min. Tine inaktivert Murine Embryonic Fibroblast (MEF) mater celler i en 37 ° C vannbad og umiddelbart overføre dem til en 15 ml tube inneholder 5 ml MEF medium.
  2. Sentrifuger ved 400 xg i 5 minutter og fjerne supernatanten. Fjern gelatinen fra 6-brønns plate, cellepelleten suspenderes i MEF medium, og overføre dem til den gelatin forbehandlet 6-brønns plate. I hver brønn, frø 2 - 4 x 10 5 inaktiv MEF celler suspendert i 2 ml MEF medium.
  3. Culture MEF feeder-celler ved 37 ° C i en 5% CO2 fuktet inkubator.
  4. På dagen for nucleofection, aspirer MEF medium og erstatte den med en ml erythroide medium. Pre-likevekt kulturplaten for 10 - 30 minutter ved 37 ° C i en 5% CO2 fuktet inkubator.
  5. Tilsett 2 ug pEV-OCT4-2A-SOX2, 1 ug pEV-MYC, 1 ug pEV-KLF4, og 0,5 ug pEV-BCL-XL i et 1,5 ml sterilt Eppendorf-rør. Oppvarm rør ved 50 ° C i 5 min for å unngå forurensning, og avkjøles til romtemperatur. Legg til57 mL nucleofection buffer og 13 mL supplement.
  6. Harvest-2 x 10 6 dyrkede PB MNCs til en 5 ml tube av sentrifugering ved 200 xg for 7 min. Fjern supernatanten og legge plasmidet og nucleofection buffer mix til cellen pellet. Bland godt ved å dra fingeren røret med fingeren.
    MERK: Så lite som 2 x 10 5 celler kan anvendes for nucleofection, men en lavere omprogrammering effektivitet bør forventes også.
  7. Overfør DNA og cellesuspensjonen til kuvetten i settet og hetten kyvetten. Velg Program U-008 på nucleofection enheten. Sett kyvetten i holderen og trykk OK for å bruke U-008 program.
  8. Ta kyvetten ut av holderen, tilsett 0,5 til 1 ml forvarmet erytropoide medium i hver kyvette, og overføre celler til pre-likevekt MEF plate umiddelbart. På grunn av den høye virkningsgrad og omprogrammering donor variasjon, såing forskjellig antall celler som strekker seg fra 1-10 x 10 5 celler per vel er svært oppmuntret.
  9. Overføre platen til en hypoksi kammer, og skylle kammeret med en blandet gass bestående av 92% N2, 5% CO2 og 3% O 2, i 1 - 2 minutter med en hastighet på 20 l / min. Etter forsegling av kammeret, kulturen av cellene ved 37 ° C.
  10. På D 2 post-nucleofection, tilsett 2 ml IPSC medium direkte til hver brønn.
  11. På D 4 post-nucleofection, fjerne 3 ml medium og tilsett 2 ml frisk IPSC medium. På D 4 post-nucleofection, vil de fleste av levende celler har festet til materen laget.
  12. Etter D 6 etter nucleofection, endre medium hver 2 d ved å la 500 mL brukt medium og tilsette 2 ml frisk E8 medium tilsatt 0,25 mM natriumbutyrat til D 14-18.
    MERK: Tilleggs feeder-celler kan tilsettes i kulturbrønnene når han påpeker at den mater cellene er blitt løsrevet. Etter opptining MEFs (se avsnitt 5.1 og 5.2), cellepelleten suspenderes i et lite volum av E8 medium (dvs. ~ 0.2 ml av en brønn i en 6-brønn plate) og deretter legge MEFs til kulturbrønnene. Omtrent 2% FBS kan tilsettes for å øke cellefesting. Alternativt kan MEF-kondisjonert medium også anvendes, men det er mer arbeidskrevende.

6. Utvidelse av iPSCs

MERK: I de fleste tilfeller et stort antall IPSC kolonier vises på D 8-10 post nucleofection. Etter D 14, store IPSC kolonier er vanligvis klar for plukking.

  1. Før plukke kolonier, tilsett 500 mL E8 medium supplert med ROCK hemmer Y27632 (10 mm), i en brønn i en mater eller Matrigel belagt 24-brønns plate. Bruk en 10 eller 20 mL pipette til å klø og plukke kolonier under mikroskopet. Overfør stykker av hver koloni til brønnene inneholdende kulturmediet.
    MERK: Konsentrasjonen av Matrigel forskjellig fra en batch til en annen. Vanligvis bruker vi 1: 100 fortynning av Matrigel.
    1. For å unngå krysskontaminering, plukkkolonier som er store og godt atskilt fra andre. Kultur iPSCs ved 37 ° C i en 5% CO 2 fuktet inkubator.
      NB: Det bør være oppmerksom på at IPSC populasjonen kan være polyklonale skyldes cellemigrering når det er flere titalls eller hundrevis av kolonier i hver brønn i en 6-brønns plate.
  2. Ikke endre medium for første 2 d. ROCK hemmer kan fremme overlevelse av små kolonier 25.
  3. Fra D-2 og videre, endrer medium hver dag ved å fjerne brukte medium og tilsetning av 500 ul friskt E8 medium i hver brønn.
  4. Omtrent en uke senere, når koloniene er store nok, fjern mediet og behandle cellene med 300 ul celle løsgjøring løsning (0,5 mM EDTA i PBS) ved 37 ° C i 1 - 3 min. Fjern cellen avløsning løsning og legge E8 medium som inneholder ROCK inhibitor (10 mm) for å suspendere iPSCs. Ikke bryte ned kolonier i enkeltceller, som kan føre til overdreven celledød. De celleklumper med 5-50 celles er egnet for IPSC passasje.
  5. Overføring 50 - 100% av cellesuspensjon til hver brønn i en 12- eller 6-brønns plate som har blitt forbelagt med brett eller Matrigel.
  6. For langsiktig kultur i Matrigel-belagte plater (se merknad i 6.1), endre medium hver dag. Når cellesammenflytning når 40 - 60%, behandle cellene med 1 ml celle løsgjøring oppløsning (0,5 mM EDTA i PBS) ved 37 ° C i ~ 3 minutter. Når koloniene begynner å krølle seg, fjerne celle avløsning løsning og legge E8 medium som inneholder ROCK inhibitor (10 mm) å suspendere iPSCs. Passage celler med en splitting faktor på 4 - 8. ROCK hemmer skal legges ved passering celler til å øke overlevelse, og fjernet en d senere for å hindre differensiering.
  7. For å fryse ned iPSCs, behandle celler med celle avløsning løsning ved 37 ° C i 3-5 minutter i henhold til produsentens protokoll. Når IPSC kolonier begynner å krølle seg, aspirer buffer og legge 0,5 til 1 ml E8 medium.
  8. <li> til et likt volum av nedfrysing medium til cellesuspensjonen og bland godt. Frosset iPSCs kan lagres i en -80 ° C fryser i flere uker eller i flytende nitrogen for langtidslagring.

7. Valg av iPSCs uten Residual episomale Plasmider

  1. Etter passering 5, slakte iPSCs og trekke genomisk DNA.
    MERK: Vanligvis etter 5 passasjer av kultur, rest episomale plasmider er umulig å oppdage. Således nesten alle de IPSC kolonier på passeringer over 5 (dvs. passasje 10) mangler rest episomale plasmider.
  2. Bruke genomisk DNA fra ikke-transfekterte PB MNCer som en negativ kontroll. Legg 1,6 pg pEV-OCT4-2A-SOX2 plasmid i en mikrogram negativ kontroll DNA for å etterligne celler med en kopi av pEV plasmid per celle.
  3. Legg til 9 mL PCR-grade vann inkludert 100 ng genomisk DNA og 1 ul spesifikke primere (10 mikrometer hver av forover og bakover primere) i 10 mL Høy Fidelity PCR Master Mix. Normalisere amount av DNA ved GAPDH. Bruk følgende primere for PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Inkuber reaksjonsblandingen ved 98 ° C i 60 s; etterfulgt av 98 ° C i 10 s, 60 ° C i 30 s, og 72 ° C i 30 sek. Etter 30 sykluser; forlenge reaksjonsblandingen ved 72 ° C i 5 minutter.
  5. Belastning 5 ul av PCR-produkter i hver brønn av en 1% agarosegel. Kjør gel for 20-30 minutter ved 100 V. Velg IPSC kloner med ikke målbare band for EBNA1 og WPRE for ytterligere kultur og nedstrøms analyse.

8. flowcytometrisystemer

  1. Feie iPSCs ved å behandle dem med Accutase ved 37 ° C i 3 - 5 minutter for å oppnå en enkel cellesuspensjon. Tilsett 1 mL PE-konjugert anti-TRA-1-60 eller eFluor 570-konjugert anti-isotypisk SSEA4 eller antistoff til 100 ul av cellesuspensjonen (1 - 5 x 10 5 celler) I 5 ml rør. Inkuber rørene i et mørkt sted ved romtemperatur i 20 min.
  2. Etter beising i 20 minutter ved RT, tilsett 2 ml PBS og sentrifuger ved 400 xg i 5 minutter. Resuspender celler i 300 ul PBS for fluorescens-aktivert cellesortering (FACS) analyse ved anvendelse av en flowcytometri celle analysator. 23,26

9. Confocal Imaging

  1. Seed iPSCs i Matrigel belagt kammer lysbilder.
  2. Etter 3-4 d av kultur, fjerne vekstmediet og fikse med 4% paraformaldehyde (PFA) ved RT i 30 min. Vask cellene to ganger med PBS.
    Merk: PFA er giftig og skadelig.
  3. Behandle cellene med 0,1% Triton X-100 i PBS (PBS-T) ved RT i 30 min. Vask cellene to ganger med PBS.
  4. Blokkere celler med blokkerende buffer (5% geiteserum i PBS, v: v) ved romtemperatur i 1 time.
  5. Under blokkeringstrinn, fortynne det primære antistoff (100x) i blokkeringsbuffer.
    MERK: antistoffer informasjonen er oppført i tabellform Materiale / Utstyr.
  6. Inkuber cellene med fortynnet antistoff ved 4 ° CO / N.
  7. Vask to ganger med PBS-T i 15 min, etterfulgt av to ganger med PBS i 15 min.
  8. Inkuber cellene med en fortynnet fluorofor-konjugert sekundært antistoff ved romtemperatur i 2 timer.
  9. Vask cellene to ganger med PBS-T i 15 min, etterfulgt av to ganger med PBS i 15 min.
  10. Flekk kjernen med DAPI (1 ug / mL) i PBS ved romtemperatur i 10 min.
  11. Vask cellene to ganger med PBS i 15 min.
  12. Ta bilder med en konfokalmikroskop. 23,27

10. Teratom analyse

Avling 1 x 10 6 iPSCs med celle løsgjøring løsning (0,5 mM EDTA i PBS) og resuspender cellene i 200 pl DMEM / F12 fortynnet (1: 1) matrigel.

  1. Subkutant injisere cellene i den bakre haunch av NOD / SCID immunsvikt mus.
  2. På 8-12 uke etter IPSC injeksjon, dissekere og fikse teratomas i 10% formalin. 28
  3. Etter microsectioning ogfarging med hematoxylin og eosin (H & E), analysere prøvene. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ved hjelp av denne protokollen, kan vi skaffe hundrevis av kolonier fra 1 x 10 5 nucleofected PB MNCs (figur 1A og 1B). Den omprogrammering effektivitet er ca 0,2 til 0,5% og koloniene uttrykker pluripotency markører (Tall 1C og 1D). iPSCs generert ved hjelp av den beskrevne protokollen er integrering fritt og har evnen til å danne teratom komponere de 3 bakterie lag (Tall 1E og 1F).

Figur 1
Figur 1: Generering av Integrasjonsfritt iPSCs fra perifere mononukleære blodceller. (A): En skjematisk av protokollen for omprogrammering av perifere blodceller. (B): AP flekker i bulk (til venstre) og en typisk ESC-lignende IPSC koloni (til høyre)60; 14 d etter PB MNCs nucleofection. Skala: 100 mikrometer. (C): Representative FACS diagrammer av iPSCs på passering 5 uttrykker TRA-1-60 eller SSEA4. (D): Representative confocal bilder av IPSC kolonier uttrykker Nanog og OCT4. Skala: 100 mikrometer. (E): Representant bilde av det totale bildet og H & E farging av teratom består alle tre bakterie lag. Skala: 100 mikrometer. (F): Kopier antall rest EV plasmider i iPSCs etter fem passasjer. Spesifikke primere for EBNA1 og WPRE ble anvendt for å amplifisere episomale vektorer. GAPDH ble anvendt som en DNA-lastekontroll. UD, umulig å oppdage. Den positive kjørefelt indikerer ett eksemplar kontroll. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Anskaffelse av blodprøver fra friske donorer eller pasienter er praktisk og ikke-invasiv, noe som gjør det til et attraktivt celle kilde for grunnforskning og klinisk celleterapi. Her har vi beskrevet en protokoll for svært effektiv generasjon av integrasjonsfritt iPSCs fra perifere blodprøver. Dette reproduserbar og rimelig tilnærming bør gagne IPSC feltet.

Vi har rapportert at det er to viktige faktorer ansvarlig for svært effektiv PB omprogrammering 30. En er ekvimolar ekspresjon av OCT4 og SOX2 ved hjelp av en linker 2A 31. For å oppnå dette, er pEV-OCT4-2A-SOX2 brukt i denne protokollen. Den andre er bruk av to plasmider pEV-myc og pEV-KLF4 for å uttrykke MYC og KLF4 i stedet for pEV-MYC-2A-KLF4 som vi tidligere har benyttet 30. Den tilsynelatende enkel endring fører til en tilnærmet 100X økning i PB omprogrammering effektivitet, som i stor grad skyldes en gradvis og større økning i MYC: KLF4-forholdet i løpet av prosessen.

Flere punkter bør vurderes for å oppnå høy effektivitet IPSC generasjon fra PB. PB MNCs dyrkes for ~ 1 uke i erytroide medium, som fremmer spredning og utvidelse av erytroide stamceller og øker dermed omprogrammering effektivitet 20. Imidlertid, for noen prøver, særlig for blodceller fra pasienter med leukemi, celler overlever dårlig når de dyrkes i erytroide medium. I dette tilfellet ville det være nyttig å senke dyrknings tid. Det er også oppmuntret til bruk 1 - 2 ug pmaxGFP vektor for å verifisere nucleofection effektivitet, som bør være større enn 50%. I tillegg, er plasmidet kvalitet viktig. Det anbefales å bruke plasmider uten endotoksin forurensning (dvs. ved hjelp av Endo-free Plasmid Maxi Kit for å trekke plasmider). Dårlig plasmid kvalitet kan føre til betydelig celledød og således redusere omprogrammering effektivitet. Vi og andre har vist at hypoksi kaes IPSC generasjon 14,32. Vi spyle den hypoksi kammer med en blandet gass bestående av 92% N2, 5% CO2 og 3% O 2. Hvis normoxia brukes i stedet, kan en opptil 80% reduksjon i omprogrammering effektivitet observeres. Når omprogrammering er fullført, kan iPSCs bli dyrket i et vanlig fuktig 5% CO2 inkubator. Når du skifter medium, er det praktisk å la en liten mengde brukt medium (dvs. 500 mL per brønn i en 6-brønns plate), og deretter legge til nytt medium. Endre medium bare annenhver dag under omprogrammering, som altfor ofte medium endringer kan redusere iPSCs generasjon 33.

Den nye protokollen vi har utviklet har nådd et høyt nivå PB omprogrammering som er sammenlignbar med den SV omprogrammering system. EV-systemet har flere åpenbare fordeler. For en, er EV rimeligere enn SV. EV Systemet kan også endres ytterligere ved å inkludere flere faktorer eller annen sammenslutningsjoner av flere faktorer, mens SVS vektorer er et kommersielt produkt som ikke kan endres av etterforskere. Vår nåværende protokollen inkluderer bruk av MEF mater celler og animalske produkter, som kan begrense de kliniske applikasjoner, men kan enkelt fjernes ved ytterligere protokoll utvikling 34,35.

iPSCs generert med dette systemet kan brukes ikke bare for sykdom modellering og narkotika screening, men også for klinisk behandling, fordi GMP-nivå EV plasmider kan enkelt genereres og ingen iPSCs med betydelig EV integrering har blitt identifisert. I kliniske anvendelser, pasient celler vanligvis havn en sykdomsfremkallende genet, som må rettes opp i iPSCs før differensiering i funksjonelle celler for terapi. En fersk rapport viser at EV omprogrammering systemet kan enkelt integreres med CRISPR / Cas9 systemet for å oppnå samtidig omprogrammering og genom redigering etter en enkel nucleofection 36. Dette er ennother fordel av EV over SV-systemet. Våre upubliserte data har vist at opptil 20% genom redigering effektivitet kan oppnås når snylter genom redigering på EV omprogrammering. Det er vårt håp at integrering av PB omprogrammering med CRISP / Cas9R genom redigering kan ha potensielle bruksområder i behandling av flere sykdommer som ellers er uhelbredelig i de kommende tiårene.

I sammendraget, bør vår forbedrede perifert blod celle omprogrammering protokoll være nyttig for et bredt spekter av etterforskere i grunnleggende forskning og kliniske applikasjoner. Denne effektive EV omprogrammering system kan også anvendes, etter modifikasjoner, for å generere integrasjons-fri stamceller (MSC) 37, eller neurale stamceller (NSC) 38, direkte fra voksne perifere blodceller uten å passere gjennom et IPSC trinn.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
Generasjon Integrerings--frie Utførte Pluripotent stamceller fra menneskelige perifere mononukleære blodceller Bruke episomale vektorer
Play Video
PDF DOI

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter