Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Het analyseren van gunstige effecten van voedingssupplementen op darmepitheel Barrier Functies tijdens de Experimental Colitis

doi: 10.3791/55095 Published: January 5, 2017

Summary

Huidige behandelingen van inflammatoire darmziekten (IBD) zijn gericht op het verlichten van de ziektesymptomen, maar kan ernstige bijwerkingen veroorzaken. Zo worden alternatieve strategieën onderzocht in dierlijke modellen colitis. Hier leggen we uit hoe de gunstige effecten van voedingssupplementen op de klinische IBD borden worden geanalyseerd in een dergelijk colitis model.

Abstract

Inflammatoire darmziekten (IBD), zoals de ziekte van Crohn en colitis ulcerosa zijn chronische recidiverende aandoeningen van de darmen. Ze veroorzaken ernstige problemen, zoals buikkrampen, bloederige diarree en gewichtsverlies, in getroffen personen. Helaas is er nog geen genezing, en behandelingen gericht alleen om de symptomen te verlichten. Huidige behandelingen omvatten anti-inflammatoire en immunosuppressieve geneesmiddelen die ernstige bijwerkingen kunnen veroorzaken. Dit staat in voor de zoektocht naar alternatieve behandeling opties, zoals voedingssupplementen, die geen bijwerkingen veroorzaken. Voordat de toepassing ervan in klinische studies, moeten dergelijke verbindingen grondig worden getest op effectiviteit en veiligheid in diermodellen. Een betrouwbare experimentele model is de dextransulfaatnatrium (DSS) model colitis bij muizen, die veel van de klinische symptomen van colitis ulcerosa bij mensen reproduceert. We hebben onlangs toegepast dit model om de gunstige effecten van een voedingssupplement met testenvitamine C en E, L-arginine, en ω3-meervoudig onverzadigde vetzuren (PUFA). We analyseerden verschillende parameters ziekte en vonden dat dit supplement kon oedeemvorming, weefselschade, leukocytinfiltratie, oxidatieve stress, en de productie van pro-inflammatoire cytokines te verbeteren, wat leidt tot een algemene verbetering van de ziekteactiviteit index. In dit artikel hebben we in detail de correcte toepassing van voedingssupplementen met de DSS colitis model in C57BL / 6 muizen, evenals hoe ziekteparameters zoals histologie, oxidatieve stress en inflammatie worden beoordeeld. Het analyseren van de gunstige effecten van verschillende voedingssupplementen kan dan uiteindelijk opent nieuwe mogelijkheden voor de ontwikkeling van alternatieve behandelingsstrategieën die IBD symptomen te verlichten en / of de fasen van remissie te verlengen zonder dat ernstige bijwerkingen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Colitis is een ontsteking van de dikke darm die diarree en abdominale pijn kan veroorzaken. Colitis kan acuut zijn, in respons op infectie of stress, of het kan ontwikkelen als een chronische ziekte, zoals bij ulceratieve colitis (UC), die behoort tot de groep van inflammatoire darmziekten (IBD). Hoewel de klinische tekenen van CU zijn goed beschreven, wordt de pathogenese nog steeds slecht begrepen 1. Het is algemeen aanvaard onder de experts dat UC is een multifactoriële aandoening, waarbij genetische mutaties en afwijkende immuunreacties speelt een belangrijke rol 2. Echter, omgevingsfactoren, zoals de stijl van leven en voeding, dragen ook bij aan de ontwikkeling van de ziekte en progressie 3.

Helaas, IBD is niet te genezen, maar er zijn veel behandelingen die gericht zijn klinische symptomen te verlichten. Huidige behandelingen omvatten anti- inflammatoire middelen, zoals sulfasalazine en corticosteroïden; immunosuppressiva, zoals azathioPrine; monoklonale antilichamen die capture pro-inflammatoire cytokinen, zoals tumornecrosefactor-α (TNF-α) of blok adhesiemoleculen, zoals integrines, overmatige leukocyt rekrutering verminderen; en inhibitoren die kinasen die pro-inflammatoire pathways, zoals Janus kinase (JAK) 4 activeren targeten. Niet alle patiënten reageren op alle behandelingen, dus therapeutische strategieën moeten worden geïndividualiseerd 5. Voorts zijn de meeste van deze therapeutische geneesmiddelen het metabolisme en immuunreacties, wat vaak ernstige bijwerkingen. Daarom zijn alternatieve behandelingen onderzocht.

Alternatieve behandelingen omvatten probiotica en voedingssupplementen, die in diermodellen en klinische studies hebben toegepast met wisselend succes 6,7. We hebben onlangs gevonden dat de toepassing van andere enkelvoudige voedingssupplementen, zoals anti-oxidatieve vitaminen of ω3-poly-onverzadigde vetzuren (PUFAS), inferieur is aan de toepassing van een combinatie van dergelijke supplementen bij het verlichten colitis en cardiovasculaire ziektesymptomen 8,9. Deze studies werden uitgevoerd bij muizen, zodat klinische studies worden uitgevoerd bij mensen om te bepalen of deze bevindingen ook gelden voor de mens is. Voordat klinische studies worden gestart, moet de effectiviteit en veiligheid van nieuwe behandelingsmogelijkheden geëvalueerd worden in diermodellen.

IBD is de dextransulfaatnatrium (DSS) model op grote schaal gebruikt om de mechanismen van de ontwikkeling van de ziekte en de gunstige effecten van drugs en voedingssupplementen 6,10 bestuderen. In de meeste studies werd slechts een acute ziekte gedurende een periode van zeven dagen geïnduceerd; Niettemin, de klinische symptomen waargenomen in deze dieren sterk lijken op die waargenomen bij IBD patiënten (dwz bloederige diarree, gewichtsverlies, epitheliale stoornissen en immuun infiltratie) 10. DSS induceert erosies in de mucosa,waardoor barrière dysfunctie en verhoogde intestinale epitheliale permeabiliteit 11. Het exacte mechanisme blijft onbekend. Echter, een studie suggereert dat DSS interageert met middellange ketenlengte vetzuren tot nano-lipocomplexes die kunnen epitheelcellen voeren en veroorzaken inflammatoire signaalroutes 12 zijn gevormd. In dit artikel beschrijven we in detail hoe colitis wordt geïnduceerd bij muizen en hoe voedingssupplementen via een sonde worden toegepast om een ​​constante dosering van elk dier te garanderen geanalyseerd en hoe de effecten van dergelijke supplementen op verschillende colitis onderzocht.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle dierproeven werden goedgekeurd door de Institutional Animal Care en gebruik Comite van Cinvestav.

1. Bereiding van DSS Drinkwater en de inductie van colitis

  1. Bereid een 3,5% w v dextransulfaat natrium (DSS) oplossing in geautoclaveerd drinkwater /. DSS lost gemakkelijk en het is niet nodig om de uiteindelijke oplossing te filteren.
    LET OP: 7 dagen van de DSS-behandeling induceert ernstige colitis. Als het induceren van milde colitis, 3 - zijn 4 dagen van de behandeling aanbevolen. Zolang de DSS drinkwater helder blijft, is het niet nodig om het water te verversen. Als het echter troebel wordt, moet worden vervangen.
  2. Noteer de basislijn gewicht van mannelijke muizen. Waarborgen dat zij 8-12 weken en binnen een bereik van 21 - 25 g lichaamsgewicht.
    NB: De juiste DSS concentratie moet in elk laboratorium worden geoptimaliseerd. De resultaten kunnen sterk variëren, afhankelijk van de huisvesting. Concentraties tussen 2,5-5% worden gewoonlijk weergegeven sterke c inducerenolitis in C57BL / 6J-muizen WT 10. DSS van verschillende bedrijven en de verschillende percelen moeten worden getest, zoals resultaten kunnen ook variëren met verschillende bronnen van DSS.
  3. Zorg voor water ad libitum en te vervangen door verse 3,5% DSS water indien nodig.

2. De toepassing van voedingssupplementen via een maagsonde

  1. Bereid een "feedable" oplossing van de gewenste voedingssupplementen in een geschikt oplosmiddel. Voor dit onderzoek gebruikten we een mengsel dat 200 mg / kg L-arginine, 83 mg / kg vitamine C, 46 mg / kg vitamine E, 77 mg / kg eicosapentaeenzuur (EPA) en 115 mg / kg docosahexaeenzuur (DHA ) in een 1: 1 oplossing van water en saffloerolie.
  2. Vul een 1 ml spuit verbonden met een sondenaald (15 G x 50 mm) met het voedingssupplement mengsel. Neem de buitenkant van de sondenaald naar elke verbinding buiten de naald te verwijderen en de juiste dosering toepassing te garanderen.
  3. Restrain de muis door grijpen de basis van de staart metanderzijds door een huidplooi stevig vastgrijpen aan de achterkant van de nek met de duim en wijsvinger van de andere hand. Plaats de staart tussen de ringvinger en de basis van de duim van dezelfde hand die de hals bezit.
  4. Met behoud van de muis in een rechtopstaande positie, steek de naald in de linker kant van de mond van het dier en volg het dak van de mond naar de slokdarm te lokaliseren. Als er geen weerstand wordt ondervonden, vooraf de naald in de richting van de maag.
    LET OP: Controleer of het dier goed ademhalen voordat u verder gaat.
  5. Dien het mengsel langzaam, verwijder de buis door langzaam te trekken uit de spuit, en laat de muisknop los. Toepassen voedingssupplementen eenmaal daags sondevoeding tijdens het experiment colitis.

3. Bepaling van de Disease Activity Index

OPMERKING: De ziekteactiviteit index is de combinatie van de scores voor gewichtsverlies, perianale bloeden en ontlasting, die zijn obgehandhaafd dagelijks 13.

  1. Meet het lichaamsgewicht dagelijks en een score van 0 toewijzen 4 volgens het gewichtsverlies percentage (0: 0%, 1: 1-5%, 2: 5-10%, 3: 10 - 20%, en 4> 20 %).
    LET OP: Lichaamsgewicht verlies wordt bepaald door het berekenen van het verschil in percentage tussen de basale gewicht vóór de inductie van DSS-colitis en de werkelijke gewicht.
  2. Om het niveau van perianale bloeden te bepalen, het verzamelen van een frisse krukje monster en gebruik de meegeleverde applicators om een ​​dunne vlek toe te passen op een dia van een guaiacmethode fecal occult bloed test kit. Gebruik een nieuw applicator voor elk monster.
    1. Sluit de klep aan de voorzijde en het raam open aan de achterzijde van de schuif. Breng twee druppels van de ontwikkelaar oplossing voor het terug op het monster locatie.
    2. Lees de resultaten na 30 s. Elk spoor van de blauwe kleur is positief voor occult bloed. Wijs een score van 0 tot 4 (0: geen, 0,5-2,5: positieve guaiacmethode fecal occult bloedtest (afhankelijk van de signaalsterkte) en 3-4: gross bloeden).
      Opmerking: Als er bloed in de ontlasting zichtbaar is, heeft de guaiacmethode fecale occult bloed testen niet te worden uitgevoerd, en een score van 3, 3,5 of 4 is toegewezen, afhankelijk van de hoeveelheid zichtbare bloed.
  3. Bepaal de consistentie van de ontlasting door het observeren van een frisse ontlasting. Wijs een score van 0 tot 4 (0: normaal / vast, 0,5-2,5: pasteus kruk en 3-4: diarree).

4. Het bepalen van intestinale epitheliale permeabiliteit in Vivo van Evans Blue Assay

  1. Verdoven dieren door ze intraperitoneaal injecteren met een mengsel van ketamine (100 mg / kg lichaamsgewicht) en xylazine (13 mg / kg lichaamsgewicht) verdund in zoutoplossing (0,9% NaCl) en de diepte van de anesthesie bepalen door het bewaken van de kneep terugtrekking reflex.
  2. Plaats de verdoofde dier in liggende positie en uitvoeren van een laparotomie om de ingewanden bloot te leggen.
  3. Zoek de blindedarm en maak een kleine incisie in het proximale segment van de dikke darm eenscendens (idealiter direct naast de blindedarm).
  4. Plaats een voeding naald (G22) en zet deze met een ligatuur met behulp van een gemeenschappelijke zijden draad. Zorgvuldig flush overvloedige PBS door de buis te spoelen alle ontlasting van de dikke darm. Druppelen Evans blauwe oplossing (1,5% w / v in PBS) in de dikke darm tot aan de anus bereikt.
  5. Incubeer de Evans blauw gedurende 15 min. Spoel de kleurstof door het spoelen van de buis met een overvloed aan PBS totdat de perianale wash-out is duidelijk.
  6. Euthanaseren van de dieren door cervicale dislocatie.
  7. Accijnzen de dikke darm en spoel het opnieuw met een overvloed aan PBS. Spoel eenmaal met 1 ml 6 mM N -acetylcysteine in PBS één kleurstof vasthouden aan de dikke slijm elimineren.
  8. Snijd de dikke darm longitudinaal en spoel het nogmaals met PBS en 1 ml 6 mM N -acetylcysteine.
  9. Registreer het gewicht en lengte. De Evans blauwe kleurstof extraheren, plaatst de colon in 2 ml N, N-dimethylformamide gedurende de nacht bij kamertemperatuur onder zacht agitation. Meet de concentratie kleurstof spectrofotometrisch bij 610 nm.

5. Tissue Collection

  1. Verdoven dieren door ze intraperitoneaal injecteren met een mengsel van ketamine (100 mg / kg lichaamsgewicht) en xylazine (13 mg / kg lichaamsgewicht) verdund in zoutoplossing (0,9% NaCl) en de diepte van de anesthesie bepalen door het bewaken van de kneep terugtrekking reflex.
  2. Euthanaseren van de dieren door cervicale dislocatie.
  3. Leg de dieren in een liggende positie en uitvoeren van een laparotomie de buikholte bloot.
  4. Met een schaar, ontleden de gehele dikke darm en de lengte opnemen.
  5. Spoel de colon voorzichtig enkele malen met koud PBS om de ontlasting te verwijderen. Registreer het weefselgewicht en voor het volgende experimenten, zoals beschreven in stap 5,6-5,8.
  6. Voor RNA-isolatie en myeloperoxidase (MPO) assays, afgesneden van een geschikte grootte weefselmonster (100 mg is meestal voldoende), plaats deze in een buis, en SNAp invriezen in vloeibare stikstof. Bewaar de weefsels bij -80 ° C voor toekomstig gebruik.
  7. Voor immunofluorescentie kleuring en oxidatieve stress bepaling (zie hieronder), snijd een kleine colon monster (0,5-1 cm) en dompel in kleine aluminium cups gevuld met een optimale snijtemperatuur (OCT) verbinding. Plaats de beker op droog ijs en laat ze langzaam invriezen, om blaasvorming voorkomen. Bevroren weefselmonsters kunnen worden opgeslagen bij -80 ° C voor toekomstig gebruik.
  8. Voor Zwitserse rollen 14, opent de dikke darm in de lengte en zorgvuldig uitwerpselen te verwijderen met behulp van een tang. Rol het op, met het slijmvlies naar binnen, met behulp van fijne punt pincet of een dunne, ronde houten stok. plaats het voorzichtig in een inbedding cassette en ga verder met stap 6.1.
    OPMERKING: DSS induceert in het colon. Echter, schade verdeling varieert vanaf het proximale tot het distale colon met meeste schade meestal gezien in het distale colon en rectum. Zo adviseren we het analyseren van de histologie, hetzij in de distale colof Zwitserse rollen van de gehele dikke darm.

6. Analyse van Colon Histologie door hematoxyline-eosine kleuring

  1. tissue Voorbereiding
    1. Voor de histologische analyse ofwel dompel de Swiss roll of kleine stukken weefsel uit bepaalde colon gebieden van controle en behandelde muizen in 5 ml 10% formaldehyde gedurende 48 uur bij kamertemperatuur (RT) de juiste fixatie.
      Opmerking: Alle verdere stappen in stap 6 worden uitgevoerd bij kamertemperatuur uitgevoerd, tenzij anders aangegeven.
    2. Was ze met kraanwater gedurende 18 uur.
    3. Dehydrateren ze met 15 ml 70% ethanol gedurende 1 uur, 96% in 1 uur, en absolute ethanol gedurende 1 uur. Herhaal elke stap met verse alcohol alvorens over te gaan naar de volgende concentratie.
    4. Blijven de dehydratatie in een mengsel van 7,5 ml absolute ethanol en 7,5 ml absolute xyleen gedurende 1 uur. Eenmaal herhalen alvorens de monsters 15 ml absolute xyleen gedurende 1 uur. Herhaal deze stap een keer met verse xyleen.
    5. Inbedding Colon weefselmonsters in Paraffine
      1. Dompel de monsters in 50 ml vloeibare paraffine gedurende 17 uur. Herhaal deze stap een keer, maar voor slechts 3 uur.
      2. Dompel de monsters in blokjes (plastic, vierkante vorm, afmetingen: 22 x 22 x 22 mm) in 810 ml vloeibare paraffine.
      3. Laat de paraffine het colon weefselmonsters te stollen gedurende 24 uur bij kamertemperatuur.
    6. Snijden Tissue Cross-secties met behulp van een microtoom
      1. Snijd colon monsters met behulp van een microtoom volgens de instructies van de fabrikant, bij een dikte van 5 urn.
      2. Verzamel de bezuinigingen in een waterbad (1 L) met 0,3% gelatine. Dit voorkomt het vouwen van weefsel doorsneden. Recover het weefsel secties en monteer ze op glasplaatjes.
    7. Hematoxyline en eosine kleuring Tissue Doorsneden
      1. Deparaffinize de monsters gedurende 18 uur bij 60 ° C in een incubator. Hiervoor gebruikt u een glas sLiDE-rack met een handvat.
      2. Na deparaffineren, dompel de glaasjes in 70 ml absolute xyleen gedurende 5 minuten. Herhaal deze stap een keer met verse xyleen.
      3. Breng de monsters in 70 ml absolute alcohol gedurende 1 min. Herhaal deze stap een keer met verse alcohol.
      4. Incubeer de colon weefselmonsters in 70 ml ethanol 96% gedurende 1 min. Herhaal deze stap een keer met verse alcohol.
      5. Was de monsters in leidingwater tweemaal voor 2 s.
      6. Incubeer de weefsels in Harris hematoxyline gedurende 7 min.
      7. Was de monsters in leidingwater tweemaal voor 2 s.
      8. Incubeer de monsters in zure alcohol (70 ml ethanol 70% en 700 ul van 1 M zoutzuur) gedurende 7 s.
      9. Was de monsters in leidingwater tweemaal voor 2 s.
      10. Incubeer de weefselmonsters in 70 ml lithiumcarbonaat (1 g lithiumcarbonaat in 100 ml gedestilleerd water) gedurende 7 s.
      11. Was de monsters in leidingwater tweemaal voor 2 s.
      12. Incubeer de monsters in 70 ml ethanol 80% Gedurende 1 min.
      13. Breng de monsters in 70 ml Eosine-Y gedurende 15 s.
      14. Incubeer ze in 70 ml 96% ethanol gedurende 1 minuut. Herhaal deze stap een keer met verse alcohol.
      15. Incubeer de weefselmonsters in 70 ml absolute ethanol (ethylalcohol absoluut watervrij) gedurende 1 min. Herhaal deze stap een keer met verse alcohol.
      16. Incubeer de monsters in 70 ml van een mengsel van 35 ml absolute alcohol en 35 ml absolute xyleen gedurende 1 min.
      17. Breng de monsters in 70 ml absolute xyleen gedurende 1 min. Herhaal deze stap gedurende 5 minuten in 70 ml verse xyleen absolute.
      18. Voeg 80 ul van kunsthars om de dikke darm weefselmonsters, bedek ze met dekglaasjes, en laat ze drogen gedurende 24 uur bij kamertemperatuur. Tenslotte analyseren van de monsters met behulp bright-field microscopy 8.

    7. Analyseren Junction Composition door Immunofluorescentie

    1. Bereid het weefsel zoals beschreven in stap 5.7 en snij 8 urn dikke doorsnedenmet behulp van een cryostaat.
    2. Fix en doorlaatbaar colon doorsneden met 96% ethanol bij -20 ° C gedurende 20 min.
      Opmerking: Alle volgende incubaties dient bij kamertemperatuur uitgevoerd, tenzij anders vermeld, in een vochtige zwart blokje aan drogen en fluorochroom fading voorkomen.
    3. Lucht drogen monsters, en spoel ze 3 keer voor 5 minuten elk met 1x PBS
    4. Incubeer de monsters met blokkeeroplossing (PBS met 0,01% Tween en 2% BSA) gedurende 2 uur.
    5. Verwijder de blokkerende oplossing en was hem met PBS-0,01% Tween gedurende 10 min.
    6. Gedurende deze tijd, de primaire antilichamen verdund tot de gewenste concentraties in PBS-0,01% Tween.
    7. Verwijder de wasoplossing, gelden de antilichaamoplossing uit de vorige stap, en incubeer overnacht bij 4 ° C in een bevochtigde vak.
    8. Verwijder de antilichaamoplossing en was 3 maal met PBS-0,01% Tween gedurende 5 min per keer en met gedeïoniseerd water gedurende 10 minuten, met zeer zacht schudden.
    9. Tijdens het wassen, centrifuge fluorochromeconjugated, species-specifieke secundaire antilichamen bij 14.000 xg gedurende 20 min bij 4 ° C.
    10. Verdun de secundaire antilichamen zonder precipitaten zoals aangegeven door de aanbieder in PBS-0,01% Tween, toepassen en incubeer gedurende 1 uur bij kamertemperatuur.
    11. Herhaal stap 7.8 en verwijder de wasoplossing zo volledig mogelijk.
    12. Pipet 4 ul van anti-fading middel gedurende elk monster op de dia.
    13. Bedek de monsters met een dekglaasje.
    14. Lucht drogen gedurende 1 uur.
    15. Seal glijbaan met nagellak. Dia's kunnen worden opgeslagen bij -20 ° C tot verdere analyse.
    16. Analyseren op een confocale laser microscoop 8.

    8. Bepaling van oxidatieve stress door oxidatie van Ethidium

    1. Na 7 dagen DSS colitis, bereid weefsel zoals beschreven in stap 5.7 en snijd dikke secties in een cryostaat met een dikte van 5 urn. Mount dwarsdoorsneden op objectglaasjes behandeld met poly-L-lysine-oplossing en incubeer de monsters with 5 uM dihydroethidium (DHE) in water bij 37 ° C gedurende 30 minuten in het donker.
    2. Was de monsters met PBS (pH 7,6) drie keer gedurende elk 15 minuten onder zacht schudden bij kamertemperatuur. Lucht droog de samples op een druppel montage medium om de fluorescentie te beschermen. Let op de fluorescentie van geoxideerde ethidium op een laser-scanning confocale microscoop (40X vergroting, 568 nm golflengte).

    9. Analyse van de rekrutering van leukocyten door MPO Assay

    1. Na 7 dagen DSS colitis, verzamelen darmweefsel en homogeniseer de monsters (200-400 mg) met 1 ml hexadecyltrimethylammoniumbromide (HTAB) buffer (0,5% HTAB in 50 mM fosfaatbuffer, pH 6,0) onder toepassing van een homogenisator op ijs.
    2. Spoel de buitenzijde van de homogenisator tweemaal met 1 ml buffer HTAB alle weefsels in het lysaat onder ultrasone trillingen en vijf keer bij 40% amplitude gedurende 10 s elk. Vries-dooi in vloeibare stikstof drie keer.
    3. Centrifugeer bij 14.000 xg gedurende 15 minuten en verzamel de supernatant.Bereid 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonzuur) -oplossing (ABTS) door mengen ABTS, 5 ml natriumcitraat (1 M in water), 0,1 ml waterstofperoxide en 45 ml bi -gedistilleerd water.
    4. Meng 0,1 ml van elk supernatant met 0,1 ml ABTS oplossing in een 96-well platbodem platen. Na 10 min, meet de absorptie bij 460 nm met een spectrofotometer.

    10. Het evalueren van de expressie van pro-inflammatoire cytokines door PCR

    1. tissue homogenisering
      1. Homogeniseer 50 tot 100 mg colon weefselmonsters in 1 ml van een zuur guanidinium thiocyanaat-fenol-chloroform mengsel met een vermogen homogenisator.
      2. Incubeer bij kamertemperatuur gedurende 15 min.
    2. fasescheiding
      1. Voeg 0,2 ml chloroform en schud krachtig gedurende 30 s.
      2. Incubeer bij 4 ° C gedurende 30 minuten.
      3. Centrifugeer bij 12.000 xg gedurende 60 min bij 4 ° C.
      4. Breng de Upper waterige fase in een nieuwe buis (~ 500 pi).
    3. RNA Neerslag en Resuspension
      1. Voeg 0,5 ml isopropylalcohol en incubeer de monsters bij 4 ° C gedurende 60 minuten.
      2. Centrifugeer bij 12.000 xg gedurende 30 min bij 4 ° C.
      3. De bovenstaande vloeistof volledig.
      4. Voeg 1 ml ethanol 75% en vortex.
      5. Centrifugeer bij 12.000 xg gedurende 30 min bij 4 ° C.
      6. Verwijder het supernatant.
      7. Laat de resterende ethanol aan de lucht drogen gedurende 3-5 min.
        NB: Het is belangrijk om niet te laten de RNA pellet volledig opdrogen, omdat deze sterk zijn oplosbaarheid zal afnemen.
      8. Re-ontbinding van de pellet in 0,3 ml diethylpyrocarbonaat (DEPC) behandeld water. Onmiddellijk transcriberen de RNA-monsters in cDNA (meer stabiel, zie stap 10.5) of op te slaan bij -80 ° C.
    4. RNA kwantificering
      1. Verdun 1 pi van RNA met 99 pl met DEPC behandeld water.
      2. Lees The OD bij 260 nm en 280 nm met een UV / VIS spectrofotometer monsterconcentratie en zuiverheid te bepalen.
    5. cDNA Synthesis
      1. Meng RNA monsters (1-5 ug) met 1 pl Oligo (dT) 12-18 (0,5 ug / ul) en DEPC-behandeld water (totaal volume 12 ui) in RNase-vrij steriele buizen.
      2. Incubeer bij 70 ° C gedurende 10 minuten.
      3. Voeg 2 ui 10X PCR buffer, 1 pl 50 mM MgCl2, 1 pl 10 mM dNTP mix en 2 pl 0,1 M dithiothreitol (DTT).
      4. Incubeer bij 4 ° C gedurende 5 minuten.
      5. Voeg 1 pl reverse transcriptase en incubeer bij 42 ° C gedurende 5 minuten.
      6. Incubeer bij 70 ° C gedurende 15 minuten.
      7. Incubeer bij 4 ° C gedurende 15 minuten. cDNA kan worden opgeslagen bij -20 ° C tot verder gebruik.
    6. PCR
      1. Meng 2,5 ui 10X PCR buffer, 1,5 pl 25 mM MgCl2, 0,5 pl van 10 mM dNTP mix, 0,25 μL Taq DNA polymerase, 0,25 pl van elke primer (10 uM) en cDNA (100 ng) en steriel water tot een totaal volume van 25 ul.
      2. Run de monsters op een 96-well thermische cycler. Om amplificatie van genoom-DNA te voorkomen, voorwaartse en achterwaartse primers moeten worden gevestigd in verschillende exons: IL1β-FW: GCAACTGTTCCTGAACTCAACT en IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA en IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT en KC-RE: CCTGAGGGCAACACCTTCA; en actine-FW: TATCCACCTTCCAGCAGATGT en actine-RE: AGCTCAGTAACAGTCCGCCTA. Gebruik de volgende PCR-omstandigheden: 95 ° C gedurende 5 min gevolgd door 30 cycli bij 95 ° C gedurende 15 s, 58 ° C gedurende 30 s en 72 ° C gedurende 30 s, en een laatste verlenging van 10 min bij 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dieet supplementen kan beschermen tegen DSS Colitis

Anti-inflammatoire en anti-oxidatieve voedingssupplementen, zoals vitamine C, vitamine E, stikstofoxide (NO) -source L-arginine en ω3-meervoudig onverzadigde vetzuren (PUFA-ω3), zijn gebruikt met wisselend succes dieren modellen tekenen van ontstekingsziekten 3,6,15 verlichten. Ondervoeding, oxidatieve stress, en de productie van pro-inflammatoire cytokines kunnen acute en chronische colitis 3 leiden. In een eerdere studie hebben we aangetoond dat een combinatie van microvoedingsstoffen toonde beschermende effecten tegen DSS-geïnduceerde colitis in vivo. Hier bieden we gedetailleerde protocollen over de manier waarop deze effecten werden gemeten 8. Eerst analyseerden we het effect van voedingssupplementen van ziekteprogressie door bepaling van de ziekteactiviteit index (DAI), bestaande uit de drie parameters van gewichtsverlies,consistentie van de ontlasting, en perianale bloeden. Representatieve resultaten bleek dat DSS behandeling leidde tot een continu toenemende DAI, zoals verwacht, tot een maximum van 8,2 ± 0,46 op dag zeven (Figuur 1A). Anti-inflammatoire dieet supplementen vertraagde het begin van colitis, maar op latere tijdstippen wanneer colitis zeer sterk was, het beschermende effect was marginaal en niet langer statistisch significant, wat suggereert dat dieetsupplementen alleen effectief wanneer de colitis is nog niet te sterk. Belangrijker kan voedingsinterventie de DSS-geïnduceerde toename in intestinale epitheliale permeabiliteit, wat een belangrijk kenmerk van colitis (Figuur 1B) is voorkomen. DSS colitis leidde tot verminderde colon lengtes en dit bakvet werd ook verbeterd door de anti-inflammatoire en anti-oxidatieve voedingssupplement (figuur 1C). Aldus klinische symptomen van colitis kan weliswaar worden ondervangen door veranderingen in dieet samenstelling.

Te analyseren waarom colitis progressie was minder ernstig in dieren die een dieet aan te vullen, werd weefsel morfologie onderzocht na hematoxyline / eosine (H / E) kleuring van paraffine ingebedde distale colon weefsels. Controlemonsters toonde een normale morfologie (Figuur 2A, bovenste paneel), terwijl dieren behandeld met 3,5% DSS toonden typische symptomen van colitis (dwz infiltratie van leukocyten, de vorming van oedeem, crypte dysplasie, en zweren Figuur 2A, middelste paneel). We merken op parallelle behandeling met dieet suppletie duidelijk verlicht-geïnduceerde colitis morfologische veranderingen, met een totale morfologie die beter vergelijkbaar met de controlegroep (Figuur 2A, onderste paneel) was. Deze waarnemingen waren vergelijkbaar met wat geweestgerapporteerd voor co-behandelingen met probiotische bacteriën 13 en duidelijk dat veranderingen in het dieet van de ontwikkeling van colitis kan tegengaan.

We wisten al dat-geïnduceerde colitis intestinale epitheliale permeabiliteit kan worden tegengegaan door een dieet suppletie. Verhoogde permeabiliteit is een kenmerk van IBD, en het is grotendeels veroorzaakt door het demonteren van de stabiliserende contactplaatsen (AJ) en tight junctions (TJ). Destabilisatie van epitheelcellen contacten door de internalisering van junctionele eiwitten wordt geïnduceerd door pro-inflammatoire cytokines, die overvloedig geproduceerd worden tijdens colitis 16. We vonden, door immunofluorescentie kleuring van distaal colon weefsel, dat de TJ molecuul zonula occludens-1 (ZO-1) en de AJ molecule E-cadherine tijdens DSS-geïnduceerde colitis werden geïnternaliseerd en dat co-lokalisatie van deze eiwitten is gedeeltelijk verloren bij crypt epitheelcel contacten (figuur 2B). ikmportantly, internalisering van E-cadherine en ZO-1 werd verlaagd wanneer DSS-behandelde muizen werden samen behandeld met een anti-inflammatoire en anti-oxidatieve voedingssupplement (figuur 2B). Overall, crypte en knooppunt structuren waren vergelijkbaar regelt wanneer de dieetsupplement werd toegepast, wat suggereert dat de waargenomen beschermende effect was tenminste deels door het behoud van weefselarchitectuur.

Dietary interventie kan tegengaan Inflammatory neutrofielen Recruitment, oxidatieve stress, en de productie van pro-inflammatoire cytokines

Een ander kenmerk van IBD is ongecontroleerde infiltratie van neutrofielen. Geworven neutrofielen dragen tot weefselschade door de productie en het vrijgeven reactieve zuurstofsoorten (ROS) en 17 proteases. Met behulp van een MPO activiteit test, vonden we een sterke neutrofielen werving in de dikke darm in reactie op DSS, die werd tegengewerktdoor dieet supplementatie (figuur 3A).

Oxidatieve stress is een ander belangrijk kenmerk van colitis veroorzaakt door het vrijkomen van ROS van geworven neutrofielen. Derhalve analyseerden we de productie van ROS in colon doorsneden. Figuur 3B toont aan dat DSS behandeling sterk verhoogde oxidatieve stress. We merken op veranderingen in de voeding volledig verhinderd DSS-geïnduceerde oxidatieve stress (Figuur 3B), wat zeer waarschijnlijk een gevolg van verminderde neutrofiele recrutering (Figuur 3A).

Pro-inflammatoire cytokines en chemokines worden sterk door verschillende celtypen tijdens colitis 18. Dergelijke ontstekingsmediatoren bijdragen aan neutrofielen werving en knooppunt eiwit internalisatie-functies die we al wisten dat zou kunnen worden verzwakt door de veranderingen in de voeding. Analyse van mRNA expressie door RT-PCR onthulde dat DSSverhoogde de expressie van IL1β, IL-6 en keratinocyt verkregen chemokine (KC), zoals verwacht (Figuur 3C), en anti-inflammatoire dieet supplementatie verminderd Dit DSS geïnduceerde toename (figuur 3C). Deze gegevens impliceren dat voedingssupplementen inderdaad kan dienen om de klinische symptomen van IBD tegen te gaan.

Figuur 1
Figuur 1. Voedingssupplementen Kan verlichten Disease Activity Index, intestinale epitheliale permeabiliteit en Colon Verkorting. (A) De ziekteactiviteit index (DAI waarden 0-12) bestaat uit de drie parameters van gewichtsverlies, ontlasting en perianale bloeden en werd dagelijks geregistreerd in de experimentele groepen control (ctrl), colitis en colitis + voedingssupplement (colitis + suppl.). De controlegroep geen symptomen van colitis vertonen, resulterend in een DAI van 0 throughout de experimentele periode. n = 5 per groep. (B) intestinale epitheliale permeabiliteit werd gemeten met Evans blauwe lekkage in de bovengenoemde experimentele groepen en werd uitgedrukt als de absorptie bij 620 nm per g weefsel. n = 8 per groep. Alle gegevens worden weergegeven als het gemiddelde ± de standaardafwijking van het gemiddelde (SDM). * P <0,05; ** P <0,01; *** P <0,001. Statistieken werden berekend door one-way ANOVA. (C) Representatieve beelden van hele dubbele punten van de respectieve experimentele groepen na 7 dagen behandeling. De schaal aan de linkerkant is in cm. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2. Tissue morfologie en Junction Architecture zijn beter behouden tijdens Colitis bij de toepassing van Nutritional Supplements. (A) 5-um paraffine dwarsdoorsnede weefsel biopten van het distale dubbele punten van de respectievelijke experimentele groepen werden gekleurd met hematoxyline / eosine en geanalyseerd op typische symptomen van colitis, zoals oedeemvorming (pijlen), leukocyt infiltratie (pijlpunten), en ulceratie (*). Over het algemeen weefsel morfologie van de colitis + suppl. groep meer lijkt op dat van de controle dan de colitis groep, waaruit een algeheel beschermend effect tegen DSS colitis. De beelden zijn representatief voor 3 onafhankelijke weefsel voorbereidingen per groep. Beelden werden genomen met behulp van een 10X objectief. Bar = 100 urn. (B) 8 urn dikke cryo-onderdelen van de corresponderende groepen werden gekleurd met antilichamen tegen ZO-1 (groen) en E-cadherine (rood). Co-lokalisatie (geel in de samengevoegde beelden, pijlen) van E-cadherine en ZO-1 bij crypt epitheelcellen contacten, die verloren gaat tijdens colitis, wordt meestal bewaard in de colitis + suppl. groep. Beelden zijn representatief voor 3onafhankelijke weefsel preparaten. Bar = 50 urn. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3. neutrofielen Recruitment, oxidatieve stress, en de productie van pro-inflammatoire cytokines kan worden verminderd door voedingssupplementen. (A) Myeloperoxidase (MPO) activiteit werd gemeten om de hoeveelheid rekrutering van leukocyten uit te splitsen in colon weefsel in de experimentele groepen: controle (ctrl), colitis en colitis + voedingssupplement (colitis + suppl.). n = 5 per groep; * P <0,05. De gegevens worden weergegeven als het gemiddelde ± SDM. Statistieken werden berekend door one-way ANOVA. (B) De fluorescentie van geoxideerde ethidium, afgebeeld in rood als maat voor oxidatieve stress in 8-um cryo-gedeelten van colon weefsels, werd opgenomen door laser confocale microscopie. De beelden zijn representatief voor 3 onafhankelijke weefsel preparaten. Bar = 100 urn. (C) De productie van pro-inflammatoire cytokines IL1β en IL-6 en de chemokine KC werd bepaald door semi-kwantitatieve RT-PCR in een 1,5% agarosegel (zwart-wit zijn teruggekeerd voor de duidelijkheid). β-actine diende als huishoudgen. Representatieve beelden van drie onafhankelijke cDNA voorbereidingen worden getoond. Klik hier om een grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Met het oog op voedingssupplementen in klinische studies te gebruiken, moeten de voordelen en de veiligheid van dergelijke supplementen zorgvuldig worden geëvalueerd in vivo in dierstudies. Bij colitis, hebben meerdere geschikte diermodellen de klinische symptomen van IBD lijken vastgesteld, waaronder chemische modellen met DSS, TNBS of azijnzuur; knock-out (KO) modellen zoals IL10-KO; en immuun-cell-mediated colitis gebruik van adoptieve T-cel overdracht 19-21. De DSS model van colitis is een snelle en betrouwbare werkwijze voor het induceren van colitis dat veel ziektesymptomen menselijke IBD lijkt en is gebruikt in een overvloed van studies die de moleculaire mechanismen van colitis 22. Bovendien DSS colitis omkeerbaar waardoor aldus ook de studie van weefselherstel na colitogenic stimulus is verwijderd. De verstrekte protocol beschrijft in detail de DSS colitis model dat al eerder is geoptimaliseerd in ons laboratorium 8.

23. Daarnaast moet DSS in een molecuulgewicht van 40-50 kDa colitis te induceren. Voor de onervaren onderzoeker, zal het belangrijk zijn om in de gaten te ontwikkelen voor een objectieve beoordeling van de DAI parameters van de consistentie van de ontlasting en perianale bloeden. Indien de beoordeling wordt uitgevoerd door een onervaren onderzoeker, verdient het aanbeveling een collega bevestigen de beoordeling, bij voorkeur in geblindeerd.

De intestinale epitheliale permeabiliteit voor macromoleculen te analyseren, hebben drie belangrijke werkwijzen gebruikt in de literatuur: de Evans blauwe kleurstof assay, zoals hier beschreven; instillatie van 4-kDa FITC-dextran per darmlus; en het voeden van 4-kDa FITC-dextran 13,24,25. In deze test wordt FITC-dextran gevoed door gavageEn de hoeveelheid FITC dextran dat het epitheel gekruist en lekte in de bloedbaan wordt fluorometrisch gemeten vanaf serummonsters. Bij deze test wordt de doorlatendheid van de gehele maagdarmkanaal gemeten, aangezien de tracer loopt helemaal van de slokdarm tot het rectum en de meeste tracer passeert voordat het colon. In de lusmodel wordt permeabiliteit gemeten in een afgesloten intestinale gebied voor de lus (meestal de dunne darm) 25. In tegenstelling, de Evans blue assay heeft het voordeel dat slechts epitheliale permeabiliteit in de colon wordt gemeten, aangezien de tracer direct ingeprent de hele dikke darm. Dus, door deze test, kunnen we concluderen dat de colonepitheel is beschermd door het dieetsupplement.

Het is altijd belangrijk om het colon gewicht en de lengte na extractie en alvorens het weefsel voor andere testen nemen, omdat sommige data (bijv lekte Evans blauw in de permeabiliteit ASSAy) worden uitgedrukt per gram weefsel. Verder is het gewicht-lengte verhouding is onafhankelijk uitlezen van weefselschade 26. In het algemeen wordt weefselmorfologie geanalyseerd met in paraffine ingebedde weefsels gekleurd met hematoxyline en eosine, zoals hier beschreven. Paraffine inbedding heeft het voordeel dat het weefsel morfologie veel beter geconserveerd in vergelijking met andere methoden insluiten. Dit maakt de ondubbelzinnige identificatie van de verschillende celtypes in het slijmvlies (bijv immuuncellen, epitheel, slijmbekercellen, etc.) en de analyse van veranderingen in weefsel colitis, zoals oedeem, infiltratie van leukocyten en epitheliale erosies apicale. Anderzijds, paraffine heeft het nadeel dat immunofluorescentiekleuring alleen kan worden uitgevoerd na tijdrovende epitoop herstel. Daarom bereiden we altijd anders ingevroren weefsel biopten ingebed in OCT compound. Dergelijke weefselmonsters kunnen gemakkelijker verder bewerken met behulp van een cryostaat en vertonen een laag autofluorescence. We gebruiken ethanol voor binding door dehydratatie omdat noch ingrijpt in actine filamenten (methanol doet), noch triggeren autofluorescentie (zoals PFA doet). Met behulp van deze technieken hebben we vastgesteld dat een anti-inflammatoire en anti-oxidatieve voedingssupplement weefselmorfologie en knooppunt architectuur tijdens colitis (vergelijk figuur 2) kan verbeteren.

Overmatige neutrofielen recruitment is een kritieke gebeurtenis tijdens colitis die wordt geïnduceerd door de productie van chemoattractanten in reactie op ontsteking 17. Neutrofiel rekrutering een fysiologische gebeurtenis, omdat neutrofielen bij aan de verwijdering van de inflammatoire cue en daaropvolgende wondgenezing. Indien dit aangeboren immuunreactie onvoldoende controle en beëindigd neutrofielen in de mucosa kunnen bijdragen tot weefselschade door het vrijgeven proteasen en reactieve zuurstofsoorten. Neutrofielen bevatten MPO, die gemakkelijk kan worden gemeten en gekwantificeerd onder toepassing van eencolorimetrische assay, waarbij de hoeveelheid MPO is recht evenredig met het aantal neutrofielen. Figuur 3A toont dat neutrofielen werving stijgt tijdens colitis en dat voedingsinterventie deze excessieve en ongecontroleerde immuunrespons kan voorkomen. Overeenkomstig de overvloedige aanwezigheid van neutrofielen in de mucosa, oxidatieve stress toeneemt tijdens colitis (Figuur 3B).

Onze voeding suppletie beschermt duidelijk de mucosa tegen oxidatieve stress, wat zeer waarschijnlijk een gevolg van verminderde neutrofiele rekrutering. Zoals vermeld, worden neutrofielen aangetrokken door chemokines en de productie van chemokinen wordt geïnduceerd door pro-inflammatoire cytokinen die door verschillende celtypen uitgescheiden tijdens colitis. Dus verondersteld dat verminderde neutrofielen rekrutering Wegens de verlaging cytokine en chemokine productie. Figuur 3C toont aan dat de pro-inflammatoire cytokines IL-1β en IL-6, alsmede dechemokine KC worden opgereguleerd tijdens DSS-geïnduceerde colitis. Het dieet supplement omgekeerd de niveaus van IL-6 naar te beheersen verbeterd en de verhoogde productie van IL-1β en KC. Opmerkelijk, KC is de belangrijkste chemoattractant voor neutrofielen in muizen.

Aldus is het verleidelijk om te speculeren dat de waargenomen conservering van weefsel morfologie gevolg van verminderde infiltratie van neutrofielen, die op zijn beurt het gevolg van de verminderde productie van KC. Analyseren RNA productie DSS behandelde weefsel met RT-PCR is problematisch wanneer residuele DSS in de geïsoleerde RNA is. Dit komt omdat DSS inhibeert zowel omkeertranscriptasen en Taq-polymerasen. Indien geen versterking kan worden bereikt, is het nodig om de RNA monsters verder te zuiveren door LiCl-bemiddelde precipitatie, zoals elders 27 beschreven.

Samengevat beschrijven we in detail verschillende analysemethoden van weefselschade tijdens DSS colitis en hoe dat dAmage kan worden verbeterd door voedingssupplementen. Opgedane kennis van dergelijke dierlijke experimenten kunnen de oprichting van patiëntencohorten rechtvaardigen voor de beschermende effecten van de geanalyseerde supplementen in de menselijke IBD onderzoeken. Gegevens die zijn verkregen uit klinische studies kan dan opent nieuwe mogelijkheden voor alternatieve behandeling strategieën voor het beheer van IBD te ontwikkelen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd ondersteund door subsidies van de Mexicaanse Raad voor Wetenschap en Technologie (Conacyt, 207.268 en 233.395 aan Michael Schnoor). KFCO is een ontvanger van een Conacyt stipendium (396.260) om een ​​MSc-diploma te verkrijgen.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Het analyseren van gunstige effecten van voedingssupplementen op darmepitheel Barrier Functies tijdens de Experimental Colitis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter