Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Analyse Effets bénéfiques des suppléments nutritionnels sur les fonctions épithéliales intestinales barrière Pendant Experimental Colite

doi: 10.3791/55095 Published: January 5, 2017

Summary

Les traitements actuels des maladies inflammatoires de l'intestin (MICI) visent à soulager les symptômes de la maladie, mais peuvent entraîner des effets secondaires graves. Ainsi, les stratégies alternatives sont à l'étude dans les modèles de colite animales. Ici, nous expliquons comment les effets bénéfiques de compléments alimentaires sur les signes cliniques MII sont analysés dans un tel modèle de colite.

Abstract

les maladies inflammatoires de l'intestin (MICI), y compris la maladie de Crohn et la rectocolite hémorragique, sont des troubles chroniques récidivantes de l'intestin. Ils causent des problèmes graves, tels que des crampes abdominales, une diarrhée sanglante, et la perte de poids, chez les personnes touchées. Malheureusement, il n'y a pas encore de traitement, et les traitements ne visent à soulager les symptômes. Les traitements actuels comprennent des médicaments anti-inflammatoires et immunosuppresseurs qui peuvent provoquer des effets secondaires graves. Ceci justifie la recherche d'autres options de traitement, tels que les suppléments nutritionnels, qui ne causent pas d'effets secondaires. Avant leur application dans des études cliniques, de tels composés doivent être rigoureusement testés pour l'efficacité et la sécurité dans les modèles animaux. Un modèle expérimental fiable est le sulfate de dextrane sodique (DSS), le modèle de colite chez des souris, qui reproduit un grand nombre de signes cliniques de la rectocolite hémorragique chez l'homme. Nous avons récemment appliqué ce modèle pour tester les effets bénéfiques d'un supplément nutritionnel contenantles vitamines C et E, L-arginine, et les acides gras poly-insaturés © 3 (PUFA). Nous avons analysé les différents paramètres de la maladie et a constaté que ce supplément a été en mesure d'améliorer la formation de l'œdème, des lésions tissulaires, l'infiltration leucocytaire, le stress oxydatif, et la production de cytokines pro-inflammatoires, conduisant à une amélioration globale de l'indice d'activité de la maladie. Dans cet article, nous expliquons en détail l'application correcte des suppléments nutritionnels en utilisant le modèle de la colite DSS C57BL / 6 souris, ainsi que la façon dont les paramètres de la maladie tels que l'histologie, le stress oxydatif et l'inflammation sont évalués. L'analyse des effets bénéfiques de différents compléments alimentaires peut alors éventuellement ouvrir de nouvelles voies pour le développement de stratégies alternatives de traitement qui atténuent les symptômes de MII et / ou qui prolongent les phases de rémission sans provoquer d'effets secondaires graves.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Colite est une maladie inflammatoire du côlon qui peut causer de la diarrhée et des douleurs abdominales. Rectocolite peut être aiguë, en réponse à une infection ou à un stress, ou il peut se développer une maladie chronique, telle que la colite ulcéreuse (CU), qui appartient au groupe des maladies inflammatoires de l'intestin (MICI). Bien que les signes cliniques de l' UC ont été bien décrits, la pathogenèse est encore mal comprise 1. Il est admis parmi les experts que les communications unifiées est une maladie multifactorielle, avec des mutations génétiques et des réponses immunitaires aberrantes qui jouent un rôle majeur 2. Cependant, les facteurs environnementaux, tels que le style de vie et la nutrition, contribuent également au développement de la maladie et la progression 3.

Malheureusement, l'IBD est pas curable, mais il y a beaucoup d'options de traitement qui visent à atténuer les symptômes cliniques. Les traitements actuels comprennent des médicaments anti-inflammatoires, tels que la sulfasalazine et les corticostéroïdes; les immunosuppresseurs, tels que azathioprine; des anticorps monoclonaux qui capturent les cytokines pro-inflammatoires telles que le facteur onconécrosant-α (TNF-α) ou des molécules d'adhésion de blocs, telles que les intégrines, afin de réduire le recrutement leucocytaire excessif; et les inhibiteurs ciblant les kinases qui déclenchent des voies pro-inflammatoires, telles que la kinase Janus (JAK) 4. Pas tous les patients répondent à tous les traitements, de sorte que les stratégies thérapeutiques doivent être individualisées 5. En outre, la plupart de ces médicaments thérapeutiques interférer avec le métabolisme et les réponses immunitaires, ce qui provoque souvent des effets secondaires graves. Pour cette raison, les options de traitement alternatives ont été étudiées.

Les traitements alternatifs comprennent les probiotiques et les suppléments nutritionnels, qui ont été appliquées dans des modèles animaux et des essais cliniques avec des niveaux variables de succès 6,7. Nous avons récemment découvert que l'application de différents suppléments nutritionnels uniques, tels que les vitamines antioxydantes ou les acides gras ω3-poly-insaturés (PENM), est inférieure à l'application d'une combinaison de tels suppléments pour soulager les symptômes de colite et de maladies cardiovasculaires 8,9. Ces études ont été réalisées chez la souris, de sorte que les études cliniques doivent être effectuées chez les humains afin de déterminer si ces résultats seront également applicables à l'homme. Avant les études cliniques sont lancées, l'efficacité et la sécurité des nouvelles options de traitement doivent être évalués dans des modèles animaux.

Pour les MII, le (DSS) modèle du sulfate de dextran de sodium a été largement utilisé pour étudier les mécanismes de développement de la maladie et les effets bénéfiques des médicaments et des suppléments nutritionnels 6,10. Dans la plupart des études, seule une maladie aiguë au cours d'une période de sept jours est induite; néanmoins, les signes cliniques observés chez ces animaux ressemblent étroitement à celles observées chez les patients MICI (c. -à- diarrhée sanglante, la perte de poids, dysfonction épithéliale, et l' infiltration des cellules immunitaires) 10. DSS induit des érosions dans la muqueuse,entraînant un dysfonctionnement de la barrière et une augmentation de la perméabilité épithéliale intestinale 11. Le mécanisme exact reste inconnu. Cependant, une étude suggère que le MAS interagit avec des acides à chaîne moyenne longueur gras pour former des nano-lipocomplexes qui sont capables de pénétrer dans les cellules épithéliales et pour induire la signalisation inflammatoire pathways 12. Dans cet article, nous décrivons en détail comment colite est induite et analysé chez la souris, comment les suppléments nutritionnels sont appliqués par gavage pour assurer un dosage constant dans chaque animal, et comment les effets de ces suppléments sur divers symptômes de colite sont examinés.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Toutes les expériences sur les animaux ont été approuvés par le soin et l'utilisation des animaux Commission institutionnelle du Cinvestav.

1. Préparation du DSS eau potable et de l'induction de la colite

  1. Préparer un 3,5% p / v de sulfate de dextrane sodique (DSS) dans de l'eau potable autoclavée. DSS se dissout facilement et il n'a pas été nécessaire de filtrer la solution finale.
    NOTE: 7 jours de traitement DSS induit une colite sévère. Si l'induction de colite légère, 3 - 4 jours de traitement sont recommandés. Tant que l'eau potable DSS reste clair, il ne faut pas changer l'eau. Toutefois, si elle se trouble, il doit être remplacé.
  2. Noter le poids de base des souris mâles. Veiller à ce qu'ils sont 8 - 12 semaines d'âge et dans une fourchette de 21 - 25 g de poids corporel.
    NOTE: La concentration de DSS appropriée doit être optimisée dans chaque laboratoire. Les résultats peuvent varier considérablement, en fonction des conditions de logement. Concentrations entre 2,5 à 5% sont habituellement rapportées pour induire une forte colitis C57BL / 6J WT souris 10. DSS de différentes entreprises et différents lots doit être testé, car les résultats peuvent également varier selon les sources de DSS.
  3. Fournir de l' eau ad libitum et le remplacer par 3,5% d' eau douce DSS si nécessaire.

2. Application des suppléments nutritionnels par Gavage

  1. Préparer une solution "peut être alimentée» des suppléments nutritionnels souhaités dans un solvant approprié. Pour cette étude, nous avons utilisé un mélange contenant 200 mg / kg de L-arginine, 83 mg / kg de vitamine C, 46 mg / kg de vitamine E, 77 mg / kg acide eicosapentaénoïque (EPA) et 115 mg kg acide docosahexaénoïque / (DHA ) dans une solution 1: 1 d'eau et de l'huile de carthame.
  2. Remplir une seringue de 1 ml reliée à une aiguille de gavage (15 G x 50 mm) avec le mélange de compléments nutritionnels. Essuyez l'extérieur de l'aiguille de gavage pour éliminer tout composé à l'extérieur de l'aiguille et d'assurer l'application de la dose appropriée.
  3. Retiens la souris en saisissant la base de la queue avecd'une part et en saisissant fermement un pli de la peau à l'arrière du cou avec le pouce et l'index de l'autre main. Placez la queue entre le troisième doigt et la base du pouce de la même main qui tient le cou.
  4. Tout en maintenant la souris dans une position verticale, insérer l'aiguille dans le côté gauche de la bouche de l'animal et suivre attentivement le toit de la bouche pour localiser l'œsophage. Si aucune résistance est rencontrée, faire avancer l'aiguille vers l'estomac.
    REMARQUE: Vérifiez que l'animal respire correctement avant de poursuivre.
  5. Administrer lentement le mélange, retirer le tube en tirant doucement sur la seringue, et relâchez la souris. Appliquer les suppléments nutritionnels une fois par jour par gavage pendant la durée de l'expérience de la colite.

3. Détermination du Disease Activity Index

NOTE: L'indice d'activité de la maladie est la combinaison des scores pour la perte de poids, saignements périanale, et la consistance des selles, qui sont obCONTENUES quotidien 13.

  1. Mesurer le poids corporel par jour, et attribue un score de 0 à 4 en fonction du pourcentage de perte de poids (0: 0%, 1: 1 - 5%, 2: 5 - 10% 3: 10 - 20% et 4:> 20 %).
    NOTE: Bodyweight perte est déterminée en calculant la différence en pour cent entre le poids de base avant l'induction de DSS-colite et le poids réel.
  2. Pour déterminer le niveau de saignement périanale, prélever un échantillon de selles fraîches et utiliser les applicateurs fournis pour appliquer un frottis mince sur une diapositive à partir d'un kit de test gaïac de sang occulte dans les selles. Utilisez un nouvel applicateur pour chaque échantillon.
    1. Fermez le couvercle sur l'avant et ouvrir la fenêtre sur le dos de la lame. Appliquer deux gouttes de la solution de révélateur à l'arrière à l'emplacement de l'échantillon.
    2. Lire les résultats après 30 s. Toute trace de couleur bleue est positive pour le sang occulte. Attribuer un score de 0 à 4 (0: aucune, de 0,5 à 2,5: gaïac positif fécale de sang occulte (en fonction de la puissance du signal), et 3 - 4: gross saignement).
      NOTE: Si le sang dans les selles est visible, le test de sang occulte dans les selles gaïac n'a pas à être effectué, et un score de 3, 3,5, ou 4 est attribué, en fonction de la quantité de sang visible.
  3. Déterminer la consistance des selles en observant un échantillon de selles fraîches. Attribuer un score de 0 à 4 (0: solide, 0,5 normale / - 2,5: tabouret pâteuse, et 3 - 4: diarrhée).

4. Déterminer Intestinal épithéliale Perméabilité in vivo par Evans Bleu Assay

  1. Anesthésier les animaux en leur injectant par voie intraperitoneale avec un mélange de kétamine (100 mg / kg de poids corporel) et de xylazine (13 mg / kg de poids corporel) dilué dans une solution saline (NaCl 0,9%), et évaluer la profondeur de l'anesthésie en surveillant la pincée réflexe de retrait.
  2. Placez les animaux anesthésiés dans une position couchée et effectuer une laparotomie pour exposer les intestins.
  3. Localisez le caecum et faire une petite incision dans le segment proximal du côlon unescendens (idéalement, immédiatement adjacentes au caecum).
  4. Insérez une aiguille d'alimentation (G22) et le fixer avec une ligature en utilisant un fil de soie commune. Soigneusement flush abondante PBS à travers le tube pour rincer toutes les matières fécales du côlon. Instiller une solution de bleu Evans (1,5% p / v dans du PBS) dans le côlon jusqu'à ce qu'il atteigne l'anus.
  5. Incuber le bleu Evans pendant 15 min. Laver le colorant en rinçant le tube avec abondance PBS jusqu'à ce que le lavage périanale est clair.
  6. Euthanasier les animaux par dislocation cervicale.
  7. Exciser le côlon et le rincer à nouveau avec abondante PBS. Rincer une nouvelle fois avec 1 ml de 6 mM de N -acetylcysteine dans du PBS pour éliminer tout colorant coller à la muqueuse du côlon.
  8. Couper le côlon longitudinalement et rincer une fois avec du PBS et 1 ml de 6 mM N -acetylcysteine.
  9. Noter le poids et la longueur. Pour extraire le colorant bleu Evans, placez le côlon dans 2 ml de N, N - diméthylformamide pendant une nuit à température ambiante avec Agitatio doucen. Mesurer la concentration de colorant par spectrophotométrie à 610 nm.

5. Collecte de tissu

  1. Anesthésier les animaux en leur injectant par voie intraperitoneale avec un mélange de kétamine (100 mg / kg de poids corporel) et de xylazine (13 mg / kg de poids corporel) dilué dans une solution saline (NaCl 0,9%), et évaluer la profondeur de l'anesthésie en surveillant la pincée réflexe de retrait.
  2. Euthanasier les animaux par dislocation cervicale.
  3. Placez les animaux dans une position couchée et effectuer une laparotomie pour exposer la cavité abdominale.
  4. Avec des ciseaux, disséquer la totalité du côlon et enregistrer sa longueur.
  5. Rincer le côlon soigneusement plusieurs fois avec réfrigéré PBS pour éliminer les matières fécales. Noter le poids des tissus et se préparer pour les expériences suivantes, comme décrit dans les étapes 5.6 - 5.8.
  6. Pour l'isolement de l'ARN et la myéloperoxydase (MPO) essais, couper un échantillon de tissu de taille appropriée (100 mg est généralement suffisant), placez-le dans un tube, et snap-congeler dans de l'azote liquide. Conserver les tissus à -80 ° C pour une utilisation future.
  7. Pour immunofluorescence et la détermination de stress oxydatif (voir ci-dessous), couper un petit colon échantillon (0,5 à 1 cm) et plonger dans de petites tasses en aluminium remplies de température de coupe optimale (OCT) composé. Placez les tasses sur glace sèche et les laisser geler lentement, afin d'éviter la formation de bulles. Des échantillons de tissus congelés peuvent être conservés à -80 ° C pour une utilisation ultérieure.
  8. Pour roule suisse 14, ouvrir le côlon longitudinalement et retirez soigneusement les matières fécales en utilisant une pince. Rouler vers le haut, avec la muqueuse tournée vers l'intérieur, en utilisant une pince à pointe fine ou un mince bâton en bois rond. Placez délicatement à l'intérieur d'une cassette intégration et passez à l'étape 6.1.
    NOTE: DSS induit des dommages au niveau du côlon. Toutefois, la répartition des dommages varie de l'extrémité proximale à la partie distale du côlon, avec la plupart des dommages habituellement observés dans le côlon distal et du rectum. Ainsi, nous vous recommandons de l'analyse de l'histologie soit dans le col distalou dans des rôles suisses de l'ensemble du côlon.

6. Analyse de Colon histologie par hématoxyline-éosine

  1. Préparation tissulaire
    1. Pour l'analyse histologique, soit plonger les rouleaux suisses ou les petits morceaux de tissus provenant de certaines régions du côlon de contrôle et des souris traitées dans 5 ml de 10% de formaldéhyde pendant 48 h à la température ambiante (RT) pour obtenir une fixation correcte.
      Remarque: Toutes les autres étapes de l'étape 6 sont effectuées à la température ambiante, sauf indication contraire.
    2. Lavez-les avec de l'eau du robinet pendant 18 h.
    3. les déshydrater avec 15 ml d'éthanol à 70% pendant 1 h, 96% pendant 1 h, et de l'éthanol absolu pendant 1 h. Répétez chaque étape avec de l'alcool frais avant de procéder à la concentration suivante.
    4. Poursuivre la déshydratation dans un mélange de 7,5 ml d'éthanol absolu et 7,5 ml de xylène absolu pendant 1 h. Répéter une fois avant de passer les échantillons à 15 ml de xylène absolu pendant 1 h. Répétez cette étape une fois avec du xylène frais.
    5. Incorporation des échantillons de tissus du côlon en Paraffine
      1. Immerger les échantillons dans 50 ml d'huile de paraffine pendant 17 h. Répétez cette étape une fois, mais pour seulement 3 h.
      2. Immerger les échantillons en cubes (plastique, moule carré, taille: 22 x 22 x 22 mm) dans 810 ml de paraffine liquide.
      3. Permettre à la paraffine des échantillons de tissus du côlon à se solidifier pendant 24 h à température ambiante.
    6. Tissue Cross-sections à l' aide d' un Microtome de coupe
      1. Découper des échantillons de côlon à l'aide d'un microtome, selon les instructions du fabricant, à une épaisseur de 5 um.
      2. Collecter les coupes dans un bain d'eau (1 L) contenant 0,3% de gélatine. Ceci empêche le pliage du tissu des sections transversales. Récupérer les coupes de tissus et de les monter sur des lames de verre.
    7. Hématoxyline et éosine des tissus sections transversales
      1. Déparaffiner les échantillons pendant 18 h à 60 ° C dans un incubateur. A cet effet, utiliser un verre sPorte-lide avec une poignée.
      2. Après déparaffinage, plongez les lames dans 70 ml de xylène absolu pendant 5 min. Répétez cette étape une fois avec du xylène frais.
      3. Transférer les échantillons dans 70 ml d'alcool absolu pendant 1 min. Répétez cette étape une fois avec de l'alcool frais.
      4. Incuber les échantillons de tissu du côlon dans 70 ml d'éthanol à 96% pendant 1 min. Répétez cette étape une fois avec de l'alcool frais.
      5. Laver les échantillons dans l'eau du robinet deux fois pour 2 s.
      6. Incuber les tissus Harris hématoxyline pendant 7 min.
      7. Laver les échantillons dans l'eau du robinet deux fois pour 2 s.
      8. Incuber les échantillons dans de l'alcool acide (70 ml d'éthanol à 70% et 700 pi de 1 M d'acide chlorhydrique) pendant 7 s.
      9. Laver les échantillons dans l'eau du robinet deux fois pour 2 s.
      10. Incuber les échantillons de tissu dans 70 ml de carbonate de lithium (1 g de carbonate de lithium dans 100 ml d'eau distillée) pendant 7 s.
      11. Laver les échantillons dans l'eau du robinet deux fois pour 2 s.
      12. Incuber les échantillons dans 70 ml d'éthanol 80% Pendant 1 min.
      13. Transférer les échantillons dans 70 ml d'éosine-Y pendant 15 s.
      14. Incuber dans 70 ml d'éthanol à 96% pendant 1 min. Répétez cette étape une fois avec de l'alcool frais.
      15. Incuber les échantillons de tissu dans 70 ml d'éthanol absolu (alcool éthylique anhydre absolu) pendant 1 min. Répétez cette étape une fois avec de l'alcool frais.
      16. Incuber les échantillons dans 70 ml d'un mélange de 35 ml d'alcool absolu et 35 ml de xylène absolu pendant 1 min.
      17. Transférer les échantillons dans 70 ml de xylène absolu pendant 1 min. Répétez cette étape pour 5 min dans 70 ml de xylène absolu frais.
      18. Ajouter 80 pi de résine synthétique pour les échantillons de tissus du côlon, les couvrir avec des lamelles, et les laisser sécher pendant 24 heures à la température ambiante. Enfin, l' analyse des échantillons en utilisant la microscopie à champ lumineux 8.

    7. Analyse Junction Composition par immunofluorescence

    1. Préparer le tissu comme décrit dans l'étape 5.7 et couper 8 sections um d'épaisseurà l'aide d'un cryostat.
    2. Fixer et perméabiliser côlon sections transversales avec 96% d'éthanol à -20 ° C pendant 20 min.
      NOTE: Toutes les incubations ultérieures doivent être effectuées à la température ambiante, sauf indication contraire, dans une boîte sombre et humide pour éviter le dessèchement et fluorochrome fading.
    3. échantillons d'air sec, puis rincez-les 3 fois pendant 5 min chacun avec PBS 1x
    4. Incuber les échantillons avec une solution de blocage (PBS contenant 0,01% de Tween et 2% de BSA) pendant 2 h.
    5. Retirer la solution de blocage et le rincer avec du PBS-Tween 0,01% pendant 10 minutes.
    6. Pendant ce temps, diluer les anticorps primaires aux concentrations souhaitées dans du PBS-Tween 0,01%.
    7. Retirer la solution de lavage, appliquer la solution d'anticorps à partir de l'étape précédente, et incuber pendant une nuit à 4 ° C dans une boîte humidifiée.
    8. Retirer la solution d'anticorps et laver 3 fois avec du PBS-Tween 0,01% pendant 5 minutes chacun et une fois avec de l'eau déminéralisée pendant 10 minutes, avec une agitation très douce.
    9. Alors que le lavage, centrifugeuse Fluorochromeconjugated, espèce-spécifiques Anticorps secondaires à 14.000 xg pendant 20 min à 4 ° C.
    10. Diluer les anticorps secondaires sans précipités comme indiqué par le fournisseur dans du PBS-Tween 0,01%, les appliquer et laisser incuber pendant 1 h à température ambiante.
    11. Répétez l'étape 7.8 et enlever la solution de lavage aussi complètement que possible.
    12. Pipette 4 ul d'agent anti-fading sur chaque échantillon sur la diapositive.
    13. Couvrir les échantillons avec une lamelle.
    14. Sécher à l'air pendant 1 h.
    15. glissière de Seal avec le vernis à ongles. Les lames peuvent être stockées à -20 ° C jusqu'à analyse ultérieure.
    16. Analyser sur un microscope confocal à balayage laser 8.

    8. Détermination du stress oxydatif par Oxydation de éthidium

    1. Après 7 jours de DSS colite, préparer le tissu comme décrit dans l'étape 5.7 et couper des sections du côlon dans un cryostat à une épaisseur de 5 um. Monter les sections sur des lames de verre traitées avec une solution lysine poly-L-et incuber les échantillons d'esprith 5 uM de dihydroethidium (DHE) dans l'eau à 37 ° C pendant 30 min dans l'obscurité.
    2. Laver les échantillons avec du PBS (pH 7,6) trois fois pendant 15 minutes chacune avec une agitation douce à température ambiante. Air sécher les échantillons et ajouter une goutte de milieu de montage pour protéger la fluorescence. Observer la fluorescence de éthidium oxydé sur un microscope confocal laser à balayage (grossissement 40X, 568 nm de longueur d'onde).

    9. Analyse des leucocytaire Recrutement par MPO Assay

    1. Après 7 jours de DSS colite, de recueillir le tissu du côlon et homogénéiser les échantillons (200-400 mg) avec 1 mL d'hexadécyltriméthylammonium (HTAB) du tampon (0,5% HTAB dans 50 mM de tampon phosphate, pH 6,0) en utilisant un homogénéiseur sur de la glace.
    2. Rincer la pointe de l'homogénéisateur à deux reprises avec 1 ml de tampon HTAB à inclure tous les tissus dans le lysat et sonication cinq fois à 40% d'amplitude pendant 10 secondes chacun. Gel-dégel dans l'azote liquide à trois reprises.
    3. Centrifuger à 14000 xg pendant 15 minutes et recueillir le surnageant.Préparer le 2,2'-azino-bis (6-3-éthylbenzothiazoline-sulfonique) (ABTS) en mélangeant une solution ABTS, 5 ml de citrate de sodium (1 M dans l'eau), 0,1 ml de peroxyde d'hydrogène, et 45 ml de bi -eau distillée.
    4. Mélanger 0,1 ml de chaque surnageant avec ml de ABTS solution à 0,1 dans une plaque à 96 puits à fond plat. Au bout de 10 min, mesurer l'absorbance à 460 nm en utilisant un spectrophotomètre.

    10. L'évaluation de l'expression de cytokines pro-inflammatoires par PCR

    1. L' homogénéisation tissulaire
      1. Homogénéiser 50 à 100 mg d'échantillons de tissus du côlon dans 1 ml d'un mélange de thiocyanate de guanidinium-phénol-chloroforme acide à l'aide d'un homogénéiseur de puissance.
      2. Incuber à température ambiante pendant 15 min.
    2. séparation de phase
      1. Ajouter 0,2 mL de chloroforme et agiter vigoureusement pendant 30 s.
      2. Incuber à 4 ° C pendant 30 min.
      3. Centrifugeuse à 12.000 xg pendant 60 min à 4 ° C.
      4. Transférer le uphase aqueuse pper dans un nouveau tube (~ 500 pi).
    3. ARN Précipitation et resuspension
      1. Ajouter 0,5 ml d'alcool isopropylique et on incube les échantillons à 4 ° C pendant 60 min.
      2. Centrifugeuse à 12.000 xg pendant 30 min à 4 ° C.
      3. Retirer le surnageant complètement.
      4. Ajouter 1 ml d'éthanol à 75% et le vortex.
      5. Centrifugeuse à 12.000 xg pendant 30 min à 4 ° C.
      6. Retirer le surnageant.
      7. Laisser l'éthanol restant sécher à l'air pendant 3-5 min.
        NOTE: Il est important de ne pas laisser le culot d'ARN sécher complètement, car cela va grandement diminuer sa solubilité.
      8. Re-dissoudre le culot dans 0,3 ml de pyrocarbonate de diéthyle (DEPC) de l'eau -Traité. transcrire immédiatement les échantillons d'ARN en ADNc (plus stables, voir étape 10.5) ou conserver à -80 ° C.
    4. ARN Quantification
      1. Diluer 1 ul d'ARN avec 99 pi d'eau traitée au DEPC.
      2. Lire le DO à 260 nm et 280 nm en utilisant un spectrophotomètre UV / VIS pour déterminer la concentration de l'échantillon et la pureté.
    5. Synthèse d' ADNc
      1. Mélanger les échantillons d' ARN (1-5 pg) avec 1 pi d'oligo (dT) 12-18 (0,5 ug / ul) et de l' eau traitée au DEPC (volume total de 12 ul) dans des tubes stériles sans RNase.
      2. Incuber à 70 ° C pendant 10 min.
      3. Ajouter 2 ul de tampon de PCR 10x, 1 pi de 50 mM de MgCl2, 1 ul de mélange dNTP 10 mM et 2 ul de 0,1 M de dithiothréitol (DTT).
      4. Incuber à 4 ° C pendant 5 min.
      5. Ajouter 1 pi de transcriptase inverse et on incube à 42 ° C pendant 5 min.
      6. Incuber à 70 ° C pendant 15 min.
      7. Incuber à 4 ° C pendant 15 min. ADNc peut être stocké à -20 ° C jusqu'à utilisation ultérieure.
    6. PCR
      1. Mélanger 2,5 pi de tampon de PCR 10x, 1,5 pi de MgCl2 25 mM, 0,5 ul de dNTP 10 mM , mélange, 0,25 μL d'ADN polymerase Taq, 0,25 ul de chaque amorce (10 pM) et de l'ADNc (100 ng) et de l'eau stérile pour obtenir un volume total de 25 ul.
      2. Exécutez les échantillons sur un cycleur thermique à 96 puits. Pour éviter l'amplification de l'ADN génomique, amorces directe et inverse devraient être situés dans différents exons: IL1β-FW: GCAACTGTTCCTGAACTCAACT et IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA et IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT et KC-RE: CCTGAGGGCAACACCTTCA; et Actine-FW: TATCCACCTTCCAGCAGATGT et Actine-RE: AGCTCAGTAACAGTCCGCCTA. En utilisant les conditions de PCR suivantes: 95 ° C pendant 5 minutes suivie de 30 cycles à 95 ° C pendant 15 s, 58 ° C pendant 30 s et 72 ° C pendant 30 secondes, ainsi que d'une extension finale pendant 10 min à 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Diet suppléments peuvent protéger du DSS Colite

des suppléments diététiques anti-inflammatoires et anti-oxydants tels que la vitamine C, la vitamine E, l'oxyde nitrique (NO) -source L-arginine, et les acides gras co3 poly-insaturés (co3-PUFA), ont été utilisés avec un succès variable dans l'animal modèles pour atténuer les signes de maladies inflammatoires 3,6,15. La malnutrition, le stress oxydatif, et la production de cytokines pro-inflammatoires peuvent déclencher à la fois la colite aiguë et chronique 3. Dans une étude antérieure, nous avons démontré que la combinaison de micronutriments a montré des effets protecteurs contre la colite induite par DSS-in vivo. Ici, nous fournissons des protocoles détaillés sur la façon dont ces effets ont été mesurés 8. Tout d'abord, nous avons analysé les effets de suppléments nutritionnels sur la progression de la maladie en déterminant l'indice d'activité de la maladie (DAI), constitué par les trois paramètres de perte de poids,la consistance des selles, et des saignements périanale. Des résultats représentatifs ont montré que le traitement conduit à une DSS DAI continuellement croissante, comme prévu, pour atteindre un maximum de 8,2 ± 0,46 à sept jours (figure 1A). Anti-inflammatoire suppléments alimentaires a retardé le début de la colite, mais à des moments plus tard, quand la colite a été très forte, l'effet protecteur était marginal et non plus statistiquement significative, ce qui suggère que les suppléments alimentaires ne sont efficaces que lorsque la colite est pas encore trop forte. Surtout, l' intervention diététique peut empêcher l'augmentation induite par DSS de la perméabilité epitheliale intestinale, ce qui est une caractéristique importante de la colite (figure 1B). La colite DSS a conduit à des longueurs de côlon réduits, et ce raccourcissement a également été améliorée par le complément anti-inflammatoire et anti-oxydant alimentation (figure 1C). Ainsi, les symptômes cliniques de colite peuvent en effet être atténués par des changements dans la composition du régime alimentaire.

Pour analyser pourquoi la colite progression a été moins sévère chez les animaux recevant un supplément de régime alimentaire, la morphologie des tissus a été étudiée après hématoxyline / éosine (H / E) coloration des tissus du côlon distal paraffine. Les échantillons de contrôle ont montré une morphologie normale (figure 2A, panneau supérieur), alors que les animaux traités avec 3,5% DSS ont montré des signes typiques de la colite (ie, infiltration leucocytaire, la formation d'oedème, la dysplasie crypte, et ulcérations; Figure 2A, panneau du milieu). À noter, le traitement parallèle avec le régime supplémentation clairement atténué les changements morphologiques induits par la colite, avec une morphologie globale qui était plus comparable au groupe témoin (figure 2A, panneau inférieur). Ces observations étaient très semblables à ce qui a étérapporté pour les co-traitements avec des bactéries probiotiques 13 et montrent clairement que les changements dans le régime alimentaire peut contrecarrer le développement de la colite.

Nous savions déjà que la perméabilité épithéliale intestinale induite par la colite pourrait être contrecarrée par la diète supplémentation. perméabilité accrue est une caractéristique de l'EIA, et il est en grande partie causée par le démontage des jonctions adhérentes de stabilisation (AJ) et des jonctions serrées (TJ). Déstabilisation de contacts de cellules épithéliales de l'intériorisation des protéines de jonction est induite par des cytokines pro-inflammatoires, qui sont abondamment produites au cours de la colite 16. Nous avons trouvé que, grâce à la coloration immunofluorescente du tissu du côlon distal, que les TJ molécule zonula occludens-1 (ZO-1) et la molécule AJ E-cadhérine ont été internalisés pendant la colite induite par DSS et que la co-localisation de ces protéines a été partiellement perdue au contact des cellules épithéliales des cryptes (figure 2B). jemportantly, intériorisation de la E-cadhérine et ZO-1 a été réduite lorsque les souris traitées DSS ont été co-traitée avec un supplément anti-inflammatoire et anti-oxydantes alimentation (figure 2B). Dans l'ensemble, les structures glandulaires et de jonction sont plus comparables aux témoins, lorsque le supplément de régime a été appliqué, ce qui suggère que l'effet protecteur observé était au moins en partie due à la préservation de l'architecture tissulaire.

Dietary Intervention Peut Contrer inflammatoire neutrophiles recrutement, le stress oxydatif et la production de cytokines pro-inflammatoires

Une autre caractéristique de l'IBD est incontrôlée infiltration de neutrophiles. Neutrophiles recrutés contribuent à une lésion tissulaire par la production et la libération d' espèces réactives de l' oxygène (ROS) et des proteases 17. L'utilisation d'un dosage de l'activité MPO, nous avons trouvé le recrutement de neutrophiles forte dans le côlon en réponse à DSS, qui a été contrecarréepar le régime alimentaire de suppléments (figure 3A).

Le stress oxydatif est une autre caractéristique importante de la colite, causée par la libération de ROS de neutrophiles recrutés. Ainsi, nous avons analysé la production de ROS dans le côlon sections transversales. La figure 3B montre que le traitement DSS a fortement augmenté le stress oxydatif. À noter, les changements dans le régime alimentaire complètement empêché DSS induite par le stress oxydatif (figure 3B), qui est très probablement une conséquence du recrutement des neutrophiles réduite (figure 3A).

Les cytokines pro-inflammatoires et des chimiokines sont fortement produites par divers types cellulaires au cours de la colite 18. Ces médiateurs inflammatoires contribuent au recrutement et à la protéine de jonction intériorisation-fonctions neutrophiles que nous savions déjà pourrait être atténué par des changements dans le régime alimentaire. Analyse de l'expression de l'ARNm par RT-PCR a révélé que le DSSaugmentation de l'expression de l' IL1β, l' IL-6 et de chimiokines kératinocytaire dérivée (KC), comme attendu (figure 3C), et que l' anti-inflammatoire suppléments alimentaires diminue cette augmentation induite par le DSS (figure 3C). Ces données impliquent que les compléments alimentaires peuvent en effet servir à lutter contre les signes cliniques de la MII.

Figure 1
Figure 1. Les suppléments nutritionnels peuvent atténuer la maladie Activity Index, Intestinal épithéliale Perméabilité et Colon shortening. (A) L'indice d'activité de la maladie (DAI, les valeurs de 0-12) se compose des trois paramètres de perte de poids, la consistance des selles, et des saignements périanales et a été enregistrée quotidiennement dans les groupes expérimentaux de contrôle (ctrl), la colite, et la colite + supplément nutritionnel (colite + suppl.). Le groupe de contrôle n'a pas montré de signes de colite, résultant en un DAI de 0 throughout la période expérimentale. n = 5 par groupe. (B) la perméabilité épithéliale intestinale a été mesurée par une fuite de bleu Evans dans les groupes expérimentaux mentionnés ci - dessus et a été exprimée comme l'absorption à 620 nm par gramme de tissu. n = 8 par groupe. Toutes les données sont présentées comme la moyenne ± l'écart type de la moyenne (SDM). * P <0,05; ** P <0,01; *** P <0,001. Les statistiques ont été calculées par une analyse de variance. (C) des images représentatives de côlons entiers des groupes expérimentaux respectifs après 7 jours de traitement. L'échelle de gauche est en cm. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. Tissue Morphologie et Junction architecture sont mieux préservées au cours Colite lors de l' application nutritionnelle Supplements. (A) 5 um paraffine section transversale de biopsies de tissus provenant côlons distales des groupes expérimentaux respectifs ont été colorées à l' hématoxyline / éosine et analysé pour déterminer des signes typiques de la colite, tels que la formation d'oedème (flèches), l' infiltration leucocytaire (têtes de flèches), et une ulcération (*). la morphologie du tissu global de la colite + suppl. groupe plus ressemble à celle du contrôle que le groupe de la colite, ce qui prouve un effet protecteur global contre DSS colite. Les images sont représentatives de 3 préparations de tissus indépendants par groupe. Les images ont été prises en utilisant un objectif 10X. Bar = 100 um. (B) 8 pm côlon cryo-sections des groupes respectifs ont été colorées avec des anticorps contre ZO-1 (vert) et E-cadhérine (rouge). La co-localisation (jaune dans les images fusionnées, des flèches) de la E-cadhérine et ZO-1 au contact des cellules épithéliales glandulaires, qui est perdue au cours de la colite, est essentiellement conservée dans la colite + Suppl. groupe. Les images sont représentatives de 3des préparations de tissus indépendants. Bar = 50 pm. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. neutrophiles recrutement, le stress oxydatif et la production de cytokines pro-inflammatoires peuvent être réduits par des suppléments nutritionnels. (A) myéloperoxydase (MPO) L' activité a été mesurée afin d' analyser la quantité de recrutement des leucocytes dans les tissus du côlon dans les groupes expérimentaux: le contrôle (CTRL), la colite et la colite + supplément nutritionnel (colite + suppl.). n = 5 par groupe; * P <0,05. Les données sont montrées comme la moyenne ± SDM. Les statistiques ont été calculées par une analyse de variance. (B) La fluorescence de l' éthidium oxydé, représenté en rouge comme la mesure du stress oxydatif dans les 8 um cryo-sections de coles tissus lon, a été enregistrée par microscopie confocale laser. Les images sont représentatives de 3 préparations de tissus indépendants. Bar = 100 um. (C) La production des cytokines pro-inflammatoires IL1β et de l' IL-6 et la chimiokine KC a été déterminée par semi-quantitative par RT-PCR dans un gel d'agarose à 1,5% ( en noir et blanc , on revient par souci de clarté). β-actine a servi comme gène de ménage. Des images représentatives de trois préparations d'ADNc indépendants sont représentés. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Afin d'utiliser des suppléments nutritionnels dans les études cliniques, les avantages et la sécurité de ces suppléments doivent être soigneusement évalués in vivo dans des études animales. Dans le cas de colite, plusieurs modèles animaux appropriés qui ressemblent aux signes cliniques de MII ont été établis, y compris les modèles chimiques à l'aide de DSS, TNBS, ou l'acide acétique; knock-out (KO) des modèles tels que IL10-KO; et la colite immunitaire à médiation cellulaire en utilisant le transfert de cellules T adoptive 19-21. Le modèle de la colite DSS est une méthode rapide et fiable d'induire la colite qui ressemble à de nombreux symptômes de la maladie de l' IBD humaine et a été utilisé dans une pléthore d'études portant sur les mécanismes moléculaires de la colite 22. En outre, la colite DSS est réversible et permet donc également l'étude de la cicatrisation des tissus après le stimulus colitogenic a été supprimée. Le protocole fourni décrit en détail le modèle de la colite DSS qui a déjà été optimisé dans notre laboratoire 8.

23. En outre, le MAS doit être dans une plage de poids moléculaire de 40 - 50 kDa pour induire la colite. Pour le chercheur inexpérimenté, il sera important de développer un oeil pour une évaluation impartiale des paramètres DAI de la consistance des selles et des saignements périanale. Si l'évaluation est effectuée par un chercheur inexpérimenté, il est recommandé d'avoir un collègue confirmer l'évaluation, idéalement en aveugle.

Pour analyser la perméabilité intestinale épithéliale pour les macromolécules, trois méthodes principales ont été utilisées dans la littérature: le dosage Evans de colorant bleu, comme décrit ici; l'instillation de 4 kDa FITC-dextran dans une anse intestinale; et l'alimentation 13,24,25 4 kDa FITC-dextran. Dans ce dernier essai, FITC-dextran est alimenté par gavage, Et la quantité de FITC dextran qui a traversé l'épithélium et une fuite dans le flux de sang est mesurée par fluorométrie à partir d'échantillons de sérum. Dans cet essai, la perméabilité de l'ensemble du tractus gastro-intestinal est mesurée, puisque le traceur passe tout le chemin de l'oesophage jusqu'au rectum et la plupart du traceur passe avant d'atteindre le côlon. Dans le modèle de boucle, la perméabilité est mesurée dans une région confinée intestinale utilisé pour la boucle (généralement de l'intestin grêle) 25. En revanche, le dosage de bleu Evans a l'avantage que seule la perméabilité épithéliale du côlon est mesurée, étant donné que le traceur est directement instillé dans l'ensemble du côlon. Ainsi, en utilisant cet essai, on peut conclure que l'épithélium colique est protégé par le supplément de régime.

Il est toujours important d'enregistrer le poids du côlon et de la longueur après extraction et avant d' utiliser les tissus pour d' autres essais, parce que certaines données (par exemple, une fuite bleu Evans dans le assa de perméabilitéy) sont exprimées par gramme de tissu. En outre, le rapport poids-longueur est une lecture indépendante des lésions tissulaires 26. D'une manière générale, la morphologie du tissu est analysée en utilisant des tissus inclus dans la paraffine colorées à l'hématoxyline et à l'éosine, comme décrit ici. Inclusion dans la paraffine présente l'avantage que la morphologie du tissu est beaucoup mieux conservée par rapport à d'autres procédés d'enrobage. Cela permet l'identification univoque des différents types de cellules dans la muqueuse ( par exemple, des cellules immunes, épithéliales, les cellules caliciformes, etc.) et l'analyse des altérations des tissus au cours de la colite, telles que la formation d'oedèmes, une infiltration de leucocytes, et des érosions apical épithéliales. D'autre part, la paraffine présente l'inconvénient que la coloration immunofluorescente ne peut être réalisée après récupération d'épitope de temps. Par conséquent, nous préparons toujours différentes biopsies de tissus congelés incorporés dans le composé octobre Ces échantillons de tissus peuvent être facilement sectionnés à l'aide d'un cryostat et montrent de faibles niveaux d'autofluorescence. Nous utilisons l'éthanol pour la fixation par la déshydratation parce que ni n'interfère avec les filaments d'actine (comme le méthanol ne), ni ne déclenchons autofluorescence (PFA fait). En utilisant ces techniques, on a trouvé qu'un supplément diététique anti-inflammatoire et anti-oxydant permet d' améliorer la morphologie du tissu et de l' architecture de jonction au cours de la colite (cf. figure 2).

Recrutement des neutrophiles excessif est un événement critique au cours de la colite qui est induite par la production d'agents chimio - attractifs , en réponse à l' inflammation 17. recrutement des neutrophiles est un événement physiologique car les neutrophiles contribuent à l'élimination de la queue inflammatoire et de la guérison des plaies suivant. Cependant, si cette réponse immunitaire innée est mal contrôlée et terminée, neutrophiles dans la muqueuse peuvent contribuer à des lésions tissulaires par les protéases de libération et les espèces réactives de l'oxygène. Neutrophiles contiennent FTU, qui peuvent être facilement mesurés et quantifiés à l'aide d'undosage colorimétrique, où la quantité de MPO est directement proportionnelle au nombre de neutrophiles. La figure 3A montre que les augmentations de recrutement neutrophiles pendant la colite et que l' intervention alimentaire peut empêcher cette réponse immunitaire excessive et incontrôlée. Conformément à la présence abondante de neutrophiles dans la muqueuse, le stress oxydatif augmente au cours de la colite (figure 3B).

Notre alimentation supplémentation protège clairement la muqueuse du stress oxydatif, ce qui est très probablement une conséquence du recrutement des neutrophiles réduite. Comme mentionné précédemment, les neutrophiles sont attirés par les chimiokines, la production de chimiokines est induite par des cytokines pro-inflammatoires qui sont sécrétées par différents types cellulaires au cours de la colite. Ainsi, nous avons supposé que le recrutement de neutrophiles réduite est une conséquence de cytokines réduite et la production de chimiokine. La figure 3C montre que les cytokines pro-inflammatoires IL-1β et de l' IL-6, ainsi que lechimiokine KC, sont régulés à la hausse au cours de la colite induite par DSS. Le supplément de régime alimentaire a inversé les niveaux d'IL-6 de retour pour contrôler les niveaux et amélioré la production accrue de IL-1β et KC. Il convient de noter, KC est le plus important chimiotactique pour les neutrophiles chez la souris.

Ainsi, il est tentant de spéculer que la conservation observée de la morphologie du tissu est due à une réduction de l'infiltration de neutrophiles, ce qui est, à son tour, une conséquence de la diminution de la production de KC. L'analyse de la production d'ARN dans les tissus DSS traités par RT-PCR est problématique lorsque le DSS résiduel est présent dans l'ARN isolé. En effet, DSS inhibe les deux transcriptases inverses et Taq-polymérases. Si aucune amplification ne peut être atteint, il est nécessaire de purifier davantage les échantillons d'ARN par précipitation de LiCl à médiation tel que décrit ailleurs 27.

En résumé, nous décrivons en détail les différentes méthodes pour l'analyse des lésions tissulaires pendant DSS colite et la façon dont ce dAmage peut être améliorée par des suppléments diététiques. Les connaissances acquises à partir de ces expériences sur les animaux peuvent justifier la mise en place de cohortes de patients pour étudier les effets protecteurs des suppléments analysés dans les MICI humaine. Les données obtenues à partir d'études cliniques peuvent alors ouvrir de nouvelles voies pour développer des stratégies de traitement alternatives pour la gestion des MII.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgments

Ce travail a été soutenu par des subventions du Conseil mexicain pour la science et la technologie (Conacyt, 207268 et 233395 à Michael Schnoor). KFCO est récipiendaire d'une bourse Conacyt (396,260) pour obtenir un diplôme MSc.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Analyse Effets bénéfiques des suppléments nutritionnels sur les fonctions épithéliales intestinales barrière Pendant Experimental Colite
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter